Whole-genome sequence analysis of Bipolaris sorokiniana infecting wheat in India and characterization of ToxA gene in different isolates as pathogenicity determinants

Abstract

Spot blotch disease of wheat caused by Bipolaris sorokiniana Boerma (Sacc.) is an emerging problem in South Asian countries. Whole genome of a highly virulent isolate of B. sorokiniana BS112 (BHU, Uttar Pradesh; Accession no. GCA_004329375.1) was sequenced using a hybrid assembly approach. Secreted proteins, virulence gene(s), pathogenicity-related gene(s) were identified and the role of ToxA gene present in this genome, in the development of disease was recognized. ToxA gene (535 bp) was analyzed and identified in the genome of B. sorokiniana (BS112) which revealed 100% homology with the ToxA gene of Pyrenophora tritici repentis (Accession no. MH017419). Furthermore, ToxA gene was amplified, sequenced and validated in 39 isolates of B. sorokiniana which confirmed the presence of ToxA gene in all the isolates taken for this study. All ToxA sequences were submitted in NCBI database (MN601358-MN601396). As ToxA gene interacts with Tsn1 gene of host, 13 wheat genotypes were evaluated out of which 5 genotypes (38.4%) were found to be Tsn1 positive with more severe necrotic lesions compared to Tsn1-negative wheat genotypes. In vitro expression analysis of ToxA gene in the pathogen B. sorokiniana using qPCR revealed maximum upregulation (14.67 fold) at 1st day after inoculation (DAI) in the medium. Furthermore, in planta expression analysis of ToxA gene in Tsn1-positive and Tsn1-negative genotypes, revealed maximum expression (7.89-fold) in Tsn1-positive genotype, Agra local at 5th DAI compared to Tsn1-negative genotype Chiriya 7 showing minimum expression (0.048-fold) at 5th DAI. In planta ToxA–Tsn1 interaction studies suggested that spot blotch disease is more severe in Tsn1-positive genotypes, which will be helpful in better understanding and management of spot blotch disease of wheat.

Supplementary Information

The online version contains supplementary material available at 10.1007/s13205-022-03213-3.

Introduction

Wheat is considered as staple and a leading source of protein in human food. Wheat production throughout North and South Asia is affected by several abiotic and biotic stresses. Among biotic stresses, an important wheat disease throughout North and South Asia is spot blotch, caused by Bipolaris sorokiniana. Various other diseases are also caused by this fungus like foliar blight, common root rot, black point and seedling blight of barley and wheat (Zillinsky 1983; Wiese 1998). However, spot blotch of wheat is one of the most important diseases which is prevalent in areas having high temperature and high humidity (Ginkle and Rajaram 1993). Almost 9 million ha of land is affected by spot blotch in India (Nagarajan and Kumar 1998) causing 14.9% (approx.) yield loss (Alam et al. 1998; Kumar et al. 2015). B. sorokiniana is an aggressive fungal pathogen that causes small, brown colored lesions on leaves with a length of 1–2 mm without chlorotic margin. These lesions become dark brown in 4–5 days and extend to several centimeters in susceptible genotypes inducing leaf abscission. Environmental factors play an important role in disease severity. In India, late sown wheat crop is highly vulnerable to this disease due to temperature which ranges between 26 and 30 °C (Chaurasia et al. 2000).

In the past, it was believed that spot blotch is caused due to combined effect of three species i.e. Alternaria triticina, Helminthosporium sativum and Pyrenophora tritici-repentis (Maraite et al. 1998). But later studies revealed that it is mainly caused by a hemibiotroph aggressive pathogen, B. sorokiniana. At the seedling stage, this disease appears and increases as the plant grows, with more severity. As this pathogen infects the leaf, conidium germination was observed on the leaf surfaces followed by a germ tube to form a rudimentary appresorium. This infection hypha either directly penetrates the cuticle and epidermal cell wall or through stomata (Kumar et al. 2002; Aggarwal et al. 2008). Many non-selective toxins and hydrolytic enzymes are produced by B. sorokiniana which form lesions on the leaf, leading to necrosis (Gayad 1961; Jahani et al. 2014).

Metabolites produced by B. sorokiniana are considered toxins that play an important role in disease development. During 1990, ToxA was discovered in Parastagonospora nodorum, causing septoria nodorum blotch (SNB) which horizontally got transferred to P. tritici-repentis causing tan spot (Friesen et al. 2006; Stukenbrock and McDonald 2007). ToxA was reported to be unique to P. tritici-repentis but not conserved in its genome (Moolhuijzen et al. 2018). Recently, ToxA gene was discovered in Australian B. sorokiniana isolates (McDonald et al. 2018) and also in the B. sorokiniana population of the United States (Friesen et al. 2018). According to Gupta et al. (2017) effector-triggered susceptibility was identified in wheat- B. sorokiniana pathosystem where ToxA (virulence gene) utilizes Tsn1 (sensitivity gene) in the host, which helps fungus to cause disease by invading the host. Necrosis was induced on wheat leaves of ToxA-sensitive wheat genotypes (possessing the Tsn1 susceptibility gene) (Faris et al. 2010). According to McDonald et al. (2018) also, presence of sensitivity gene Tsn1 in wheat generally helps a ToxA-positive pathogen to cause spot blotch disease and ToxA functions in a Tsn1-dependent manner. In general, the ToxA–Tsn1 system is a prototype of an inverse gene-for-gene relationship (Navathe et al. 2020).

Using whole-genome sequencing, host–pathogen interactions at the molecular level in several pathosystems, synthesis of secondary metabolites through genes encoding enzymes and other proteins which are involved in virulence, can be identified. Till now, whole-genome sequences of seven B. sorokiniana isolates are available. Aggarwal et al. (2019) announced the whole genome of a highly virulent strain of B. sorokiniana (BS112) Indian isolate (RCTM00000000) with a genome assembly size of 35.64 Megabytes (37.38 Million base pair). This whole-genome de novo sequence of Indian wheat isolate of B. sorokiniana represents the first genome-scale assembly for B. sorokiniana. However, detailed sequence analysis for the pathogenicity-related genes, carbohydrate-active enzymes and comparative analysis with other isolates is not available yet which will be helpful to understand how Indian isolate is different from other isolates. Navathe et al. (2020) reported ToxA gene in 70% of Indian isolates. However, copy number, and expression dynamics of ToxA gene in pathogen and in planta is not understood yet. Therefore, ToxA gene in Indian population of B. sorokiniana was characterized and its expression dynamics was established in Tsn1-positive and Tsn1-negative genotypes.

Materials and methods

Establishment of fungal cultures and DNA extraction

Wheat infected leaves were collected from different regions of India (Table 1). For the isolation of the pathogen, infected leaves were surface sterilized and necrotic lesions were cut into smaller fragments. These fragments were washed with 1% sodium hypochlorite (NaOCl₂) solution, followed by washing twice with sterilized water. To induce sporulation, these fragments were placed on PDA (potato dextrose agar) poured petri plates under a 12 h photoperiod at 25 °C. Several single spores from each of the PDA poured petri plates were observed under microscope and single spore cultures were established. The pathogen was identified based on conidia morphology (Aggarwal et al. 2009, 2010). After confirmation, cultures of different isolates were maintained on PDA slants for further use.

Table 1.

Details of B. sorokiniana isolates collected from different regions of India

S.No	Agroclimatic zone	Location/state	Centre name	Designated name of isolate	Accession no
1	North Hills zone	Pantnagar (Uttarakhand)	_	BS-1	MN601358
2	North Western plains zone	Asandh, panipat (HR)	Asandh -1	BS-3	MN601359
3	North Eastern plains zone	Faziabad, Ayodhya (UP)	Faizabad-1	BS-4	MN601360
4	North Western plain zone	Karnal (HR)	DWR-1, BS-2	BS-6	MN601361
5	North Hills zone	Almora (Uttarakhand)	Almora UPAS-1	BS-11	MN601362
6	North Western plains zone	Karnal (HR)	Jaipur-6	BS-14	MN601363
7	North Eastern plains zone	Faziabad, Ayodhya (UP)	Faizabad-1	BS-27	MN601364
8	North Eastern plains zone	Faziabad, Ayodhya (UP)	Faizabad-3	BS-29	MN601365
9	North Eastern plains zone	Faziabad, Ayodhya (UP)	Faizabad-4	BS-30	MN601366
10	North Eastern plains zone	Faziabad, Ayodhya (UP)	Faizabad-6	BS-32	MN601367
11	North Eastern plains zone	Faziabad, Ayodhya (UP)	Faizabad-7	BS-50	MN601368
12	North Hills zone	Almora (Uttarakhand)	Almora UPAS-1	BS-54	MN601369
13	Peninsular zone	Mahabaleshwar (MS)	Mahabaleshwar	BS-65	MN601370
14	Peninsular zone	Mahabaleshwar (MS)	Mahabaleshwar -1a	BS-66	MN601371
15	Peninsular zone	Pune (MS)	IARI, Pune-1	BS-68	MN601372
16	Peninsular zone	Pune (MS)	IARI, Pune-1	BS-69	MN601373
17	Peninsular zone	Dharwad (KN)	Dharwad-1	BS-72	MN601374
18	Southern Hill Zone	Wellington, Tamil nadu	Wellington (Nilgiri-2)	BS-75	MN601375
19	Southern Hill Zone	Wellington, Tamil nadu	K8	BS-88	MN601376
20	Southern Hill Zone	Wellington, Tamil nadu	11 K-7	BS-91	MN601377
21	Southern Hill Zone	Wellington, Tamil nadu	R-3	BS-94	MN601378
22	North Eastern Plains Zone	Varanasi, Uttar pradesh	BHU	BS-112	MN601379
23	North Eastern Plains Zone	Varanasi, Uttar pradesh	_	BS-124	MN601380
24	North Western plains zone	New Delhi	IARI	BS-125	MN601381
25	North Western plains zone	New Delhi	IARI	BS-126	MN601382
26	North Western plains zone	New Delhi	IARI	BS-127	MN601383
27	North Western plains zone	New Delhi	IARI	BS-128	MN601384
28	North Eastern Plains Zone	Masodha, Uttar pradesh	Masodha	BS-129	MN601385
29	North Eastern Plains Zone	Kanpur, Uttar pradesh	Kanpur	BS-130	MN601386
30	North Western plains zone	New Delhi	IARI	BS-131	MN601387
31	North Western plains zone	Karnal (HR)	_	BS-132	MN601388
32	Southern Hill Zone	Wellington, Tamil nadu	_	BS-133	MN601389
33	North Western plains zone	New Delhi	IARI	BS-134	MN601390
34	Southern Hill Zone	Wellington, Tamil nadu	_	BS-135	MN601391
35	North Western plains zone	New Delhi	IARI	BS-136	MN601392
36	North Western plains zone	New Delhi	IARI	BS-137	MN601393
37	Southern Hill Zone	Wellington, Tamil nadu	_	BS-138	MN601394
38	North Western plains zone	New Delhi	IARI	BS-139	MN601395
39	North Western plains zone	New Delhi	IARI	BS-140	MN601396

Thirty-nine isolates of B. sorokiniana were established from infected wheat leaf samples collected from different regions of India. These cultures were grown in potato dextrose broth (PDB) and incubated at 25 °C with periodical shaking. After 1 week, the mycelial mat (0.2 g) from each isolate, was harvested aseptically and snap frozen in liquid nitrogen. Frozen mycelia were subjected to DNA extraction using CTAB method (Murray and Thompson 1980).

Genome sequencing and hybrid assembly

In this study, the data sets were compiled from the initial draft genome assembly of B. sorokiniana (BS112) causing spot blotch of wheat (Aggarwal et al. 2019). The Genome of B. sorokiniana isolate BS112 was sequenced by using Illumina Hiseq, Oxford Nanopore Sequencing and Ion-Torrent platform technologies. The Illumina reads were pre-processed using Trim-galore (Krueger 2015), and Nano pore fast5 data were base called using Albacore (Sahoo 2017). Hybrid genome assembly was created using MaSuRCA tool (Zimin et al. 2013). Later using pyScaf, the contigs were processed (Bryant et al. 2018).

Gene prediction, annotation and pathway analysis

Genes were predicted in the genome of B. sorokiniana using AUGUSTUS annotation tool (Stanke and Morgenstern 2005). Functional annotations of genes were performed using BLASTx tool (Altschul et al. 1990). The predicted proteins were searched against NCBI-BLAST-2.2.29 + blastp program with an e-value of 1e-5 for gene ontology and annotation. Around 98% of predicted genes were annotated against the protein database (UniprotKB). Protein domain analysis was widely done using the Pfam database (Finn et al. 2014). HMMER 3.0 was used to infer Pfam domains. From derived protein sequences, in total, 12,082 proteins domains were found to be associated. The gene ontology annotation was done for fungal hybrid assembly in biological, chemical and molecular functions. Pathogen–host interaction database (PHI database) was used to classify the putative pathogenicity-related genes. The pathway analysis of the predicted genes was performed through KEGG database (Kanehisa et al. 2017).

Phylogenetic analysis among B. sorokiniana isolates

Complete fungal genome assemblies available for B. sorokiniana isolates in NCBI were used for phylogenetic analysis. Seven genomes of B. sorokiniana isolates namely; BS112 (Gen bank: RCTM01000006.1), BRIP10943a (Gen bank: CM017956.1), WAI2406 (Gen bank: CM018002.1), WAI2411 (Gen bank: CM017972.1), BRIP27492a (Gen bank: CM017986.1), ND90Pr (Gen bank: NW_006911895.1), Shoemaker (Gen bank: WNKQ01000001.1) and one isolate of P. tritici-repentis (Gene bank: NQWZ01000001.1, Strain- AR_CrossB10) as outgroup were taken for this purpose. Genomic distances between pair of genomes were calculated using mash distance matrix dashing tool (Ondov et al. 2016). Phylogenetic tree was created using MEGA X (Kumar et al. 2018) (Table 2).

Table 2.

Summary of Bipolaris sorokiniana genomes used in this study

S.No.	Organism	Strain	Isolation source	Host	Assembly name	Accession no.	Size (Mb)	GC%	Scaffold	References
1	Bipolaris sorokiniana	BS112	Infected leaves	Wheat	ASM432937v1	GCA_004329375.1	37.38	49.4	43	Aggarwal et al. (2019)
2	Bipolaris sorokiniana	WAI2406	Mycelium	Wheat	ASM845270v1	GCA_008452705.1	36.89	49.44	21	McDonald et al. (2019)
3	Bipolaris sorokiniana	BRIP10943a	Mycelia and spores	Wheat	ASM845273v1	GCA_008452735.1	36.92	49.53	22	McDonald et al. (2019)
4	Bipolaris sorokiniana	BRIP27492a	Mycelia and spores	Barley	ASM845272v1	GCA_008452725.1	35.24	49.45	19	McDonald et al. (2019)
5	Bipolaris sorokiniana	WAI2411	Mycelium	Wheat	ASM845271v1	GCA_008452715.1	36.24	49.5	21	McDonald et al. (2019)
6	Bipolaris sorokiniana	(Sacc.) Shoemaker	Gansu	Wheat	ASM1341676v1	GCA_013416765.1	34.33	48.1	96	Unpublished
7	Bipolaris sorokiniana ND90Pr	ND90Pr	leaves	Barley	Cocsa1	GCA_000338995.1	34.41	49.8	154	Ohm et al. (2012)

Comparative genome annotation of orthologous gene families

The four Bipolaris species namely Cochliobolus victoriae (B. victoriae) (Accession no. GCA_000527765, Strain- F13), C. miyabeanus (B. oryzae) (Accession no. GCA_000523455.1, Strain- ATCC 44560), C. sativus (B. sorokiniana; BS112), and C. carbonum (B. zeicola) (Accession no. GCA_000523435.1, Strain- 26-R-13) were evaluated for comparative genome annotation of orthologous gene families using OrthoVenn.

Secretome analysis

In the current study, secretome prediction of B. sorokiniana genome was performed using SignalP v4.1 in combination with TargetP v1.1 for all possible secreted proteins. These secreted proteins were examined for transmembrane (TM) spanning regions using TMHMM (TMHMM v2.0; http://www.cbs.dtu.dk/cgi-bin/nph-sw_request?tmhmm). The proteins located in the predicted N-terminal signal peptide is retained as 0 or 1 transmembrane region. Big-PI (http://mendel.imp.ac.at/gpi/cgi-bin/gpi_pred_fungi.cgi) is used to predict GPI-anchor proteins. Localization of the remaining proteins was predicted using ProtComp by LocDB and PotLocDB databases (ProtComp v8.0; http://www.softberry.com). After secretion, location of proteins was estimated using WoLFPSORT and analysis done by “run WolfPsort summary fungi” in the WoLFPSORT V0.2 package (70% specificity and sensitivity) (Horton et al. 2007). Blast2GO (Conesa and Gotz 2008) (http://www.blast2go.com/b2glaunch) was used to explore whether any additional gene annotation existed from protein set within the predicted refined secretome. From refined secretome, genes were identified which were further classified into six carbohydrate-active enzymes (CAZy) classes; polysaccharide lyases (PL), glycoside hydrolases (GH), carbohydrate esterases (CE), carbohydrate-binding modules (CBM), auxiliary activities (AA) and glycosyl transferases (GT) using CAZy database (http://www.cazy.org/).

Primer designing and amplification of ToxA gene

ToxA gene sequence-specific primers were designed from a genomic region of P. tritici-repentis isolate PTR-01, complete coding sequence (Accession no. MH017419) using integrated DNA technologies (IDT) primer designing tool (Svobodova et al. 2010). Amplification of ToxA gene from genomic DNA (B. sorokiniana isolates collected from different regions of India) was ensured using primer pair ToxA BS F 5′TCATGCGTTCTATCCTCGTA3′ and ToxA BS R 5′CTAATTTTCTAGCTGCATTCTCCA3′. The PCR conditions included initial denaturation at 95 °C for 5 min; followed by 39 cycles of amplification, each cycle with the following plan: denaturation at 94 °C for 30 s, annealing at 52 °C for 30 s, and extension at 72 °C for 1 min; followed by a final extension at 72 °C for 10 min. By gel electrophoresis (1.2%), PCR products were visualized. Amplified product was gel purified, sequenced and analyzed against the NCBI database. The amplicon sequencing was outsourced to Eurofins Genomics India Pvt. Ltd. (Bengaluru, India). The sequences obtained were aligned using BioEdit sequence alignment editor. Phylogenetic analysis was done using molecular evolutionary genetics analysis (MEGA-X), amongst plant pathogens viz. B. sorokiniana, P. tritici-repentis (Accession no. MH017419), Parastagonospora nodorum (CP022834), Phaeosphaeria avenaria (JX997418) species were inferred using the neighbor-joining method. In this study, the sequences of ToxA of various isolates were deposited in NCBI GenBank.

Tsn1 allelic status in Indian wheat genotypes and its pathogenicity assay

Thirteen wheat genotypes were taken which includes WH 542, WL 711, Agra Local, Suzoe, HD 29, PBW 343, HD 3086, Chiriya 7, HD 30, Milan, HD 2329, Ning 8139 and HD 2967. These 13 genotypes are further classified based on the presence or absence of Tsn1. To test ToxA–Tsn1 relationship, the collected wheat genotypes were grown and at two leaf stages pathogen B. sorokiniana (BS112) (positive for ToxA gene) was inoculated as foliar spray for which B. sorokiniana BS112 was grown on sorghum grains under aseptic conditions for 2 weeks. Inoculum was prepared and sprayed @10⁴ conidia/ml using hand atomizer. Inoculated seedlings were kept in moist chamber where the temperature was maintained at 25 °C, and > 80% of relative humidity (Aggarwal et al. 2009). Genomic DNA was isolated from above-mentioned wheat genotypes using CTAB method. PCR amplification was carried out using dominant marker Xfcp623 (F 5′CTATTCGTAATCGTGCCTTCCG3′ and R 5′CCTTCTCTCTCACCGCTATCTCATC3′) procured from intron five of Tsn1 gene at an annealing temperature of 57 °C. Amplicon presence infers Tsn1 and its absence infers tsn1.

Pathogenicity assay was done on 3-week-old seedlings of 13 different wheat genotypes as mentioned above. At 4 days post-inoculation, disease severity (%) was measured and calculated as per the scale; 0 = free of spots; 1 = up to 5% leaf area covered with necrotic spots; 2 = 6–20% of the leaf area covered; 3 = 21–40% of the leaf area covered; 4 = 41–60% of the leaf area covered; 5 = spots inclusion more than 60% of the leaf area covered.

Average disease index (ADI) was calculated using the formula:

$$\text{ADI}=\left(\left(\text{sum}\text{of}\text{ratings}\text{of}\text{each}\text{leave}\right)/\left(\text{total}\text{leaf}\ast 5\right)/100\right)$$

ADI was converted into disease responses viz. 0 = No infection; 0–10 = resistance response (R); 10.1–20 = moderately resistance (MR); 20.1–30 = moderately susceptible (MS); 30.1–50 = susceptible(S); and more than 50 = highly susceptible (HS) (Adlakha et al. 1984).

Expression analysis of ToxA under in vitro and in planta conditions

Expression analysis of ToxA gene was done following two conditions. For in vitro expression analysis of ToxA gene using qPCR, B. sorokiniana BS112 pathogen was grown in potato dextrose broth (PDB) and harvested at 1st, 2nd, 3rd, 4th and 5th day post-inoculation. For in planta gene expression analysis, pathogen (BS112—most aggressive isolate) was inoculated on resistant genotype (Chiriya 7) and susceptible genotype (Agra local) of wheat as per procedure mentioned above. The pots were kept in a moist chamber maintaining a temperature of approx. 25 °C and > 80% relative humidity. The inoculated leaf samples were collected at 1^st, 2nd, 3rd, 4th and 5th day post-inoculation, kept in aluminum foil, and immediately frozen in liquid nitrogen for further processing.

Total RNA was isolated from inoculated leaf samples and fungal mycelia (BS112) separately using Trizol (Invitrogen) reagent method as per the manufacturer’ guidelines. RNA quantification was done using Nanodrop. First-strand cDNA was synthesized using Revertaid cDNA synthesis kit (Thermo Fisher Scientific, Wilmington, USA) as per the manufacturer’ guidelines and was stored at − 20 °C for further use.

Quantitative gene expression was performed using primer pair ToxA_F TGCGTTCTATCCTCGTACTTC and ToxA_R GTGATTGACATGCAGCTTCC (designed using Integrated DNA Technologies (IDT) primer designing tool) to amplify the ToxA gene. A housekeeping EFN-1 alpha gene (EFN-1F CTTCTCGCCTACACCCTTG and EFN-1R CCTTCTCCCAACCCTTGTAC) was also used (Manamgoda et al. 2014). The designed primers were synthesized by Eurofins Genomics India Pvt. Ltd., Bengaluru, Karnataka, India.

The quantitative PCR was performed on 48-well plates mini opticon real-time PCR system (Biorad, Hercules, California, USA) with the following conditions: an initial activation step at 95 °C for 7 min; followed by 35 cycles of denaturation at 95 °C for 15 s, annealing at 53 °C for 30 s, and extension at 72 °C for 30 s; melt curve analysis of the PCR product was carried out at 72 °C for 1 min and ramped from 75 to 95 °C with a rise by 1 °C every 5 s. qPCR was done using SYBR Green PCR master mix (Fermentas) which includes 10 µl of SYBR Green PCR master mix, 10 nM of the appropriate primer (both EFN-1 alpha and ToxA) and 100 ng of template cDNA with a total of 20 µl reaction volume. Each experiment was carried out in triplicate with two technical replicates. Relative gene expressions were calculated in terms of fold changes using the ^ΔΔCt method (Livak and Thomas 2001).

Results

Genomic features of B. sorokiniana (BS112)

Whole-genome sequencing of B. sorokiniana (BS112) was performed using Illumina Hiseq (SRX6673824), Oxford Nanopore Sequencing (SRX6100476) and Ion-Torrent platform (SRX6673825) technologies. For the Illumina library preparation, TruSeq DNA PCR free kit was used with an insert size of 350 bp and 150 bp read size from both the ends. As a result of which 36,915,848 paired end reads were generated. Ion Xpress plus fragment library kit was used for fungal DNA shearing enzymatically into suitably sized fragments for Ion torrent library. A target peak of 330 bp was selected for adapter ligated library using E-gel seize select 2% agarose gel (Invitrogen Corporation, USA). Finally, Ion plus fragment library kit (Life technologies, USA) was used for adapter ligation, size selected library was amplified and the run was performed on an Ion PGM system version 1. As a result, 8,45,589 reads were obtained. Oxford nanopore platform library preparation was done using a ligation sequencing kit (SQK-LSK 108) from oxford nanopore technologies; as a result of which 5,60,150 reads were generated.

All three types of sequencing reads were incorporated in hybrid genome assembly pipeline using the MaSuRCA tool version 3.2.2 (7) to produce a draft genome assembly of 37.38 Mb with a GC content of 50.2% and the contigs were organized into scaffolds using pyScaf version 3 (https://pypi.org/search/?q_PyScaf_version_3). A total of 235 scaffolds were produced with the N₅₀ scaffolds of 3,501,266 bp and an average scaffold of 1,51,674.3 ± 4,98,379.7 bp (Table S1).

Gene prediction and gene ontology annotation

A total number of 10,460 protein-coding genes were identified with an average gene size of 435–545 bp. Total proteins annotated against fungal database was 10,141 and unannotated proteins were 391. An average gene density was 250–300 genes/Mb in the genome of B. sorokiniana and 8506 bp and 35 bp were the maximum and minimum sizes of the genes, respectively. Pfam was scanned to the predicted proteins of B. sorokiniana protein domain collection. A total of 12,082 protein domains were estimated from derived protein sequences. A total of 3357 protein families were identified from which top Pfam domain “WD domain, G-beta repeat” is involved in transcription factors (422 proteins). Superfamily MSF domain (203 proteins) is the second topmost Pfam domain associated with transportation of solutes involved in chemiosmotic ion gradients. In addition, Ankyrin repeat contains 138 proteins of the Pfam domain, is highly involved in a diverse set of cellular functions (Fig. 1; Online Resource 1). To classify the putative pathogenicity-related genes, 3627 genes were annotated against the pathogen–host interaction database (PHI database). Based on the homology of pathogenicity proteins, 1475 genes were related to reduced virulence, 1281 genes to unaffected pathogenicity, 264 genes to loss of pathogenicity, 174 genes related to lethal and 117 genes related to unaffected pathogenicity reduced virulence (Fig. 2) (Online Resource 2).

Fig. 1.

Top 10 PFam domain distribution in the whole genome of B. sorokiniana using HMMER 3.0

Fig. 2.

Top 10 genes expressing the type of virulence/pathogenicity from whole-genome functional annotation of B. sorokiniana using pathogen–host interaction (PHI) database

In gene ontology (GO) annotation, 3300 genes were assigned to ‘biological process’ which included 217 genes for transmembrane transport, 187 genes for carbohydrate metabolic process, 182 genes for metabolic process (Fig. 3a), whereas 7784 genes assigned for ‘molecular function’, 432 genes were related to ATP binding, 356 genes to Zinc ion binding, 245 to DNA binding (Fig. 3b). A total of 4165 genes were assigned for ‘cellular component’ which included 1912 genes for integral component of membrane, 394 for nucleus, 188 for cytoplasm (Fig. 3c) (Online Resource 3).

Fig. 3.

Pie chart representing gene ontology based functional annotation of genes present in the B. sorokiniana genome. GO charts were generated using. a Top 15 process hits for gene ontology biological process (3300). b Top 15 process hits for gene ontology molecular function (7784). c Top 15 process hits for gene ontology cellular component (4165)

Phylogenetic inferences

The evolutionary relationship of seven isolates of B. sorokiniana along with one isolate of P. tritici-repentis determined through phylogenetic analysis (Fig. 4a) revealed high similarity between the isolates. All the isolates of B. sorokiniana were grouped together in a single major cluster G2 showing close similarity. Cluster G2 was again sub-divided into two major clusters; G2a (BRIP10943a, WAI2406, WAI2411) and G2b (BRIP27492a, ND90Pr, BS112, Shoemaker). This showed that B. sorokiniana isolate BS112 has about 99% similarity to the isolate Shoemaker from china.

Fig. 4.

a Pairwise genome alignment using Dashing tool among seven genomes of B. sorokiniana isolates (BS112.fna, BRIP10943a.fna, WAI2406.fna, WAI2411.fna, BRIP27492a.fna, ND90Pr.fna, Shoemaker.fna) and one isolate of P. tritici-repentis (AR_CrossB10.fna, outgroup). Phylogenetic tree was created using MEGA X. b Venn diagram showing unique and shared orthologous gene families among four Bipolaris species namely Cochliobolus victoriae/ B. victoriae, Accession no. GCA_000527765, Strain- F13; C. miyabeanus/B. oryzae Accession no. GCA_000523455.1, Strain- ATCC 44,560; C. sativus/B. sorokiniana, BS112; and C. carbonum/B. zeicola Accession no. GCA_000523435.1, Strain- 26-R-13

Comparative genome annotation between the Bipolaris species

The orthologous gene families among four Bipolaris species including B. victoriae, B. oryzae, B. sorokiniana and B. zeicola were identified using OrthoVenn (Fig. 4b). A total of 11,938 clusters and 8370 single copy gene clusters from B. sorokiniana genome were identified in four other species of Bipolaris, which revealed that 8674 gene families are common in Bipolaris species. Orthologous cluster study reveals 98 common clusters between B. sorokiniana and B. victoriae; 115 common clusters between B. sorokiniana and B. oryzae; and 74 common clusters between B. sorokiniana and B. zeicola. Furthermore, 21 unique gene clusters were identified in B. sorokiniana, 25 in B. victoriae, 13 in B. oryzae, and 5 in B. zeicola.

Prediction and analysis of the attributes of B. sorokiniana secretome

Among 10,460 predicted proteins, 1078 proteins were annotated as classical secretory proteins by SignalP v4.1 (Peterson et al. 2011) (http://www.cbs.dtu.dk/services/SignalP/), while 1134 proteins were classified as secretory proteins by TargetP v1.11 (http://www.cbs.dtu.dk/services/TargetP/). To predict the total secretome, SignalP v4.1 and TargetP v1.1 were combined initially, removing all duplicate segments and 1184 unique proteins having secretory signatures were generated using TMHMM software. Within the gene set, 935 secretory proteins containing zero transmembrane domain (TmHmm0) having 92 highly probable glycosylphosphatidylinositol (GPI) anchor containing sequences and 47 proteins containing one transmembrane domain (TmHmm1) were identified. A total of 982 transmembrane proteins from the protein data set screened through WoLFPSORT using “run WoLFPSORT v. 0.2” for the confirmation of secretory protein, resulted in the identification of 682 secretory proteins (Table S2). From this total of 682 proteins, 573 were assigned to GO terms in 3 categories, namely molecular function (343), biological process (88) and cellular component (137) (Fig. 5).

Fig. 5.

Functional annotation of the B. sorokiniana secretome showing topmost category Viz. MF molecular function (348), CC cellular component (88), BP biological process (137)

Using the CAZy database, 216 CAZy enzymes were predicted specifically, with GH (glycoside hydrolases) families being the most copious (Fig. 6). Forty-five GH families were spotted having 78 total genes, from which 7 families showed the presence of more than 2 genes including GH5 having a maximum number of genes (6 genes) followed by GH3 (5 genes), GH7 (5 genes), GH43 (5 genes), GH10 (4 genes), GH11 (4 genes) and GH35 (3 genes). Seventy-six genes from 18 CBM (carbohydrate binding modules) families were identified, from which 8 CBM families showed more than 2 genes including CBM1 (30 genes), CBM2 (8 genes), CBM18 (8 genes), CBM13 (5 genes), CBM6 (3 genes), CBM32 (3 genes), CBM35 (3 genes) and CBM60 (3 genes). Sixteen genes were identified from 6 CE (carbohydrate esterase) families, from which a maximum number of genes were identified for CE5 (5 genes) followed by CE1 and CE4, 3 genes each. Furthermore, 41 genes from 10 AA (auxiliary activities) families were identified, from which a maximum number of genes were present in AA3 (11 genes) followed by AA9 (10 genes), AA1 (5 genes), AA5 (4 genes) and AA1 (3 genes). Furthermore, nine genes were identified from four families of PL (polysaccharide lyases), which includes a maximum number of genes in PL3 (three genes) and PL4 (three genes). From all of them, CBM1, GH5 and AA3 families were most ample.

Fig. 6.

CAZymes class annotation distribution in the genome of B. sorokiniana BS112. All six CAZyme categories are represented as: AA Auxiliary activities (10), CBM Carbohydrate binding modules (18), CE Carbohydrate esterase (6), GH Glycoside hydrolases (45), GT Glycosyl transferases (1), and PL Polysaccharide lyases (4)

ToxA gene analysis in the genome of B. sorokiniana

Screening of ToxA gene in the genome of B. sorokiniana (RCTM01000005.1) using BLAST_n revealed three copies of ToxA gene in this pathogen which was identified in different scaffolds i.e. (a) scaffold 7,180,000,000,228.1880955; start-1236214, end-1236802, (b) scaffold00139 99.755; start-408, end-747 and (C) scaffold00139 100.000; start-133, end-246.

ToxA gene sequencing and phylogenetic analysis in Indian population of B. sorokiniana

ToxA gene got amplified in thirty-nine B. sorokiniana isolates collected from different locations in India (Table 1), which confirmed the presence of ToxA in all the isolates studied. The coding length of the ToxA gene was 535 bp (excluding intron) which was exactly same in all the B. sorokiniana isolates (Fig. S1a). All these ToxA sequences were submitted in the NCBI database under the accession numbers (MN601358-MN601396) (Table 1).

Phylogenetic relationship of ToxA gene amongst B. sorokiniana BS112, P. tritici-repentis, P. nodorum and P. avenaria was concluded using the Neighbor-Joining method in MEGA X (Fig. S1b). The nucleotide sequences of B. sorokiniana ToxA from India (BSToxA) and Australia (AusBSToxA1 and AusBSToxA2) aligned to P. tritici-repentis (ptr_ToxA) and P. nodorum (Sn4_ToxA). All the isolates revealed 100% homology with P. tritici-repentis sequence and differing by a single nucleotide from one of the two BSToxA haplotypes identified in Australia (Fig. S2).

ToxA–Tsn1 gene relationship in wheat genotypes

In the host, the presence of Tsn1 (xfcp623), a sensitivity gene; helps a ToxA-positive pathogen to cause more severe necrotic lesions on wheat genotypes. To predict allelic status at Tsn1 (400 bp amplicon) locus using PCR amplification, thirteen genotypes of wheat were screened; from which five wheat genotypes (WH 542, WL 711, HD 29, PBW 343, and Agra local) (38.4%) were found to be Tsn1 positive, whereas remaining eight lacked Tsn1 and instead carry tsn1 (Fig. 7a). Furthermore, pathogenicity assay of B. sorokiniana (BS112) was tested on these 13 wheat genotypes to identify the correlation between Tsn1 (presence or absence) and necrotic lesions formation. The average disease index was calculated on the basis of the number and length of lesions on the leaf of different wheat genotypes (Fig. 7b). Genotypes viz. WH 542, WL 711, HD 29, PBW 343 and Agra local showed severe necrotic lesions on leaves when inoculated with B. sorokiniana while Tsn1-negative wheat genotypes showed no necrotic lesion formation. This confirmed that ToxA has a susceptible reaction phenotype on wheat genotypes harboring the Tsn1 gene (Fig. S3).

Fig. 7.

a Amplification profile of wheat genotypes harboring Tsn1 gene (400 bp amplicon). M (100 bp bioprep marker), 1-WH 542, 2-WL 711, 3-Agra Local, 4-Suzoe, 5- HD 29, 6- PBW 343, 7-HD 3086, 8-Chiriya 7, 9-HD 30, 10-Milan, 11-HD 2329, 12- Ning 8139, 13-HD 2967. b Average Disease Index (ADI) on 3-week-old seedlings of different wheat genotypes (1-WH 542, 2-WL 711, 3-Agra Local, 4-Suzoe, 5- HD 29, 6- PBW 343, 7-HD 3086, 8-Chiriya 7, 9-HD 30, 10-Milan, 11-HD 2329, 12- Ning 8139, 13-HD 2967) at 4 days post-inoculation with virulent isolate BS112 of B. sorokiniana

Relative expression analysis ToxA gene under in vitro and in planta conditions

To evaluate gene expression during fungal infection, relative qPCR with an EFN-1 alpha gene as an internal control was performed to determine the time-dependent expression of ToxA in wheat genotypes. In vitro expression analysis of ToxA gene in B. sorokiniana pathogen collected at different time intervals, using qPCR revealed maximum upregulation (14.67-fold) at 1st day after inoculation (DAI), followed by 2nd DAI (11.83 fold), then gradually expression decreased at 3, 4 and 5 DAI in minimal basal medium (Fig. 8a). In planta expression analysis via inoculated leaf collected at different time intervals from two genotypes was performed using qPCR. The maximum expression (7.89-fold) was observed at 5th DAI in susceptible cultivar (Agra local), while minimum expression (0.048 fold) was found in resistant cultivar (Chiriya 7) at 5th DAI (Fig. 8b).

Fig. 8.

a In vitro expression analysis of ToxA gene in B. sorokiniana pathogen collected at different time intervals (1st, 2nd, 3rd, 4th and 5th day) in liquid broth medium. Error bars shows ± SD among the biological triplicates. b In vivo expression analysis of ToxA gene after inoculation on two different wheat genotypes at different time points (1st, 2nd, 3rd, 4th and 5th day). Error bars shows ± SD among the biological triplicates

Discussion

Wheat is the most vital food grain in the northern and North-western parts of India. After China, India is the second chief producer of wheat in the world and accounts for 8.7 percent of the world’s total production (Ramadas et al. 2020). It is rich in proteins, carbohydrates and vitamins and provides balanced food. High yield loss in wheat is mainly due to many fungal diseases like wheat rusts, spot blotch, head blight, etc. Over the next several decades, due to predicted high global population growth rate, it would be a challenge to meet this rocketing demand for wheat. Management of fungal diseases and the development of resistant genotypes of wheat is the key component to meet this challenge (Figueroa et al. 2018). Fungal disease management and to understand the zestful nature of the genome of the fungal pathogen, whole-genome sequencing is of great significance. Genome sequencing of fungal pathogens shows extensive variations in genome structure, its composition between species and also between isolates of same species. Genome sequencing is an antecedent for many strategies and alternatives for plant defense reactions against fungal pathogens (Aylward et al. 2017).

Using next-generation sequencing technology, we have produced a draft genome of B. sorokiniana and a total sequence assembly size of 37.38 Mb was predicted (Aggarwal et al. 2019), which is larger than the size of other isolates of B. sorokiniana available in NCBI; for example, WAI2406 (36.89 Mb), BRIP10943a (36.92 Mb), ND90Pr (AEIN00000000: 34.41 Mb; Ohm et al. 2012), Shoemaker (WNKQ00000000: 34.32 Mb) etc. The genome size of B. sorokiniana (BS112) is also notably larger than other species of Bipolaris like B. maydis (32.93 Mb), B. victoriae (32.83 Mb), B. zeicola (31.26 Mb), B. oryzae (31.51 Mb) and B. papendorfii (JXCC00000000: 33.4 Mb).

To better understand gene functions, 15,249 genes were assigned to different categories. The top categories included transmembrane transport, carbohydrate metabolism, ATP binding, etc. which is mainly involved in carbohydrate mechanism such as gluconeogenesis, glycolysis and citric acid cycle (TCA cycle) (Kuan et al. 2015). This mechanism can facilitate the use of various substrates for B. sorokiniana, exposed to various carbohydrate sources in the environment. To penetrate the rigid barriers of the plant cell walls, many types of CAZymes (Carbohydrate active enzymes) are produced by fungi. To identify genes responsible for CAZymes, B. sorokiniana genome was mapped to the CAZy database. From total CAZymes, 45 glycoside hydrolases (GH) were identified. The number of GH family in other Bipolaris species is also reported higher compared to other CAZymes. Interestingly, the B. sorokiniana genome contains a lesser number of GH families (45) compared with that of the reported Bipolaris species as B. maydis has 276 families. Our findings revealed that B. sorokiniana has a total of six carbohydrate esterase (CE) families. The highest number of CE₅ (five copies) and CE₁ (three copies) indicated that B. sorokiniana produces many plant degrading enzymes having cutinase and carboxylesterase activity. From 18 carbohydrate-binding modules (CBM) family, CBM₁ and CBM₁₈ have the highest number of genes indicating chitin-binding activity. High number of CBM and GH families may have the ability to degrade lignocellulose (main structural component of the plant) collectively (Lam et al. 2020). This indicates that B. sorokiniana has a wide variety of CAZymes which are involved in the deprivation of plant cell wall complex carbohydrates.

In this study, we reported the functional identification of the ToxA gene in different Indian populations of B. sorokiniana. ToxA gene in a global population dataset was found to be drastically different depending upon the area from which the population was sampled. Earlier, for Australian populations of P. nodorum and P. tritici-repentis, ToxA was present in all the tested isolates (Antoni et al. 2010; McDonald et al. 2013). Recently, Navathe et al. (2020) reported 70% of ToxA-positive isolates in the tested Indian population of B. sorokiniana, whereas our results revealed that the ToxA gene existed (100%) in all the Indian isolates of B. sorokiniana taken for the study. In the present study, the gene ToxA was PCR amplified in all the 39 isolates of B. sorokiniana, and the length of the amplicon in all the isolates was uniform (535 bp). The sequencing data suggested that, there is a high degree of similarity of the ToxA gene present in B. sorokiniana, P. tritici-repentis and Phaeosphaeria species. The similarity between these three species can be best illustrated by horizontal gene transfer (Friesen et al. 2006). The horizontal gene transfer may be due to hybridization between the various fungal species (McDonald et al. 2018). The exact sequence match of B. sorokiniana (BS112) and the other two species suggests global migration of these strains.

The expression of ToxA gene was investigated using qPCR, measuring the level of B. sorokiniana in leaf tissue at different time intervals displaying disease symptoms. Gene expression levels were compared by C_T (threshold) values for each runner gene. The stability of gene expression was reflected through the coefficient of variation of C_T values, wherein higher the C_T values lower will be the gene expression levels and vice versa. Pathogenicity assay and PCR amplification confirmed that the isolate carrying ToxA caused severe necrotic lesions on wheat genotypes having the sensitivity gene Tsn1. In contrast, it caused fewer or no lesions to wheat genotypes lacking Tsn1. Quantitative gene expression analysis and pathogenicity assay revealed that necrotic symptoms observed on Agra local genotype leaves were due to high expression of the ToxA gene, which gradually increased and caused leaf necrosis, whereas, on Chiriya 7 its effect is reverse. Tsn1 is part of a complex network of resistance/susceptibility to spot blotch. According to Navathe et al. (2020) ToxA–Tsn1 have inverse gene to gene relationship; similarly, our study also confirms ToxA-positive isolates show more severe necrosis on wheat genotype harboring the Tsn1 gene. Furthermore, ToxA maximum expression was observed at 5 days of inoculation in susceptible wheat genotype harboring Tsn1 gene suggesting its role in the colonization of pathogen and causing infection. Recently, Wu et al. (2021) also confirmed the ToxA–Tsn1 relationship through culture filtrate infiltration method. However, the appearance of necrosis on the wheat leaf is not only induced by ToxA but could be through some other toxins present in culture filtrate or crude extract. Study of ToxA–Tsn1 interaction is very useful for breeding program. Wheat breeders may avoid the genotypes with the Tsn1 allele and retain genotypes with the tsn1 allele.

In this study, a detailed analysis of the genome of B. sorokiniana (BS112) was conducted, which led to the identification of secretory proteins, the establishment of phylogenetic relationships among different Bipolaris species, and understanding the genes involved in host–pathogen interactions at the molecular level. This study further stated the ToxA–Tsn1 interaction in Indian wheat genotypes and confirmed that spot blotch is more severe in Tsn1-positive wheat genotypes.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

RA, SA and SS conceived and designed the experiment and wrote the manuscript; RA, BMB, MSG and MSS contributed in corrections and suggestions; ARR and SS helped in performing bioinformatics analysis; RA, SA and PJ analyzed the data and conducted the wet lab experiments. All the authors read and approved the final manuscript.

Data availability

Data are available in a publically accessible repository. The data presented in this study are openly available at https://www.ncbi.nlm.nih.gov.

Declarations

Conflict of interest

The authors declare that they have no conflict of interest in the publication.