Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Jun 21.
Published in final edited form as: Nat Metab. 2021 Apr 8;3(4):571–585. doi: 10.1038/s42255-021-00374-y

Mitochondrial NADP+ is essential for proline biosynthesis during cell growth

Diem H Tran 1,4, Rushendhiran Kesavan 1,4, Halie Rion 1, Mona Hoseini Soflaee 1, Ashley Solmonson 1, Divya Bezwada 1, Hieu S Vu 1, Feng Cai 1, John A Phillips III 2, Ralph J DeBerardinis 1,3, Gerta Hoxhaj 1
PMCID: PMC9210447  NIHMSID: NIHMS1718166  PMID: 33833463

Abstract

Nicotinamide adenine dinucleotide phosphate (NADP+) is vital to produce NADPH, a principal supplier of reducing power for biosynthesis of macromolecules and protection against oxidative stress. NADPH exists in separate pools, in both the cytosol and mitochondria; however, the cellular functions of mitochondrial NADPH are incompletely described. Here, we find that decreasing mitochondrial NADP(H) levels through depletion of NAD kinase 2 (NADK2), an enzyme responsible for production of mitochondrial NADP+, renders cells uniquely proline auxotrophic. Cells with NADK2 deletion fail to synthesize proline, due to mitochondrial NADPH deficiency. We uncover the requirement of mitochondrial NADPH and NADK2 activity for the generation of the pyrroline-5-carboxylate metabolite intermediate as the bottleneck step in the proline biosynthesis pathway. Notably, after NADK2 deletion, proline is required to support nucleotide and protein synthesis, making proline essential for the growth and proliferation of NADK2-deficient cells. Thus, we highlight proline auxotrophy in mammalian cells and discover that mitochondrial NADPH is essential to enable proline biosynthesis.


Cell proliferation imposes a high metabolic demand for increased production of biomass and energy, which inevitably produces reactive oxygen species (ROS)1. NADPH provides the major cellular currency of reducing equivalents for reductive biosynthesis and antioxidant defence2. The synthesis of several macromolecules, including fatty acids, deoxyribonucleotides, tetrahydrofolates and amino acids, requires NADPH as a cofactor3–7. Moreover, NADPH powers several redox systems to regenerate key antioxidants such as glutathione (GSH) and thioredoxin to neutralize ROS3,5,8,9. Thus, proliferating cells upregulate the NADP(H)-producing pathways to support the increased anabolic demand and enhance their antioxidant capacity10–14. Given the importance of this redox cofactor in supporting vital metabolic functions for optimal cell growth and proliferation, it is central to understand the biochemical routes that maintain and utilize NADPH.

NADPH exists in separate pools, in both the cytosol and mitochondria. The total cellular pool of NADPH is regulated by the activity of NAD kinases (NADKs), enzymes that catalyse the phosphorylation of NAD+ to NADP+, the rate-limiting substrate for NADP(H) production7,15. Human cells express two NADKs, cytosolic NADK and mitochondrial NADK2, which generate compartment-specific sources of reducing power. NADK was recently identified as a direct target of the phosphoinositide-3-kinase (PI3K)–Akt pathway16. In response to growth factors or oncogenic signalling, Akt phosphorylates and stimulates NADK, thereby promoting an increase in cellular NADP(H)16, which supports biosynthesis of macromolecules such as lipids and nucleotides6. Surprisingly, the metabolic role of mitochondrial NADP(H) and NADK2 in mammalian cells remains unclear17.

Mutations in NADK2 were recently observed in people exhibiting neurological and development symptoms, which are characteristic of mitochondrial dysfunction18. Besides its role in supplying reducing power for regeneration of major antioxidants such as GSH and thioredoxin to neutralize ROS in mitochondria8,9,19, the metabolic functions of mitochondrial NADP(H) that are central for cell growth and proliferation remain undetermined. Here, we show that the essential role of NADK2 and mitochondrial NADP(H) in cell growth and proliferation is to enable proline synthesis for anabolic metabolism.

Results

NADK2 deficiency renders cells proline auxotrophic.

To understand the influence of mitochondrial NADP(H) on cellular metabolism, we used CRISPR–Cas9 to generate NADK2 deficiency (ΔNADK2) in six different cancer cell types: human embryonic kidney 293E (HEK293E) cells, cervical cancer cells (HeLa), myelogenous leukaemia cells (K562), non-small cell lung cancer cells (A549), breast cancer cells (T47D) and melanoma cells (A375). NADK2 deficiency reduced cell proliferation in all six cell lines (Fig. 1a) and decreased tumour growth in A549 and K562 xenograft mouse models (Fig. 1b–d and Extended Data Fig. 1a). This was in striking contrast to NADK deficiency, which had only marginal effects on proliferation (Extended Data Fig. 1b). Reconstitution of ΔNADK2 HEK293E cells with wild-type NADK2 cells completely restored proliferation (Extended Data Fig. 1c). NADK2 loss did not induce a compensatory increase in NADK expression, and overexpressing NADK did not compensate for loss of NADK2 (Extended Data Fig. 1c), indicating that NADK and NADK2 serve nonredundant functions in cells. To determine the cause of the decreased cell proliferation of ΔNADK2 cells, we attempted to rescue proliferation with metabolic intermediates thought to depend on NADPH availability. Treatment with the ROS scavenger N-acetylcysteine (NAC), nucleosides or fatty acids did not restore proliferation of ΔNADK2 cells (Fig. 1e and Extended Data Fig. 1d,e), nor did supplementation with supra-physiological levels of pyruvate or aspartate, which support mitochondrial respiration and de novo nucleotide synthesis, respectively (Fig. 1e,f and Extended Data Fig. 1e,f). Surprisingly, supplementation with a mixture of nonessential amino acids (NEAAs) completely restored NADK2-deficient cell proliferation and even surpassed the growth of NADK2-expressing cells (Fig. 1e and Extended Data Fig. 1e).

Fig. 1 |. Loss of NADK2 renders cells dependent on proline for cell proliferation.

Fig. 1 |

a, Cell proliferation and immunoblots of wild-type (WT) or single-cell-derived knockout cells of NADK2 (ΔNADK2) in HEK293E, HeLa, K562, A549, T47D and A375 grown in DMEM with 10% serum. Relative proliferation rate was assessed 72 h after plating and normalized to day 0. n = 3 biologically independent replicates for HEK293E, HeLa, K562 and A549 and n = 5 for T47D and A375. b, Experimental design of the tumour study. c, A549 ΔNADK2 cells stably reconstituted with either empty vector (Vec) or NADK2 were injected subcutaneously into athymic nude mice (n = 7 biologically independent animals). Tumour growth was monitored after tumour onset over time. Data are presented as the mean ± s.e.m. *P < 0.05 for comparisons were calculated using a one-sided Student’s t-test. d, K562 ΔNADK2 cells stably reconstituted with either empty vector or NADK2 were injected subcutaneously into athymic nude mice (n = 3 or 4 biologically independent animals). Tumour growth was monitored as in c. Data are presented as the mean ± s.e.m. *P < 0.05 for comparisons were calculated using a one-sided Student’s t-test. e, Relative proliferation rate as in a from WT or ΔNADK2 HEK293E cells. Cells were grown in 10% dialysed serum for 72 h or supplemented with NAC (5 mM), nucleosides (inosine, 0.1 mg ml−1; uridine, 0.1 mg ml−1), NEAA mixture (1×), pyruvate (10 mM) or aspartate (10 mM). n = 3–9 biologically independent samples. f, Relative proliferation rate as in e from isogenic ΔNADK2 HEK293E cells stably expressing either empty vector or NADK2 and supplemented with the indicated NEAAs at their concentrations in HPLM. n = 3 biologically independent samples. g, Relative proliferation rate in the presence or absence of proline (0.2 mM) was assessed in HEK293E, HeLa and K562 cells in three consecutive days. n = 3 biologically independent samples. Data are presented as the mean ± standard deviation (s.d.) and are representative of at least two independent experiments (a and e–g). ***P < 0.001 for comparisons were calculated using a two-sided Student’s t-test (a) and one-way analysis of variance (ANOVA) test and Tukey’s post hoc test (e–g).

To identity the amino acids responsible for this rescue, we treated cells with seven individual NEAAs either at their physiological concentrations present in human plasma-like medium (HPLM20; Fig. 1f and Extended Data Fig. 1f) or at ten times higher concentrations (Extended Data Fig. 1g). Strikingly, only proline rescued the proliferation of ΔNADK2 cells, and did so at both concentrations (Fig. 1f and Extended Data Fig. 1f,g). Remarkably, proline rescued cell proliferation to the same extent as reconstitution with wild-type NADK2 in all the cell lines tested (Fig. 1f,g and Extended Data Fig. 1f–h). Similarly to monolayer growth conditions, we found that proline supplementation also supports the growth of NADK2-deficient cells grown under anchorage-independent conditions (Fig. 2a–c). Of note, while proline supplementation fully rescued the growth defect of ΔNADK2 spheroids in HEK293E and T47D cells, we observed a significant, but incomplete rescue of that from K562 cells, indicating that NADK2 in some contexts is needed to support other processes besides proline synthesis. Together, these findings indicate a general requirement of proline for ΔNADK2 cells.

Fig. 2 |. NADK2 is required for anchorage-independent cell growth.

Fig. 2 |

a–c, Quantification and representative images from ΔNADK2 HEK293E, T47D and K562 cells stably expressing either empty vector or WT NADK2 grown as spheroids (anchorage-independent growth) and cultured in the presence or absence of proline (0.2 mM). Quantification of the spheroid size from 4–6 independent images for each cell line. Data are the mean ± s.d. from n = 5 or 6 biologically independent samples for a, n = 4–6 for b and n = 6 for c, representative of at least two independent experiments. ***P < 0.001 for multiple comparisons were calculated using one-way ANOVA and Tukey’s post hoc test (a–c).

The ability of proline to restore cell proliferation is surprising because ΔNADK2 cells cultured in medium supplemented with proline still displayed a drastic decrease in mitochondrial NADP+ and NADPH synthesis (Extended Data Fig. 1i), measured using rapid mitochondrial purification (MITO-Tag)21 coupled with stable isotope tracing with [13C3-15N]nicotinamide16. These data suggest that proline can circumvent the requirement of mitochondrial NADP(H) for cell growth.

To gain insight into the metabolic connection between NADK2 and proline metabolism, we performed unbiased metabolomic profiling in ΔNADK2 HEK293E cells stably expressing either empty vector or NADK2. Interestingly, proline was the most significantly depleted metabolite after NADK2 deletion (Fig. 3a,b), with proline concentrations dropping below 90% in NADK2-deficient cells within 24 h in proline-free medium (Fig. 3c,d). Moreover, a reduction in proline levels, but not in many other amino acids, was also observed in NADK2-deficient A549 and K562 xenograft tumours, indicating the importance of NADK2 to maintain proline levels in tumours (Extended Data Fig. 2a,b).

Fig. 3 |. NADK2 is required for the maintenance of proline levels.

Fig. 3 |

a, Steady-state metabolite profiles from isogenic ΔNADK2 HEK293E cells stably expressing either empty vector or NADK2 grown in DMEM supplemented with 10% serum. Intracellular metabolites from four independent samples per condition were profiled by LC–MS/MS and shown as row-normalized heat maps. IMP, inosine-5′-monophosphate; UDP, uridine 5′-diphosphate. b, Peak areas are shown for glutamate and proline from a. c,d, Intracellular concentration of glutamate and proline are shown for NADK2-deficient and NADK2-expressing HEK293E (c) and K562 (d) cells after withdrawal of proline for 24 h. The concentrations (nmol mg−1) were calculated by LC–MS/MS using the indicated standards for glutamate and proline (Methods). Data are the mean ± s.d. from n = 4 biologically independent samples for a and n = 3 or 4 for c and d, and are representative of at least two independent experiments. *P < 0.05 and ***P < 0.001 for comparisons were calculated using a two-sided Student’s t-test (b) and one-way ANOVA test and Tukey’s post hoc test (c and d).

Proline is predominantly synthesized in the pancreas.

Proline can be synthesized in both the mitochondria and the cytosol through a series of reactions that are dependent on NADP(H) or NAD(H) (Fig. 4a)22. Mitochondrial proline synthesis involves the NADPH-dependent formation of pyrroline-5-carboxylate (P5C) from glutamate. P5C can be further reduced to proline by NAD(P) H-dependent P5C reductase enzymes, through either PYCR1 or PYCR2 isoforms in mitochondria or the PYCRL isoform in the cytosol22. Intravenous infusions with 13C5-labelled glutamine and liquid chromatography with tandem mass spectrometry (LC–MS/MS) analysis in mice revealed highest enrichment of the newly synthesized [13C5]proline (M + 5) in the pancreas, with most of the other tissues displaying fractional enrichment similar to that in the blood (Fig. 4a,b), suggesting that most tissues have the ability to obtain proline from blood in addition to (or instead of) synthesizing it (Fig. 4a,b). Consistent with this, infusions with [13C5]proline (M + 5) in mice showed 43% enrichment of proline (M + 5) in blood, 10–20% enrichment in most tissues and the lowest enrichment in brain (3%; Fig. 4c). The [13C5]glutamate enrichment was very low in all tissues (0.5% or less), indicating little conversion of proline to glutamate under these conditions (Fig. 4c). Overall, our data suggest that many tissues obtain proline from the blood, while some, such as the pancreas, synthesize it from glutamine (Fig. 4a–c).

Fig. 4 |. In vivo infusions with 13C isotopes reveal that proline synthesis occurs mainly in the pancreas.

Fig. 4 |

a, Schematic of the proline biosynthesis pathway, showing the enzymes and key steps that require reducing cofactors in the form of NAD(P)H or FADH2. Parentheses (P) indicate the ability of enzymes to use either NADH or NADPH. In vivo tracing with [13C5]glutamine and [13C5]proline in mice and the tissues extracted for metabolite analysis by mass spectrometry are indicated. b, Fractional abundance (%) of glutamine (M + 5), glutamate (M + 5) and proline (M + 5) across tissues following intravenous infusion with [13C5]glutamine (5 h). Fed WT mice were used, and each dot represents data from one mouse. Data are presented as the mean ± s.d. from n = 5 biologically independent animals. c, Fractional abundance (%) of proline (M + 5) and glutamate (M + 5) across tissues after intravenous infusion with [13C5]proline (3 h). Fed WT mice were used, and each dot represents data from one mouse. Data are presented as the mean ± s.d. from n = 5 biologically independent animals. Images of organs adapted from Servier Medical Art (https://smart.servier.com) under a Creative Commons Attribution 3.0 Unported License (https://creativecommons.org/licenses/by/3.0/).

NADK2 activity is required for de novo proline synthesis.

To determine whether loss of NADK2 affects proline biosynthesis, we used [13C5]glutamine tracing (M + 5) to measure the newly synthesized [13C5]proline (M + 5) generated from P5C synthase (P5CS) and P5C reductase (PYCR) in the context of NADK2 loss (Fig. 5a and Extended Data Fig. 3a). Strikingly, knocking out NADK2 in five cancer cell lines nearly eliminated 13C transfer from glutamine to proline, and this effect was completely reversed by expression of NADK2 (Fig. 5b,c and Extended Data Fig. 3b–e). Moreover, shRNA-mediated depletion of NADK2 or P5CS showed comparable levels of reduced proline synthesis (Extended Data Fig. 3f–h). These changes occurred without any visible alteration in the abundance of proteins in the proline biosynthesis pathway (Extended Data Fig. 4a,b). Importantly, fibroblasts derived from an individual with NADK2 deficiency due to a mutation in the start codon (p.Met1Val)18 were also devoid of proline synthesis in this assay (Fig. 5d and Extended Data Fig. 4c).

Fig. 5 |. NADK2 activity is required for glutamine-dependent proline biosynthesis.

Fig. 5 |

a, Schematic of the proline biosynthesis pathway. b,c, Fractional abundance (%) of glutamate (M + 5) and proline (M + 5) from isogenic ΔNADK2 HEK293E (b) or HeLa (c) cells stably expressing either empty vector or NADK2 and labelled for 3 h with [13C5]glutamine. WT counterparts of each cell line are shown as controls. d, Fractional abundance (%) of glutamate (M + 5) and proline (M + 5) from WT and NADK2-deficient primary patient-derived fibroblasts labelled with [13C5]glutamine as in b. e, Immunoblots and fractional abundance (%) of glutamate (M + 5) and proline (M + 5) shown as in c from ΔNADK2 HEK293E cells transiently expressing empty vector (−), WT NADK2 or catalytically dead NADK2 mutant (D161A). WT counterparts are shown. f, Immunoblots and fractional abundance (%) of glutamate (M + 5) and proline (M + 5) from NADK2 and NNT double-knockout (ΔNADK2 + ΔNNT) HEK293E cells transiently expressing empty vector, NADK2, NNT or both NADK2 and NNT. g, Relative proliferation rate as in Fig. 1a from isogenic ΔNADK2 HeLa cells stably expressing either empty vector or NADK2. Cells were grown in 10% dialysed serum for 72 h or supplemented with ornithine (0.5 mM), dimethyl α-ketoglutarate (DMKG; 0.25 mM), proline (0.2 mM) and a mixture of polyamines (1×). h, Normalized peak areas of ornithine and proline from ΔNADK2 HeLa cells stably expressing either empty vector or NADK2 and grown for 36 h in the presence or absence of ornithine (0.5 mM). i, Normalized peak areas of proline from ΔNADK2 HeLa cells stably expressing either empty vector or NADK2 and labelled for 3 h with [13C5-15N2]ornithine. Left, schematic of [13C5-15N2]ornithine (M + 7) tracing experiment, indicating 13C-labelled carbon atoms (grey) or 15N-labelled nitrogen atoms (blue) present in ornithine and proline. Data are the mean ± s.d. from n = 4 biologically independent samples for b–d and n = 3 for e–i, and are representative of at least two independent experiments. *P < 0.05, **P < 0.01 and ***P < 0.001 for comparisons were calculated using a two-sided Student’s t-test (d and i) and one-way ANOVA and Tukey’s post hoc test (b, c and e–h).

To determine whether NADK2 catalytic activity is required for the observed effect, we mutated a conserved catalytic residue on human NADK2 (D161A) that results in loss of its activity23 and measured the synthesis of proline from glutamine (Fig. 5e and Extended Data Fig. 4d,e). Consistent with previous results, expression of wild-type NADK2 restored proline (M + 5) levels to values similar to those in the wild-type cells, whereas cells expressing a catalytically dead NADK2 (D161A) mutant failed to synthesize proline (M + 5), indicating that the catalytic activity of NADK2 is essential for proline biosynthesis. To determine whether NADK2-dependent supply of reducing power NADP(H) is the major contributor to proline synthesis, we tested the role of nicotinamide nucleotide transhydrogenase (NNT), a transmembrane enzyme that transfers electrons from NADH to NADP+ and has been implicated in maintaining a reduced NADPH pool in mitochondria24. We generated double knockouts of NADK2 and NNT in HEK293E cells and measured proline synthesis from [13C5]glutamine after expressing either NNT or NADK2 individually or together (Fig. 5f and Extended Data Fig. 4f). NADK2 expression restored proline synthesis, while NNT failed to do so. These data indicate the NADPH production from NNT does not compensate for loss of NADK2, and imply that NADK2 is the primary source of mitochondrial NADP(H) for proline biosynthesis (Fig. 5f and Extended Data Fig. 4f).

Mitochondrial NADP(H) fuels pyrroline-5-carboxylate production.

To better understand which step in proline synthesis requires mitochondrial NADP(H), we also considered an alternative pathway that produces P5C from ornithine via ornithine aminotransferase (OAT; Fig. 5a). Supplementation of ΔNADK2 cells with OAT substrates (L-ornithine and a cell permeable α-ketoglutarate (α-KG)) restored cell proliferation to levels similar to those achieved by proline supplementation (Fig. 5g and Extended Data Fig. 4g). The ornithine-mediated rescue in cell proliferation of NADK2-deficient cells was not due polyamines, small polycations synthesized from ornithine that promote cell proliferation25, as supplementation of cells with a mixture of polyamines failed to restore cell proliferation in ΔNADK2 cells (Fig. 5g).

Importantly, we found that L-ornithine was sufficient to restore proline levels (Fig. 5h) and flux through proline biosynthesis via OAT (Fig. 5i and Extended Data Fig. 4h), suggesting that the generation of P5C through P5CS is the bottleneck step that requires mitochondrial NADPH and NADK2 activity. Together, these data indicate that NADK2 depletion results in proline auxotrophy, making proline essential for the growth and proliferation of NADK2-deficient cells (Figs. 1–3 and 5 and Extended Data Figs. 1–4).

Proline does not alter the NADK2-dependent redox or bioenergetics.

We next explored which proline-dependent pathways were most related to the loss of cell proliferation in NADK2-deficient cells. We considered whether PRODH-mediated proline oxidation, which has been implicated in ATP production, is involved in rescuing cell proliferation26. Inhibition of PRODH1/2 using a PRODH inhibitor did not affect the ability of proline to rescue cell proliferation in ΔNADK2 HeLa cells (Extended Data Fig. 5a), nor did it significantly affect the growth of NADK2-expressing cells (Extended Data Fig. 5b). These findings indicate that restoration of NADK2-deficient cell proliferation by proline is independent of proline oxidation by PRODH1/2.

In addition to its role in protein synthesis, proline has been implicated in the control of redox homeostasis and regulation of cellular bioenergetics (Extended Data Fig. 5c)22. To determine the direct effect of proline in redox and energy metabolism, we assessed several metabolic parameters in the context of NADK2 loss. Although depletion of mitochondrial NADPH after NADK2 loss increases intracellular ROS levels, exogenous proline supplementation did not influence ROS levels (Extended Data Fig. 5d,e). Notably, proline did not produce any discernible changes in reduced GSH, oxidized glutathione (GSSG) or in the GSH/GSSG ratio, which act in concert with NADPH to maintain the cellular redox state (Extended Data Fig. 5f,g)27. Although NADK2 loss reduced mitochondrial respiration as judged by decreased oxygen consumption rate (OCR) in HeLa, HEK293E, K562 and A549 cells (Fig. 6a–d), no substantial changes were observed in extracellular acidification rate (ECAR; Extended Data Fig. 5h,i) or 13C5-labelling of tricarboxylic acid (TCA) cycle intermediates from [13C5]glutamine (Fig. 6e,f). Moreover, supplementing with proline at levels that restored proliferation did not alter these parameters, indicating a decoupling between proline-dependent cell proliferation and bioenergetics (Fig. 6a–f). Together, these findings suggest that proline is not limiting for redox or bioenergetics under monolayer cell growth conditions. Although NADK2 appears to contribute to redox homeostasis, its requirement for cell proliferation is related to proline biosynthesis.

Fig. 6 |. Proline levels do not alter the NADK2-dependent regulation of mitochondrial respiration.

Fig. 6 |

a–d, OCR for ΔNADK2 HeLa (a), HEK293E (b), K562 (c) and A549 (d) cells stably expressing either empty vector or NADK2 cultured in the presence or absence of proline (2 mM). WT counterparts are shown. OCR values were normalized to optical density from crystal violet assays (Methods). e, Schematic of [13C5]glutamine tracing into TCA cycle intermediates. α-KG, α-ketoglutarate; OAA, oxaloacetate. f, Fractional abundance (%) of the indicated TCA cycle intermediates from isogenic ΔNADK2 HeLa cells stably expressing either empty vector (−) or NADK2 cDNA and labelled for 3 h with [13C5]glutamine and cultured in the presence or absence of proline. Data are presented as the mean ± s.d. and are representative of at least two independent experiments. n = 11 or 12 biologically independent samples for a and d, n = 3–12 for b, n = 7–12 for c and n = 3 or 4 for f. *P < 0.05, **P < 0.01 and ***P < 0.001 for multiple comparisons were calculated using one-way ANOVA with Tukey’s post hoc test.

Proline supports nucleotide synthesis in NADK2-deficient cells.

Analysis of the cell cycle from G1-synchronized cells revealed a general delay in cell cycle progression of NADK2-deficient cells, which was restored by supplementation with proline or NADK2 expression (Extended Data Fig. 6a). Additionally, asynchronous NADK2-deficient cells showed an S- and G2/M-phase arrest that could also be rescued by supplementation with proline or NADK2 (Extended Data Fig. 6b). We hypothesized that the cell cycle regulation impairment was likely due to a decrease in cellular nucleotide or protein abundance. To test whether nucleotide synthesis is affected by loss of NADK2, we performed [13C6]glucose tracing analysis via LC–MS/MS to label nucleotides (Extended Data Fig. 7a). Remarkably, we found that the fractional abundance of newly synthesized purines (AMP (M + 5) and GMP (M + 5)) and pyrimidines (CMP (M + 5) and CDP (M + 5)) was decreased in ΔNADK2 cell lines and was restored by expressing NADK2 or simply by supplementing with proline (Fig. 7a,b and Extended Data Fig. 7a). We did not see NADK2-dependent changes in intermediates of the one-carbon metabolism that support nucleotide synthesis following labelling with [3-13C]serine28, which can be traced into formyl units, and then into nucleotides, such as deoxythymidine monophosphate (Extended Data Fig. 7b,c)6,7.

Fig. 7 |. Proline becomes limiting for nucleotide synthesis in NADK2-deficient cells.

Fig. 7 |

a,b, Fractional abundance (%) of 13C-labelled intermediates of purine (AMP (M + 5) and GMP (M + 5)) and pyrimidine (CMP (M + 5) and UDP (M + 5)) synthesis, measured by targeted LC–MS/MS, from isogenic ΔNADK2 HeLa (a) or K562 (b) cells stably expressing either empty vector or NADK2, grown in the presence or absence of proline (0.2 mM) and labelled for 3 h with [13C6]glucose. c,d, Relative incorporation of radiolabel from [14C]glycine or [14C]aspartate (6 h of labelling) from isogenic ΔNADK2 HeLa (c) or K562 (d) cells, stably expressing either empty vector or NADK2 and grown in the presence or absence of proline (0.2 mM). n = 3 biologically independent samples. e, Immunoblots of nucleotide biosynthesis genes and NADK2 shown for isogenic ΔNADK2 HeLa, K562 or HEK293E cells stably expressing either empty vector or NADK2, grown in DMEM supplemented with 10% serum in the presence or absence of proline (0.2 mM) for 48 h. Data are representative of two independent experiments. Data are the mean ± s.d. from n = 4 biologically independent samples for a, n = 3 or 4 for b and n = 3 for c and d, and are representative of at least two independent experiments. *P < 0.05, **P < 0.01 and ***P < 0.001 using a one-way ANOVA with Tukey’s post hoc test for a–d.

Interestingly, exogenous proline supplementation did not alter the synthesis of nucleotides in NADK2-expressing cells, indicating that proline is limiting for nucleotide synthesis in ΔNADK2 cells. To validate these results, we also used a surrogate assay to specifically measure the de novo purine and pyrimidine synthesis rates via [14C]glycine or [14C]aspartate incorporation into RNA, respectively29,30.Consistent with the [13C6]glucose tracing analysis, loss of NADK2 also displayed a decrease in 14C incorporation into RNA, which was completely rescued by addition of proline (Fig. 7c,d and Extended Data Fig. 7d). Importantly, no pronounced effects on the incorporation of an exogenously provided nucleoside ([3H]uridine) was observed, suggesting that the nucleotide salvage pathways and RNA synthesis were not affected (Extended Data Fig. 7e).

To gain insight into regulation of nucleotide synthesis by proline availability, we profiled the protein levels of genes that contribute to the nucleotide synthesis in HeLa, K562 and HEK293E cells (Fig. 7e and Extended Data Fig. 7f). Interestingly, we found that multiple enzymes in the de novo and salvage nucleotide synthesis pathway were under-expressed in NADK2-deficient, proline-depleted cells and their levels could be restored by proline supplementation or NADK2 expression (Fig. 7e). The most prominent proline-dependent changes across cell lines were observed in the levels of PRPS1 and PRPS2, the enzymes responsible for generating activated sugar (PRPP) for nucleotide synthesis; APRT and HPRT, purine salvage enzymes; and de novo pyrimidine synthesis enzyme CAD (Fig. 7e). Akin to protein levels, we also observed proline-dependent changes at the transcript levels of these genes (Extended Data Fig. 8). Other enzymes that feed into nucleotide pathway, including the pentose phosphate pathway enzymes TKT, TALDO or PGD, or the purine synthesis enzyme GART, were not altered at the protein or transcript levels in a proline- or NADK2-dependent manner (Extended Data Figs. 7f and 8). These data indicate that proline levels regulate the expression of a subset of key nucleotide synthesis genes, and further work is required to fully elucidate the underlying mechanisms of the proline-mediated gene signature.

Proline deficiency is sensed through the GCN2–ATF4 pathway.

To determine whether the NADK2-dependent control of proline synthesis leads to altered protein synthesis rate, we measured the kinetics of expression of mScarlet red fluorescent protein (RFP) and observed that proline was able to increase protein synthesis in the NADK2-knockout cells to a level similar to that of NADK2-expressing cells (Fig. 8a). In addition to regulating nucleotide and protein synthesis, reduced proline levels also triggered a strong response in the GCN2–eIF2α–ATF4 pathway (Fig. 8b), which senses depletion of amino acids and the uncharged tRNAs31. Two hours of proline removal was sufficient to induce activation of this pathway in HeLa cells, as measured by autophosphorylation of GCN2 (Thr 899), phosphorylation of eIF2α (Ser 51) and increased ATF4 protein levels (Fig. 8b). Activation of the GCN2–eIF2α–ATF4 pathway was sustained for 12 h after proline removal, but the nutrient-sensing mTORC1 pathway did not respond during this time (Fig. 8b), in contrast to its rapid inactivation in amino acid-free medium (Fig. 8c)32. Nevertheless, prolonged proline removal (48 h) from NADK2-deficient HeLa and K562 cells induced a decrease in mTORC1 signalling, as well as an activation of the GCN2 pathway, indicating that proline levels are primarily sensed by the GCN2 pathway (Fig. 8d).

Fig. 8 |. NADK2 loss inhibits protein synthesis and triggers activation of the GCN2–eIF2α–ATF4 pathway.

Fig. 8 |

a, Relative protein synthesis rate presented as the percentage of RFP over a 12-h period from isogenic ΔNADK2 HeLa cells stably expressing either empty vector or NADK2 and transiently transfected with mScarlet RFP. Cells were grown in the absence or presence of proline (0.2 mM). Data are presented as the mean ± s.d. from n = 2 biologically independent samples and are representative of two independent experiments. b, Time course of proline dropout (withdrawal) from ΔNADK2 HeLa cells stably expressing either empty vector or WT NADK2. Activation of markers of the GCN2–eIF2α–ATF4 pathway, but not mTORC1, is observed in ΔNADK2 HeLa cells within 12 h of proline withdrawal. Data are representative of two independent experiments. c, Time course (as indicated) of amino acid withdrawal (−AA) in WT HeLa cells showing inhibition of mTORC1 signalling and activation of the GCN2–eIF2α–ATF4 pathway. Data are representative of two independent experiments. d, Activation of the GCN2–eIF2α–ATF4 pathway and inhibition of mTORC1 signalling in ΔNADK2 HeLa and K562 cells stably expressing either empty vector or WT NADK2 cultured for 48 h in the presence or absence of proline (0.2 mM). Data are representative of two independent experiments. e, Model of NADK2 controlling proline biosynthesis, which sustains nucleotide and protein synthesis for cell growth and proliferation.

Discussion

Here we reveal that NADK2 and mitochondrial NADPH pools are essential to enable proline biosynthesis for cell growth and proliferation (Fig. 8e). While mitochondrial NADPH is a cofactor for many metabolic reactions2,7,9,33,34, including ROS mitigation, IDH2 function, lysine catabolism, fatty acid oxidation and proline metabolism, we discovered that only proline can circumvent the requirement of mitochondrial NADPH for cell growth and proliferation. This finding elucidates an unexpected hierarchy in the NADPH-dependent functions of mitochondria in proliferating cells.

Analogously to studies demonstrating that the main role of the electron transport chain in proliferating cells is to enable aspartate synthesis35,36, we find mitochondrial NADP(H) is vital to generate proline. We demonstrate that NADK2-deficient cells are proline auxotrophs and entirely unable to synthesize proline from glutamine in cancer cell lines. While proline auxotrophy was not previously reported in mammalian cells, Saccharomyces cerevisiae mutants defective in the proline synthesis genes, PRO1, PRO2 and PRO3, the mammalian homologues P5CS and PYCR, exhibit proline auxotrophy37.

We found that NADK2 activity is vital for P5CS function, the NADPH-dependent step of the proline synthesis pathway. Our data suggest that only the P5CS enzyme, but not PYCR in the proline synthesis pathway, depends exclusively on mitochondrial NADPH availability, as supplementing NADK2-deficient cells with ornithine, which bypasses the P5CS step but still requires PYCR to generate proline, restores proline production and cell proliferation. This finding is also in agreement with previous reports suggesting that mitochondrial PYCR preferentially uses NADH when assayed in vitro38.

Our infusion experiments with 13C-labelled glutamine (M + 5) and proline (M + 5) indicated that many tissues can obtain proline from circulation, in addition to synthesizing it from glutamine. While most of the organs did not display high levels of glutamine-derived proline, interestingly, the pancreas showed the highest enrichment of the newly synthesized proline. Since pancreatic acinar cells synthesize and secrete more protein than any other cell type in the body39–41, the high rate of proline synthesis in the pancreas could be required to support the high demand for protein synthesis. Our findings should further stimulate the investigation of whole-body proline metabolism at a tissue-specific level, as individuals with NADK2 deficiency are reported to have normal or even excessive levels of proline in the blood, despite clear defects in proline biosynthesis in patient-derived fibroblasts.

Even though most tissues can acquire proline from the circulation, NADK2 deficiency decreased tumour growth and reduced proline levels by at least 50% in tumours. These data suggest that circulatory proline does not fully compensate for NADK2-dependent proline synthesis and that tumours employ cell-intrinsic biosynthesis of proline. Future strategies targeting NADK2 and simultaneously restricting proline levels in the diet could be used to further investigate the importance of the NADK2–proline axis in tumorigenesis of various cancer types.

While we find that NADK2 loss and proline deficiency limits nucleotide synthesis, at least in part, likely due to a decreased expression of several nucleotide synthesis genes, including PRPS1/2, HPRT, APRT and CAD, we cannot exclude the possibility that other mechanisms could be involved in controlling nucleotide synthesis in a proline- or NADK2-dependent manner. Additionally, it would be important to determine the relevance of proline sensing in NADK2-deficient tumours by the GCN2–eIF2α–ATF4 pathway, given the critical role of the GCN2 pathway in mediating metabolic adaptation to nutrient stress and aiding cancer cell survival42,43

While we show that mitochondrial NADP(H) and NADK2 primarily control cell growth and proliferation via enabling proline biosynthesis and anabolic metabolism under cell culture conditions, this does not rule out other contexts, including complex physiological and pathological settings in vivo, in which mitochondrial NADP(H) is required for redox homeostasis and other functions beyond proline synthesis.

Taken together, our data indicate that NADK2 and mitochondrial NADPH pools are vital for generating proline levels required for both nucleotide and protein synthesis to restore cell proliferation. Thus, we have identified an example of mammalian proline auxotrophy that is directly dependent on the levels of mitochondrial NADP(H).

Methods

Cell culture conditions.

All cell lines were maintained in DMEM (Corning/Cellgro, 10–017-CV) containing 10% FBS at 37 °C and 5% CO2. Cancer cell lines, including HeLa, K562, T47D, A549 and A375 were obtained from the American Type Culture Collection. HEK293E cells were a gift from C. Mackintosh. Primary fibroblasts from NADK2-deficient individuals have been described previously18 and were provided by the laboratory of J.A.P. III. NADK2-knockout cells were maintained in 10% FBS in the presence of 0.2 mM proline. For cell proliferation experiments involving supplementation of medium with various metabolic intermediates, cells were plated in 10% dialysed serum.

Xenograft experiments.

All animal procedures were performed in accordance with ethical regulations and guidelines approved by the Institutional Animal Care and Use Committee at University of Texas Southwestern Medical Center (protocol no. 2020–102880). A549 and K562 cells were deleted for NADK2 by CRISPR–Cas9 and stably reconstituted with constructs expressing either empty vector or NADK2 WT. Male athymic nude mice aged 6 weeks old were subcutaneously injected with NADK2-deficient or NADK2-expressing cells (5 × 106 for A549 cells and 4 × 106 for K562 cells). Tumour growth rates were monitored weekly. Mice were euthanized once the tumour size reached around 2 cm3.

13C nutrient infusions in mice.

All procedures were approved by the Institutional Animal Care and Use Committee at University of Texas Southwestern Medical Center (protocol no. 2017–101840). All mice were housed in a pathogen-free environment with a 12:12 light/dark cycle and fed a chow diet (Envigo, Teklad Global 16% Protein Rodent Diet) ad libitum. All infusions took place between 09:00 and 11:00 with no prior fasting of the mice. Healthy, 6- to 10-week-old mice (C57BL/Ka) were initially anaesthetized using ketamine and xylazine (75 mg kg−1 and 10 mg kg−1, intraperitoneally (i.p.)) and maintained under anaesthesia using subsequent doses of ketamine (20 mg kg−1, i.p.) alone as needed. A 25-gauge catheter was inserted into the tail vein, and isotope infusions began immediately after a retro-orbital blood draw to mark time zero.

For [13C5]glutamine infusions, a total dose of 2.5 g kg−1 was dissolved in 1,500 μl normal saline, supplemented with 50 U ml−1 heparin, and administered with a bolus of 150 μl min−1 for 1 min followed by an infusion rate of 2.5 μl min−1 for 5 h, as previously reported44,45. For proline infusions, mice were infused with a stock of 20 mM [13C5]proline first with a bolus of 125 μl min−1 for 1 min followed by an infusion rate of 0.1 μl min−1 g−1 for 3 h. Retro-orbital blood draws were taken throughout the infusion to monitor tracer enrichment in blood. After cessation of the infusion, tissue samples were taken and frozen in liquid nitrogen, and later extracted in 80% methanol for extraction. Blood samples obtained during the infusion were chilled on ice for 5–10 min and then flash frozen in liquid nitrogen. Aliquots of 10–20 μl were added to 80% methanol for extraction.

Complementary DNA constructs, shRNA and CRISPR–Cas9.

NADK2 cDNA (GenScript, OHu24582), NNT cDNA (OriGene, MC200591) and NADK cDNA (OriGene, RC200544) were subcloned into a lentivirus vector (Lenti-III-PGK; Abmgood, G305) with a C-terminal FLAG-tag. Catalytically dead NADK2 (D161A) was generated by site-directed mutagenesis using KOD Xtreme Hot Start DNA Polymerase. The following plasmids were obtained from Addgene: pmScarlet-i_C1 (85044), pMXs-3XHA-EGFP-OMP25 (HA-Mito; 83356) and pMXs-3XMyc-EGFP-OMP25 (Control-Mito; 83355). All plasmids were verified by sequencing at the McDermott Center Sequencing Core at University of Texas Southwestern Medical Center.

Control shRNA (pLKO.1-puro), shRNA targeting NADK2 (no. 1: Sigma, TRCN0000424042 and no. 2: Sigma, TRCN0000414087) or P5CS (no. 1: Sigma, TRCN0000064851 and no. 2: Sigma, TRCN0000064850) were used to generate stable cell lines via lentivirus delivery and puromycin (2 μg ml−1) selection.

To generate NADK2-knockout cells in different cells lines, NADK2 CRISPR–Cas9 knockout plasmids containing a GFP marker and derived from the GeCKO (v2) library were obtained from Santa Cruz (sc-414406). NNT sgRNA sequence was cloned into the GFP-expressing PX458 CRISPR vector (Addgene, 48138) using the following guides: sense: GTGTCCTCTACTTAGCAATT; antisense: AATTGCTAAGTAGAGGACAC. Two days after transfection of the CRISPR–Cas9 knockout plasmids, GFP-positive cells were subjected to single-cell sorting into 96-well plates via flow cytometry with BD FACS Aria Fusion. Clones were grown in DMEM containing 30% FBS and supplemented with 1× NEAA mixture (Gibco, 11140050), 1 mM pyruvate, 10 mM HEPES and 55 μM β-mercaptoethanol (Thermo Fisher Scientific, 21985023). Clonal cells were screened by immunoblotting with NADK2 or NNT antibody. NADK knockouts in HEK293E cells were described previously16.

Transient expressions were performed with polyethylenimine or Lipofectamine 3000 Transfection Reagent transfection methods using 2 μg of plasmid DNA per well of a six-well plate. Experiments were initiated 48 h after transfection.

Immunoblotting.

Protein extracts were prepared according to previously described methods16. Protein concentrations were determined using the Bradford assay. Protein lysates (20 μg) were loaded on 4–15% Criterion TGX Precast gradient gels and subjected to immunoblotting with the indicated antibodies. Antibody dilutions were performed as follows: PYCR1, PYCR2 and PYCRL antibodies were used at 1:2,000; PRODH1 antibody was diluted at 1:200; HPRT antibody was diluted at 1:200; β-actin antibody was diluted at 1:10,000; and all remaining antibodies were diluted at 1:1,000 in 5% BSA in TBST buffer. Secondary antibodies were used at a 1:5,000 dilution in 5% milk in TBST. Proteins were detected with enhanced chemiluminescence. For gel source data, see Supplementary Fig. 1. Immunoblotting images were assembled in Adobe Fireworks 8.

mRNA expression analysis.

Total RNA was extracted from HeLa and K562 cells cultured in DMEM supplemented in 10% FBS in the presence or absence of proline (0.2 mM) for 48 h by RNeasy Plus Mini Kit (QIAGEN, 74136). RNA (1 μg) was subjected to reverse transcription with EcoDry Premix (Takara, 639545). The resulting cDNA was diluted in nuclease-free water (1:4) and amplified using Bio-Rad SsoAdvanced Universal SYBR (Bio-Rad, 1725274) and CFX384 Touch Real-Time PCR Detection System (Bio-Rad). Data are shown as the ratio between the gene of interest and the control gene (RPLP0) as previously described29. The quantitative PCR data were analysed with a Bio-Rad CFX Manager version 3.1.1517.0823. Primer sequences are shown in Supplementary Table 3.

Rapid isolation of mitochondria for measurement of NADP+ and NADPH by LC–MS/MS.

ΔNADK2-HA-Mito HEK293E cells were generated by stably expressing 3XHA-EGFP-OMP25 (HA-Mito) in the ΔNADK2 HEK293E cells as previously described46. ΔNADK2-HA-Mito cells were then reconstituted by lentivirus delivery of empty vector or NADK2, both in the Lenti-III-PGK backbone plasmid. As the negative control, HEK293E cells expressing 3XMyc-EGFP-OMP25 (Control-Mito) were used.

Cells from a confluent 15-cm plate were labelled for 3 h with [13C3-15N] nicotinamide and HA-tagged mitochondria were isolated as previously described46 from an equal amount of protein for each condition and metabolites. Metabolites were extracted in 50 μl of 80% methanol and analysed by targeted LC–MS/MS without drying with a QExactive HF-X hybrid quadrupole orbitrap high-resolution mass spectrometer (HRMS; Thermo Fisher Scientific) coupled to a Vanquish ultra-high-pressure liquid chromatograph (UHPLC) system.

Cell proliferation assays.

Crystal violet assay was used to determine cell proliferation. Briefly, cells were rinsed with PBS and stained with 0.1% crystal violet solution in 10% ethanol (Sigma, C6158) for 20 min at room temperature. After staining, cells were rinsed three times with PBS and air dried for 30 min, before extraction with 10% acetic acid. Absorbance was measured at 590 nm by SpectraMax iD3 Multimode Microplate Detection Platform (Molecular Devices). Cells were plated in 24-well plates in DMEM supplemented with 10% dialysed FBS or as indicated in the figure legends as follows: 4 × 104 HeLa, 5 × 104 HEK293E, 1 × 105 K562, 4 × 104 A375, 2.5 × 104 A549 or 3 × 105 T47D cells. For HEK239E and K562 cells, 24-well plates were first coated with 0.01% poly-L-lysine (Sigma, P4707). Seeding density of untreated adhered cells was also measured 12 h after plating and used to calculate the relative proliferation rate. For treatment with amino acids, the indicated concentrations shown in Supplementary Table 1 were used.

Tumour spheroid growth assay.

Spheroid growth assay was used to determine the anchorage-independent cell growth and adapted from a previous report47. Briefly, white, clear-bottom 96-well plates (Corning, 3903) were coated with 50 μl of 1.5% low-melting agarose (Lonza, 50101) and allowed to dry. Isogenic NADK2-deficient or NADK2-expressing HEK293E, T47D and K562 cells (1,000 cells per well) were seeded in 150 μl of DMEM supplemented with 10% dialysed FBS, with or without proline (0.2 mM). The plates were centrifuged at 2,000 r.p.m. for 10 min. Spheroid images were taken in a Zeiss Primovert microscope with an AxioCam 208 colour camera at ×4 magnification, and image size was analysed with ImageJ software version Java 1.8.0_172 (National Institutes of Health). Spheroid cell growth was monitored and recorded within 7 d after plating and as indicated in the figure legends.

Cell cycle analysis.

Cells were synchronized in G1 via a double thymidine block method, as previously described48. Briefly, isogenic NADK2-deficient or NADK2-expressing HeLa cells were plated in DMEM supplemented with 10% serum in the presence or absence of proline as indicated in the figure legends. First, cells were treated with 3 mM thymidine (Sigma, T9520) for 24 h, followed by release from thymidine for 12 h in fresh 10% serum containing DMEM and another 24-h treatment with 3 mM thymidine. Cells were released from the G1 thymidine block and collected every 2 h for a 10-h period. Cells were collected and immediately fixed with ice-cold ethanol (70%). Cells were subjected to staining solution (0.5 ml) containing 0.1% Triton X-100, 0.2 mg ml−1 RNase A (Sigma, R4875) and 20 μg ml−1 propidium iodide (BioLegend, 421301) in PBS. Stained cells were analysed using a BD LSRFortessa flow cytometer (BD Biosciences), and the collected data were analysed using FlowJo (BD Biosciences, version 10.7.1 for Windows).

Protein synthesis rate measurements.

Isogenic NADK2-deficient or NADK2-expressing HeLa cells were plated in six-well plates in the presence and absence of 0.2 mM proline. Next, 2 μg of mScarlet RFP was transfected with Lipofectamine 3000 reagent. Cells were collected at 0, 2, 4, 6, 8, 10 and 12 h after transfection, fixed with 4% paraformaldehyde and analysed by flow cytometer (BD Biosciences LSRFortessa). Unstained cells were used as the negative control, and the percentage of RFP-positive cells was calculated from biological duplicates and representative of two independent experiments.

Intracellular reactive oxygen species measurement by CellROX green.

HeLa and HEK293E cells were cultured in six-well plates in DMEM containing 10% dialysed FBS and supplemented with or without L-proline as indicated in the figures. After 48 h, cells were treated for 30 min with 5 μM CellROX green reagent (Invitrogen, C10444) in FluoroBrite DMEM containing 10% dialysed FBS (Thermo Fisher Scientific, A1896701). Cells were washed with PBS twice, collected, and live cells were analysed immediately by flow cytometry (BD Biosciences LSRFortessa). Results were analysed using FlowJo (BD Biosciences, version 10.6.1 for Windows). Unstained cells were used as the negative control. Data are presented from biological triplicates and are representative of at least two independent experiments.

Measurements of GSH/GSSG ratios.

GSH and GSSG were measured using the GSH/GSSG-GLO assay (V6611, Promega) according to the manufacturer’s protocol, and the GSH/GSSG ratio was calculated from 4 × 104 ΔNADK2 HeLa cells and 1 × 104 ΔNADK2 HEK293E cells plated in white, clear-bottom 96-well plates (Corning, 3903) in DMEM supplemented with 10% dialysed FBS with or without proline (2 mM) and cultured overnight at 37 °C and 5% CO2. Luminescence was measured using the SpectraMax iD3 Multimode Plate Detection Platform (Molecular Devices).

Quantification of intracellular concentrations of proline and glutamate.

HEK293E and K562 cells were cultured in six-well plates in DMEM containing 10% FBS and 0.2 mM proline. After 48 h, cells were incubated in proline-free DMEM containing 10% dialysed serum for 24 h or collected at time 0 h. Metabolites were extracted on ice with 500 μl of extraction buffer containing 80% methanol (−80 °C) supplemented with isotope-labelled internal standards (125 ng [2,3,3,4,4,5,5-D7]proline (Cambridge Isotope Laboratories, DLM-2657-PK), 250 ng [2,4,4-D3]glutamic acid (Cambridge Isotope Laboratories, DLM-335–1) and 125 ng [15N2]glutamine (Cambridge Isotope Laboratories, NLM-1328–0.25)). For standard curves, [13C5]glutamine (Cambridge Isotope Laboratories, CLM-1822-H-0.1MG), [13C5]glutamic acid (Cambridge Isotope Laboratories, CLM-1800-H-0.25) and [13C5-15N]proline (Cambridge Isotope Laboratories, CNLM-436-H-0.1) were used. Data were obtained using MassHunter Q-TOF Quantitative Analysis software (Agilent Technologies, version 10.1). Intracellular glutamate and proline concentrations were quantified against standard curves. Protein concentration was quantified using BCA Protein Assay Kit (Thermo Fisher Scientific, 23225). Metabolite levels were calculated and shown as nmol mg−1 of total protein.

Oxygen consumption rate and extracellular acidification rate.

OCR and ECAR were measured by an XFe96 Analyzer (Seahorse BioScience). Isogenic NADK2-deficient and NADK2-expressing HeLa, HEK293E and A549 cells were cultured overnight in Seahorse XF96 cell culture microplates (Agilent, V3-PS). K562 cells were seeded on Cell-Tak-coated plates and analysed on the same day. Before measurement, cells were rinsed three times with DMEM (Sigma, D5030) supplemented with 2 mM L-glutamine, 1 mM pyruvate and 10 mM glucose (pH 7.4), and incubated for 30 min at 37 °C in an CO2-free incubator. Oligomycin, CCCP and antimycin A were injected for a final concentration of 2 μM, 1 μM and μM, respectively. The assay programme was set up in Wave software (Agilent Technologies, version 2.6.1 for Windows), programmed for four cycles of 2-min mixing followed by 3 min of measurements. For normalization, cells were fixed with 10% neutral buffered formalin (Thermo Fisher Scientific, 5701) and stained with crystal violet solution (Sigma, C6158). OCR values were normalized to optical density from the crystal violet assays.

To achieve comparable seeding density between NADK2-deficient and NADK2-expressing cells, the following cell numbers were seeded: HeLa cells: 1.4 × 104 for ΔNADK2 without proline, 1 × 104 for ΔNADK2 with proline and 1 × 104 for isogenic ΔNADK2 expressing NADK2 in the presence or absence of proline; HEK293E cells: 1.1 × 104 for ΔNADK2 without proline, 8 × 103 for ΔNADK2 with proline, 8 × 103 for isogenic ΔNADK2 expressing NADK2 in the presence or absence of proline; A549 cells: 8 × 103 for ΔNADK2 without proline, 5.5 × 103 for ΔNADK2 with proline, 5.5 × 103 for isogenic ΔNADK2 expressing NADK2 in the presence or absence of proline; and 18 × 103 for K562 cells under all conditions.

[U-14C]glycine, [U-14C]aspartate and [3H]uridine incorporation into RNA.

Incorporation of 14C and 3H radiolabel into RNA was performed as previously described29. Cells were seeded in six-well plates in DMEM containing 10% serum and supplemented with or without l-proline (0.2 mM). Two days after plating, cells were labelled for 6 h with 1 μCi of uniformly labelled 14C (U-14C) glycine, [U-14C] aspartate or [U-3H]uridine in 10% dialysed serum in the presence or absence of proline. RNA was isolated using RNeasy Plus Mini Kit (QIAGEN, 74136) according to the manufacturer’s protocol and eluted with 50 μl of water. Radioactivity was measured by liquid scintillation counting from 35 μl of eluted RNA using a BD, Beckman Coulter LS 6500 Liquid Scintillation Counter. Data are representative of biological triplicates from at least two independent experiments. To achieve comparable seeding density between NADK2-deficient and NADK2-expressing cells, the following cell numbers were seeded: HeLa and HEK293E cells: 6 × 105 for ΔNADK2 without proline, 4 × 105 for ΔNADK2 with proline, and 4 × 105 cells for isogenic ΔNADK2 expressing NADK2 in the presence or absence of proline; K562 cells: 1 × 106 for ΔNADK2 without proline, 7 × 105 for ΔNADK2 with proline and 7 × 105 cells for isogenic ΔNADK2 expressing NADK2 in the presence or absence of proline.

Rapid isolation of mitochondria from measurement of NADP+ and NADPH by LC–MS/MS.

ΔNADK2 HEK293E cells stably expressing 3XTag-EGFP-OMP25 (HA-Mito) were stably reconstituted with either empty vector or NADK2. HEK293E cells expressing 3XMyc-EGFP-OMP25 (Myc-Mito) were used as the negative control. Cells were labelled for 3 h with [13C3-15N]nicotinamide, and HA-tagged mitochondria were isolated as previously described46,49 from an equal amount of protein for each condition and metabolites. Metabolites were extracted in 50 μl of 80% methanol and analysed by targeted LC–MS/MS without drying with a QExactive HF-X hybrid quadrupole orbitrap HRMS (Thermo Fisher Scientific) coupled to a Vanquish UHPLC system.

Targeted metabolic flux analysis.

For metabolite analysis by LC–MS/MS, cells were seeded in six-well plates and experiments were performed at ~90% confluency, with biological triplicates or quadruplicates for each condition. For glutamine tracing experiments, cells were incubated in glutamine-free DMEM containing 10% dialysed FBS and 2 mM [13C5]glutamine; for glucose tracing experiments, cells were incubated with glucose-free DMEM containing 10% dialysed FBS and 10 mM [13C6]glucose; and for ornithine tracing experiments, cells were incubated with DMEM containing 10% dialysed FBS and 0.5 mM [13C5-15N2] ornithine (Cambridge Isotope Laboratories, CNLM-7578-H-PK). All labelling experiments were performed for 3 h. Metabolites were extracted on ice with 500 μl of 80% methanol (−80 °C) as previously described16. Metabolite extracts from the pooled supernatants were dried down in a SpeedVac concentrator. Dried samples were resuspended either in water, and run in a 6550 iFunnel Q-TOF (Agilent Technology), or in 80% acetonitrile aqueous solution, and run on an AB QTRAP 5500 (Applied Biosystems SCIEX).

Isotopologue analysis on a 6550 iFunnel Q-TOF.

Approximately 5 μl of analyte was run with a flow rate of 250 μl min−1 by reverse-phase chromatography, using a 1290 UHPLC coupled to a HRMS 6550 iFunnel Q-TOF mass spectrometer (MS; Agilent Technology). Raw data files were analysed using Profinder software (Agilent Technologies, version B.08.00 SP3). Peak integration results were manually curated in Profinder for improved consistency and exported as a spreadsheet.

Isotopologue analysis on an AB QTRAP 5500.

Mass spectrometry was performed on an AB QTRAP 5500 (Applied Biosystems SCIEX) with electrospray ionization source in the multiple reaction monitoring mode. Data acquisition was achieved by injecting 10 μl of analytes with a flow rate of 0.2 ml min−1 on a SeQuant zip_HILIC column (150 × 2 mm) while the column and samples were kept at 4 °C using a Nexera UHPLC system (Shimadzu). The solvents for the mobile phase were: 10 mM ammonium acetate aqueous solution at pH 9.8 (A) and 100% acetonitrile (B). The gradient programme was: 0–18 min, 10–45% A; 18–20 min, 45–70% A; 20–25 min, 70% A; 25–27 min, 70–10% A; and 27–34 min, 10% A. Data for multiple reaction monitoring are shown in Supplementary Table 2 and were obtained using Analyst software (Applied Biosystems SCIEX, version 1.6.1). Data and peak area integration were analysed using MultiQuant software (Applied Biosystems SCIEX, version 2.1.1).

Isotopologue analysis of the TCA cycle intermediates by gas chromatography.

Samples were extracted in 80% methanol. The resulting supernatant was evaporated and resuspended in 30 μl of a 10 mg ml−1 solution of myristic acid in anhydrous pyridine. Samples were heated to 70 °C for 15 min, and then added to 70 μl of N-(tert-butyldimethylsilyl)-N-methyltrifluoroacetamide derivatization reagent for 1 h at 70 °C. Samples were analysed on a 7890 gas chromotagraph coupled to an Agilent 5975C mass selective detector. The observed distributions of mass isotopologues were corrected for natural abundance (Fig. 6e,f).

Sequence alignments.

Amino acid sequences for NADK2 were obtained from Uniprot (http://www.uniprot.org/). Clustal Omega was used for multiple sequence alignments and Jalview was used for visualization for the alignments. (http://www.jalview.org/).

Antibodies and other reagents.

Antibodies used in this study were to NADK2 (Abcam, ab181028, GR164717–1), PRODH2 (Abcam, ab151130, GR3267439–3), APRT (Abcam, Ab196558, GR289813–17), NNT (Proteintech, 13442–2-AP), PYCRL-A189 (Sigma, SAB4100231), PYCR1 (Proteintech, 13108–1-AP), PYCR2 (Proteintech, 17146–1-AP), P5CS (Proteintech, 17719–1-AP, ALDH18A1), PRODH1 (Santa Cruz, sc-376401, K1919), PRPS1 (Proteintech, 15549–1-AP), PRPS2 (Proteintech, 27024–1-AP), GART (Proteintech, 13659–1-AP), PPAT (Proteintech, 15401–1-AP), TALDO1 (Proteintech, 12376–1-AP), Transketolase (Proteintech, 11039–1-AP), PGD (Proteintech, 14718–1-AP), HPRT (Santa Cruz Biotechnology, sc-376938, E0520), NADK (CST, 55948, no. 1), CAD (CST, 93925S, no. 1), P70 S6 Kinase (CST, 2708, no. 8), p-S6 Kinase-T389 (CST, 9234, no. 12), 4EBP1 (CST, 9644, no. 12), phospho-GCN2 (T899; CST, 94668S, no. 1), GCN2 antibody (CST, 3302S, no. 5), ATF4 (CST, 11815S, no. 5), phospho-eIF2α (S51; CST, 9721S, no. 21), eIF2α (CST, 9722S, no. 15), β-actin (Sigma, A5316, no. 059M4770V) and horseradish peroxidase-conjugated secondary antibodies anti-mouse (CST, 7076, no. 34) and anti-rabbit (CST, 7074, no. 29).

NAC (Sigma, A9165), crystal violet (Sigma, 6158), protease inhibitor cocktail (Sigma, P8340), [13C5]glutamine (Sigma, 605166), [13C6]glucose (Sigma, 389374), L-proline (Sigma, P5607), L-ornithine (Sigma, O2375), dimethyl-2-oxoglutarate (Sigma, 349631), polyamine Supplement 1000X (Sigma, P8483), sodium pyruvate (Thermo Fisher Scientific, 11360–070), aspartate (Sigma, A8949), uridine (Sigma, U3003), inosine (Sigma, I4125), alanine (Sigma, A7627), serine (S4311), glycine (Sigma, G7126), asparagine (Sigma, A4159), glutamic acid (Sigma, G1626), oleate (Sigma, O7501), KOD Xtreme Hot Start DNA Polymerase (Millipore, 71975–3), dialysed FBS (Sigma, F0392), l-tetrahydro-2-furoic acid (Santa Cruz Biotechnology, sc-253674), polybrene (Santa Cruz, sc-134220), [U14C]glycine (PerkinElmer, NEC276E250UC), [U14C] aspartic acid (PerkinElmer, NEC268E050UC), [3H]uridine (PerkinElmer, NET367250UC), [13C3-15N]nicotinamide (Cambridge Isotope Laboratories, CNLM-9757–0.001), Glutagro (Corning, 25–015-CI), β-mercaptoethanol (Gibco, 21985023), BCA kit (Thermo Fisher Scientific, 23225), Lipofectamine 3000 Transfection Reagent (Thermo Fisher Scientific, L3000015), glucose-free DMEM (Thermo Fisher Scientific, 11966025), glutamine-free DMEM (Thermo Fisher Scientific, 11–960-044), polyethylenimine (Polysciences, 24765–1), nicotinamide-free DMEM (US Biologicals, D9800–17), microcystin-LR (Enzo life sciences, ALX-350–012-C500), Bradford assay reagent (Bio-Rad) and chow diet (Envigo, Teklad Global 16% protein rodent diet) were used.

Statistical analysis and software.

Statistical analysis was performed using GraphPad Prism 8.4.3 software and Microsoft Excel 365. All error bars represent the standard deviation from the mean, except for tumour data and quantitative PCR data where error bars represent the mean ± s.e.m. For multiple comparisons, one-way ANOVA with Tukey’s post hoc test were conducted. For pairwise comparisons, Student’s t-tests were used and are indicated in each figure legend. Other software used included Microsoft PowerPoint 365 for Fig. 8e.

Reporting Summary.

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Extended Data

Extended Data Fig. 1 |. NADK2-deficient cells require proline for cell proliferation.

Extended Data Fig. 1 |

a, A549 and K562 ΔNADK2 cells stably reconstituted with either empty vector (Vec) or NADK2 were injected subcutaneously into athymic nude mice. Tumour growth curves are shown as average of all tumours from the data shown in Fig. 1c,d. Data are presented as mean ± SEM from 7 tumors (A549) or 3 or 4 tumours (K562). *P < 0.05 for pairwise comparisons calculated using a one-sided Student’s t-test. b, Immunoblots and cell proliferation of wild-type or single cell-derived knockout cells of NADK in HEK-293E cells grown in DMEM with 10% serum. Proliferation rate was assessed 72 h post-plating and normalized to Day 0. c, Relative proliferation rate was assessed in three consecutive days from wild-type or isogenic ΔNADK2 cells stably expressing either empty vector, NADK2 or NADK. Immunoblots for NADK, NADK2 and β-actin are shown. d, Relative proliferation rate as in (b) from isogenic ΔNADK2 HeLa cells stably expressing either empty vector or NADK2. Cells were grown in 10% dialyzed serum or supplemented with oleate (0.1 mM). e, Relative proliferation rate as in (b) from wild-type or ΔNADK2 HeLa cells. Cells were grown in 10% dialyzed serum for 72 hours or supplemented with NAC (5 mM), nucleosides (inosine 0.1 mg/ml uridine, 0.1 mg/ml), non-essential amino acid (NEAA) mixture (1X), pyruvate (10 mM) or aspartate (10 mM). f, Relative proliferation rate as in (b) from isogenic ΔNADK2 K562 cells stably expressing either empty vector or NADK2 and supplemented with the indicated individual non-essential amino acids at concentration present in human plasma-like medium (HPLM). g, Relative proliferation rate as in (b) from isogenic ΔNADK2 HEK-293E cells stably expressing either empty vector or NADK2, and supplemented with the indicated individual non-essential amino acids at 10X concentration present in human plasma-like medium (HPLM). Related to Fig. 1f. h, Relative proliferation rate as in (b) from HCT116 cells with stable shRNA-mediated knockdown of NADK2 grown in the presence or absence of proline (2 mM). i, Normalized peak areas of mitochondrial NAD + (M + 4), NADP + (M + 4) and NADPH (M + 4) from labeling with 13C3-15N-nicotinamide are shown. ΔNADK2 HEK293E cells stably expressing HA-Mito were stably reconstituted with either empty vector or NADK2. HEK-293E cells expressing (Myc-Mito) were used as a negative control (1-Ctrl). HA-tagged mitochondria were isolated from equal amount of protein for each condition and metabolites were analyzed by targeted LC-MS/MS. Data are presented as the mean ± SD (b-i) from n = 4 of biologically independent samples for (b), n = 3 for (c,g,h,i), n = 12 for (d), n = 3–9 for (e), n = 3–5 for (f) and are representative of at least two independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001 for comparisons calculated using a two-sided Student’s t-test for (b) and with one-way ANOVA test and Tukey’s post-hoc test for (c-i).

Extended Data Fig. 2 |. NADK2-deficient tumors display reduced proline levels.

Extended Data Fig. 2 |

a,b, Immunoblots and peak areas of proline and other amino acid are shown from A549 (a) and K562 (b) xenograft tumours that are NADK2-deficient (blue) or that express NADK2 from tumors in Fig. 1c,d. Each condition represents four tumors, and levels of NADK2 are assessed by immunoblotting and shown below the graphs. Data are presented as the mean ± SD from n = 4 of biologically independent samples. **P < 0.01 for comparisons was calculated using a two-sided Student’s t-test.

Extended Data Fig. 3 |. Glutamine-dependent proline synthesis is dependent on NADK2 (Data supporting Fig. 5).

Extended Data Fig. 3 |

a, Schematic of 13C5-glutamine labelling. b, Fractional abundance (%) of glutamine (M + 5) from experiment presented in Fig. 5b. c, Fractional abundance (%) of glutamine (M + 5) from experiment presented in Fig. 5c. d, Fractional abundance (%) of glutamine (M + 5), glutamate (M + 5) and proline (M + 5) from isogenic ΔNADK2 A549 cells stably expressing either empty vector (−) or NADK2 cDNA and labeled for 3 hours with 13C5-glutamine. Wildtype counterparts of each cell line are shown as controls. e, Fractional abundance (%) of glutamine (M + 5), glutamate (M + 5) and proline (M + 5) from isogenic ΔNADK2 K562 cells stably expressing either empty vector (−) or NADK2 cDNA and labeled for 3 hours with 13C5-glutamine. Wildtype counterparts of each cell line are shown as controls. f, Immunoblots from HCT116 cells stably expressing a control shRNA (Ctrl), NADK2 shRNA, or two shRNAs against P5CS. g, Fractional abundance (%) of glutamine (M + 5), glutamate (M + 5) and proline (M + 5) from HCT116 cells stably expressing a control shRNA (Ctrl) or two shRNAs against P5CS. Immunoblots are shown in (f). h, Fractional abundance (%) of glutamine (M + 5), glutamate (M + 5) and proline (M + 5) from HCT116 cells stably expressing a control shRNA (Ctrl) or an shRNA against NADK2. Immunoblots are shown in (f). Data are presented as the mean ± SD from n = 4 of biologically independent samples for (b-e) and n = 3 or 4 for (g,h) and are representative of at least two independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001 for comparisons was calculated using a two-sided Student’s t-test for (h) and with one-way ANOVA test and Tukey’s post-hoc test for (b-e,g).

Extended Data Fig. 4 |. NADK2 regulated proline synthesis for cell growth. Data supporting Fig. 5.

Extended Data Fig. 4 |

a, Immunoblots of NADK2 and proline biosynthesis genes shown for wild-type or isogenic ΔNADK2 HEK293E cells stably expressing either empty vector or NADK2 grown in DMEM supplemented with 10% serum in the presence or absence of proline (0.2 mM). Data are representative of at least two independent experiments. b, Immunoblots as in (a) for wild-type or isogenic ΔNADK2 A549 cells stably expressing either empty vector or NADK2 grown in DMEM supplemented with 10% serum in the presence or absence of proline (0.2 mM). Data are representative of at least two independent experiments. c, Immunoblot and fractional abundance (%) of glutamine (M + 5) from experiment presented in Fig. 2d. d, Schematic showing the sequence conservation of D161 among NADK2 orthologs across different species. e, Fractional abundance (%) of glutamine (M + 5) from experiment presented in Fig. 5e. f, Fractional abundance (%) of glutamine (M + 5) from experiment presented in Fig. 5f. g, Relative proliferation rate as in (Fig. 5g), but from isogenic ΔNADK2 HEK293E cells stably expressing either empty vector or NADK2. Cells were grown in 10% dialyzed serum for 72 hours or supplemented with ornithine (0.5 mM), dimethyl α-ketoglutarate (0.25 mM), or with ornithine (0.5 mM) and dimethyl α-ketoglutarate (0.25 mM). h, Normalized peak areas of ornithine (M + 7) from 3 hours labeling with 13C5-15N2-ornithine are shown from experiment presented in Fig. 5i. Data are presented as the mean ± SD from n = 4 of biologically independent samples for (c), n = 3 for (e-h) and are representative of at least two independent experiments. *P < 0.05, **P < 0.01 for comparisons calculated using a two-sided Student’s t-test for (c,h) and with one-way ANOVA test and Tukey’s post-hoc test for (e-g).

Extended Data Fig. 5 |. Proline does not affect the NADK2-dependent regulation of ROS levels.

Extended Data Fig. 5 |

a, Relative proliferation in ΔNADK2 HeLa cells cultured in DMEM with 10% dialyzed serum for 72 hours in the presence or absence of proline (2 mM) or PRODH inhibitor L-THFA (5 mM). Data is normalized to cells grown in the presence of proline. b, Relative proliferation as in (a) in HeLa ΔNADK2 cells reconstituted with NADK2. c, Schematic of putative functions of proline axis mediating ATP generation or defense against ROS. d,e, Mean fluorescence intensity for CellRox Green staining (ROS) in ΔNADK2 HeLa (d) or HEK-293E (e) cells stably expressing either empty vector or NADK2 cultured in 10% dialyzed serum in the presence or absence of proline (2 mM). f,g, GSH, GSSG and GSH/GSSG ratio quantified from ΔNADK2 HeLa (d) or HEK-293E (e) cells cultured in 10% dialyzed serum in the presence or absence of proline (2 mM). h,i, Extracellular Acidification Rate (ECAR) for ΔNADK2 HeLa (e) or HEK-293E (f) cells stably expressing either empty vector or NADK2 cultured in the presence or absence of proline (2 mM). Wildtype counterparts are shown (Supporting Fig. 6). Data are presented as the mean ± SD from n = 3 of biologically independent samples for (a,b), n = 4 for (d,e,f,g), n = 11 or 12 for (h), and n = 9–11 for (i), and are representative of at least two independent experiments. **P < 0.01, ***P < 0.001 for comparisons calculated using a two-sided Student’s t-test for (f,g) and with one-way ANOVA test and Tukey’s post-hoc test for (a,b,d,e,h,i).

Extended Data Fig. 6 |. NADK2 loss results in impairment of cell cycle progression.

Extended Data Fig. 6 |

a, Cell cycle profiles (histograms) at indicated time points after release from G1 phase arrest induced by double-thymidine block, from ΔNADK2 HeLa cells stably expressing either empty vector or WT NADK2, cultured in the presence or absence of proline (0.2 mM) as indicated. Data are analyzed using the FlowJo’s Watson Pragmatic cell cycle platform algorithm and are representative of at least two independent experiments performed in duplicates or tripicates. b, Cell cycle profiles from asynchronous ΔNADK2 HeLa cells stably expressing either empty vector or WT NADK2, cultured in the presence or absence of proline (0.2 mM) as indicated. Biological duplicates are shown. Data are analyzed using the FlowJo’s Watson Pragmatic cell cycle platform algorithm and are representative of at least two independent experiments performed in duplicates or triplicates.

Extended Data Fig. 7 |. NADK2 regulates nucleotide synthesis (Data supporting Fig. 7).

Extended Data Fig. 7 |

a, Schematic of 13C6-glucose labelling. b, Schematic of 3-13C-serine labeling. c, Fractional abundance (%) of Serine (M + 1), 10-Formyl-THF (M + 1), and dTMP (M + 1) from isogenic ΔNADK2 HEK-293E cells stably expressing either empty vector or NADK2 cDNA and labeled for 6 hours with 3-13C-serine. d, Relative incorporation of radiolabel from 14C-glycine, 14C-aspartate, or 3H-uridine (6 hours labelling) from isogenic ΔNADK2 HEK-293E cells stably expressing either empty vector (−) or NADK2 cDNA grown in the presence or absence of proline (0.2 mM). e, Relative incorporation of radiolabel from 3H-uridine (6 hours labelling) from isogenic ΔNADK2 HeLa, or K562 cells stably expressing either empty vector or NADK2 cDNA grown in the presence or absence of proline (0.2 mM). Performed in parallel with experiment shown in Fig. 7c (HeLa) and Fig. 7d (K562). Data are presented as the mean ± SD from n = 3–4 of biologically independent samples (c,d,e) and are representative of at least two independent experiments. **P < 0.01, ***P < 0.001 for comparisons calculated using a two-sided Student’s t-test for (c) and with one-way ANOVA test and Tukey’s post-hoc test for (d,e). f, Immunoblots of pentose pathway enzymes (TKT, TALDO, PGD, G6PD) and nucleotide biosynthesis genes (PPAT, GART) shown for isogenic ΔNADK2 HeLa, K562 or HEK-293E cells stably expressing either empty vector or NADK2, grown in DMEM supplemented with 10% serum in the presence or absence of proline (0.2 mM) for 48 hours. Data are representative of two independent experiments.

Extended Data Fig. 8 |. Proline availability regulates transcript levels of multiple nucleotide biosynthesis genes. (Data supporting Fig. 7).

Extended Data Fig. 8 |

a,b, Transcript levels are shown for the indicated nucleotide biosynthesis genes from isogenic ΔNADK2 HeLa (a), or K562 (b) cells stably expressing either empty vector or NADK2 grown in DMEM supplemented with 10% serum in the presence or absence of proline (0.2 mM). Data are presented as the mean ± SEM from =3 of biologically independent samples that were each measured in technical triplicates. *P < 0.05, **P < 0.01 for comparisons calculated using one-way ANOVA test and Tukey’s post-hoc test.

Supplementary Material

Supplemental

Acknowledgements

We thank C. Llamas and P. Mishra for guidance with Seahorse assays; C. Yang for assistance with xenograft experiments; L. Zacharias, M. Martin and T. Mathews for mass spectrometry assistance; and N. Loof, T. Shih and the Moody Foundation Flow Cytometry Facility for flow cytometry assistance. The research was supported by the Cancer Prevention and Research Institute of Texas (CPRIT; RR190087). G.H. is a CPRIT Scholar. R.J.D. is an HHMI Program investigator, the Robert L. Moody, Sr. Faculty Scholar at University of Texas Southwestern Medical Center and Joel B. Steinberg, M.D. Chair in Paediatrics. J.A.P. III is supported in part by Vanderbilt Center for Undiagnosed Diseases (VCUD; 5U01HG007674).

Footnotes

Additional information

Extended data is available for this paper at https://doi.org/10.1038/s42255-021-00374-y.

Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s42255-021-00374-y.

Competing interests

R.J.D. is an advisor for Agios Pharmaceuticals and Vida Ventures. All other authors declare no competing interests.

Peer review information Nature Metabolism thanks the anonymous reviewers for their contribution to the peer review of this work. Primary Handling Editor: George Caputa.

Data availability

Supplementary Information including Supplementary Tables 1–3 and a figure exemplifying the gating strategy for Extended Data Fig. 6 are provided with this paper. All other data are available from the corresponding author upon request. Source data are provided with this paper.

References

  • 1.DeBerardinis RJ & Chandel NS Fundamentals of cancer metabolism. Sci. Adv 2, e1600200 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Pollak N, Dölle C. & Ziegler M. The power to reduce: pyridine nucleotides–small molecules with a multitude of functions. Biochem. J 402, 205–218 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Hosios AM & Vander Heiden MG The redox requirements of proliferating mammalian cells. J. Biol. Chem 293, 7490–7498 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hoxhaj G. & Manning BD The PI3K–AKT network at the interface of oncogenic signalling and cancer metabolism. Nat. Rev. Cancer 20, 74–88 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Xiao W, Wang R-S, Handy DE & Loscalzo J. NAD(H) and NADP(H) redox couples and cellular energy metabolism. Antioxid. Redox Signal 28, 251–272 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Fan J. et al. Quantitative flux analysis reveals folate-dependent NADPH production. Nature 510, 298–302 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lewis CA et al. Tracing compartmentalized NADPH metabolism in the cytosol and mitochondria of mammalian cells. Mol. Cell 55, 253–263 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Schieber M. & Chandel NS ROS function in redox signaling and oxidative stress. Curr. Biol 24, R453–R462 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Goodman RP, Calvo SE & Mootha VK Spatiotemporal compartmentalization of hepatic NADH and NADPH metabolism. J. Biol. Chem 293, 7508–7516 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Nilsson R. et al. Metabolic enzyme expression highlights a key role for MTHFD2 and the mitochondrial folate pathway in cancer. Nat. Commun 5, 3128 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Locasale JW Serine, glycine and one-carbon units: cancer metabolism in full circle. Nat. Rev. Cancer 13, 572–583 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Patra KC & Hay N. The pentose phosphate pathway and cancer. Trends Biochem. Sci 39, 347–354 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Piskounova E. et al. Oxidative stress inhibits distant metastasis by human melanoma cells. Nature 527, 186–191 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ju H-Q, Lin J-F, Tian T, Xie D. & Xu R-H NADPH homeostasis in cancer: functions, mechanisms and therapeutic implications. Signal Transduct. Target. Ther 5, 231 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Agledal L, Niere M. & Ziegler M. The phosphate makes a difference: cellular functions of NADP. Redox Rep. 15, 2–10 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hoxhaj G. et al. Direct stimulation of NADP+ synthesis through Akt-mediated phosphorylation of NAD kinase. Science 363, 1088–1092 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ohashi K, Kawai S. & Murata K. Identification and characterization of a human mitochondrial NAD kinase. Nat. Commun 3, 1248 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Pomerantz DJ et al. Clinical heterogeneity of mitochondrial NAD kinase deficiency caused by a NADK2 start loss variant. Am. J. Med. Genet. A 176, 692–698 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhang K. et al. Deficiency of the mitochondrial NAD kinase causes stress-induced hepatic steatosis in mice. Gastroenterology 154, 224–237 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Cantor JR et al. Physiologic medium rewires cellular metabolism and reveals uric acid as an endogenous inhibitor of UMP synthase. Cell 169, 258–272 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bayraktar EC et al. MITO-Tag mice enable rapid isolation and multimodal profiling of mitochondria from specific cell types in vivo. Proc. Natl Acad. Sci. USA 116, 303–312 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Tanner JJ, Fendt S-M & Becker DF The proline cycle as a potential cancer therapy target. Biochemistry 57, 3433–3444 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Poncet-Montange G, Assairi L, Arold S, Pochet S. & Labesse G. NAD kinases use substrate-assisted catalysis for specific recognition of NAD. J. Biol. Chem 282, 33925–33934 (2007). [DOI] [PubMed] [Google Scholar]
  • 24.Rydström J. Mitochondrial NADPH, transhydrogenase and disease. Biochim. Biophys. Acta 1757, 721–726 (2006). [DOI] [PubMed] [Google Scholar]
  • 25.Arruabarrena-Aristorena A, Zabala-Letona A. & Carracedo A. Oil for the cancer engine: the cross-talk between oncogenic signaling and polyamine metabolism. Sci. Adv 4, eaar2606 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Elia I. et al. Proline metabolism supports metastasis formation and could be inhibited to selectively target metastasizing cancer cells. Nat. Commun 8, 15267 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Harris IS & DeNicola GM The complex interplay between antioxidants and ROS in cancer. Trends Cell Biol. 30, 440–451 (2020). [DOI] [PubMed] [Google Scholar]
  • 28.Chen L, Ducker GS, Lu W, Teng X. & Rabinowitz JD An LC–MS chemical derivatization method for the measurement of five different one-carbon states of cellular tetrahydrofolate. Anal. Bioanal. Chem 409, 5955–5964 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ben-Sahra I, Hoxhaj G, Ricoult SJH, Asara JM & Manning BD mTORC1 induces purine synthesis through control of the mitochondrial tetrahydrofolate cycle. Science 351, 728–733 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ben-Sahra I, Howell JJ, Asara JM & Manning BD Stimulation of de novo pyrimidine synthesis by growth signaling through mTOR and S6K1. Science 339, 1323–1328 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Donnelly N, Gorman AM, Gupta S. & Samali A. The eIF2α kinases: their structures and functions. Cell. Mol. Life Sci 70, 3493–3511 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wolfson RL & Sabatini DM The dawn of the age of amino acid sensors for the mTORC1 pathway. Cell Metab. 26, 301–309 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Bradshaw PC Cytoplasmic and mitochondrial NADPH-coupled redox systems in the regulation of aging. Nutrients 11, 504 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Houten SM et al. Mitochondrial NADP(H) deficiency due to a mutation in NADK2 causes dienoyl-CoA reductase deficiency with hyperlysinemia. Hum. Mol. Genet 23, 5009–5016 (2014). [DOI] [PubMed] [Google Scholar]
  • 35.Sullivan LB et al. Supporting aspartate biosynthesis is an essential function of respiration in proliferating cells. Cell 162, 552–563 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Birsoy K. et al. An essential role of the mitochondrial electron transport chain in cell proliferation is to enable aspartate synthesis. Cell 162, 540–551 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Brandriss MC Isolation and preliminary characterization of Saccharomyces cerevisiae proline auxotrophs. J. Bacteriol 138, 816–822 (1979). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.De Ingeniis J. et al. Functional specialization in proline biosynthesis of melanoma. PLoS ONE 7, e45190 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Allfrey V, Daly MM & Mirsky AE Synthesis of protein in the pancreas. The role of ribonucleoprotein in protein synthesis. J. Gen. Physiol 37, 157–175 (1953). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Case RM Synthesis, intracellular transport and discharge of exportable proteins in the pancreatic acinar cell and other cells. Biol. Rev. Camb. Philos. Soc 53, 211–354 (1978). [DOI] [PubMed] [Google Scholar]
  • 41.Logsdon CD & Ji B. The role of protein synthesis and digestive enzymes in acinar cell injury. Nat. Rev. Gastroenterol. Hepatol 10, 362–370 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Ye J. et al. The GCN2–ATF4 pathway is critical for tumour cell survival and proliferation in response to nutrient deprivation. EMBO J. 29, 2082–2096 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Tameire F. et al. ATF4 couples MYC-dependent translational activity to bioenergetic demands during tumour progression. Nat. Cell Biol 21, 889–899 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Marin-Valencia I. et al. Analysis of tumor metabolism reveals mitochondrial glucose oxidation in genetically diverse human glioblastomas in the mouse brain in vivo. Cell Metab. 15, 827–837 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Hui S. et al. Glucose feeds the TCA cycle via circulating lactate. Nature 551, 115–118 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Chen WW, Freinkman E, Wang T, Birsoy K. & Sabatini DM Absolute quantification of matrix metabolites reveals the dynamics of mitochondrial metabolism. Cell 166, 1324–1337 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Vinci M. et al. Advances in establishment and analysis of three-dimensional tumor spheroid-based functional assays for target validation and drug evaluation. BMC Biol. 10, 29 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Chen G. & Deng X. Cell synchronization by double thymidine block. Bio. Protoc 8, e2994 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Chen WW, Freinkman E. & Sabatini DM Rapid immunopurification of mitochondria for metabolite profiling and absolute quantification of matrix metabolites. Nat. Protoc 12, 2215–2231 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental

Data Availability Statement

Supplementary Information including Supplementary Tables 1–3 and a figure exemplifying the gating strategy for Extended Data Fig. 6 are provided with this paper. All other data are available from the corresponding author upon request. Source data are provided with this paper.

RESOURCES