Cisplatin alkylating activity in zebrafish causes resistance to chorionic degradation and inhibition of osteogenesis

Abstract

Zebrafish have gained popularity as a model organism due to their rapid, external, and transparent development, high fecundity, and gene homology with higher vertebrate models and humans. Specifically, drug discovery has had high success in the implementation of zebrafish in studies for target discovery, efficacy, and toxicity. However, a major limitation of the zebrafish model is a dependence on waterborne exposure in order to maintain high throughput capabilities. Dose delivery can be impeded by a matrix of N-linked glycoproteins and other polypeptides called the chorion. This acelluar barrier is protective of the developing embryo, and thus new approaches for assessment have involved their removal. In these studies, we explored the chorionic interference of a well-characterized alkylating chemotherapeutic, cisplatin, known to accumulate in the chorion of zebrafish and cause delayed hatching. Our results indicated that increased exposure of cisplatin due to dechorionation did not alter morphological endpoints, although retained confinement reduced total body length and yolk utilization. Additionally, inhibition of osteogenesis visualized with Alizarian Red staining, was observable in dechorionated and non-dechorionated treatment groups. The chorions of cisplatin-treated embryos showed resistance to degradation unless treated with a pronase solution. This may be may be due to cisplatin covalently crosslinking which reinforces the structure. As such, the chorion may play an advantageous role in studies to determine alkylating activity of novel compounds. Furthermore, the expression of zebrafish hatching enzyme was not affected by cisplatin exposure. These studies demonstrate that not only was recapitulation of mechanistic activity supported in zebrafish, but highly relevant off-target toxicities observed in higher vertebrates were identified in zebrafish, regardless of chorionation. Experimental design in drug discovery should consider preliminary studies without dechorionation in order to determine dose impediment or off-target adducting.

The platinum-based (Pt) chemotherapeutic cisplatin (CisPt) is a highly successful anti-neoplastic drug regarded by the World Health Organization as an essential drug treatment (WHO, 2016). The success of CisPt precipitated the creation of alternative platinum derivatives (platins) including oxaliplatin and carboplatin. Together, platins are used to treat approximately 50 % of all cancer diagnoses (Wheate et al., 2010). Mechanistically, CisPt enacts its anti-neoplastic effects by alkylating activity. CisPt undergoes aquation within the cytoplasm of the cell, in which the two chloride molecules are exchanged for water, yielding a chlorohydroxo complex. This species is highly reactive and binds to nucleophilic guanine or adenine within DNA resulting in bulky adducts (Eastman, 1987; Hall et al., 2008). These bulky adducts are identified during proliferation, causing CisPt to specifically target dividing (cancerous and non-cancerous) cells. The adducts initiate a cascade of events resulting in apoptosis (Bellon et al., 1991). However, DNA is not an exclusive target, and studies have shown that only approximately 1% of CisPt reaches the nucleus (Gonzalez et al., 2001; Legin et al., 2014; Centerwall et al., 2006). Alternative nucleophiles, such as the sulfur or nitrogen atoms of amino acids in proteins can provide binding sites for the activated form of CisPt (Möltgen et al., 2020; Russo Krauss et al., 2016; Gullo et al., 1980; Kato et al., 2019).

The zebrafish (Danio rerio) model has gained significant popularity for higher throughput efficacy and toxicity assessments (Leonard and Randall, 2005; Santoriello and Zon, 2012; MacRae and Peterson, 2015). This is due to inherent characteristics of the model including rapid, external, and transparent development, high fecundity, and 70 % functional homology with human genes (Kimmel et al., 1995; Howe et al., 2013). This model allows for expedited examination of adverse outcome pathways from a biochemical level to whole organism endpoints, which is especially relevant for compounds or diseases that may affect multiple organ systems. In fact, large screening for drug activity in zebrafish has identified novel compounds tested in clinical trials (Leonard and Randall, 2005; Santoriello and Zon, 2012; MacRae and Peterson, 2015; Tan and Zon, 2011; North et al., 2007; White et al., 2011). Although this model has become an asset to the drug development paradigm, a major limitation of the zebrafish model is dose delivery by waterborne exposure. This delivery system can be inefficient due to poor solubility of compounds, short half-lives in solution, photodegradation and others. This is further complicated by the poorly characterized permeability of the 1.5–2.5 μm thick acellular encapsulating envelope of pre-hatched zebrafish called the chorion. The chorion is composed of a matrix of N-linked glycoproteins including collagen, gelantin, and fibronectin and other polypeptides which contains nanopores that allow nutrient access from the external environment (Bonsignorio et al., 1996).

In order to eschew this complication, recent research has including the process of dechorionation in treatment protocols (Henn and Braunbeck, 2011; Mandrell et al., 2012). However, our research suggests that the chorion may also provide information regarding the activity of molecules. Our previous work and others demonstrated that zebrafish exposed to CisPt were delayed in hatching up to 5 dpf although typical hatching ranges from 2–3 dpf. Furthermore, ICP-MS quantification determined that 92–96 % of the total CisPt accumulated in the chorion (Karas et al., 2019; Kovacs et al., 2016). Based on the nucleophilic activity of the aqueous species, we hypothesized that CisPt crosslinks with proteins in the chorion (Fig. 1).

Fig. 1.

Proposed crosslinking mechanism of CisPt-induced delayed hatching. CisPt alkylating activity has been shown to target nucleophilic groups in proteins. Created in BioRender.com.

The AB strain zebrafish (ZIRC, Eugene, OR) was used for all experiments. Breeding stocks were bred and housed in Aquatic Habitats (Apopka, FL) recirculating systems in Lipman Hall, Cook Campus at Rutgers University, New Brunswick under a 14/10 h light/dark cycle. Embryos were collected within 1 h after fertilization, washed with egg water (60 μg/mL Instant Ocean in DI water), and cleaned thoroughly. Morphometric studies were conducted in single-housed (2 mL glass vials) and all other studies were group-housed (20 mL glass vials). All waterborne exposures contained less than 0.05 % of DMSO and began at 3 h post fertilization (hpf) with static renewal (every 24 h) solution. To investigate chorionic interference of exposure, morphological measurements and treatments were carried out in non-dechorionated (naturally hatched) and manually dechorionated fish. Manual dechorionation was conducted at 48 hpf in order to mimic a natural hatching time point (Kimmel et al., 1995). A 15 mg/L CisPt concentration was selected due to low lethality and high percent delayed hatching. These larvae were stained with both Alcian Blue and Alizarin Red after a 5-day exposure to improve visualization and highlight alterations to cartilage and bone development, respectively. Total body length was significantly decreased in CisPt treated groups, which mirrored the increased yolk sac size (Fig. 2A and C). Inhibited growth coupled with lack of nutrient utilization may be due to the anti-proliferative effects of CisPt. This effect was augmented in embryos that were not dechorionated, most likely due to retained confinement and the lack of mobility as observed in alternative studies with delayed hatching (Peng et al., 2015; Zoupa and Machera, 2017). Intraocular distance was decreased to a similar extent for non-dechorionated and dechorionated fish and CisPt treatment did not appear to alter pericardial sac size (Fig. 2B and D). CisPt treated fish, regardless of dechorionation, showed completely inhibited bone development within the otic capsules located posterior the eye as well as bone structures along the jaw and gills, although no alterations were identified in cartilage formation. Additionally, non-dechorionated CisPt exposed larval manifested impaired cranio-facial development (Fig. 2E).

Fig. 2.

Morphological measurements A) total body length B) intraocular distance C) yolk sac area and D) pericardial sac area were conducted at 5 dpf after fixing and staining. Treatment groups included egg water controls (Con), controls which were dechorionated at 48 hpf (D. Con), CisPt treatment with dechorionation at 48 hpf (D. CisPt), and CisPt treatment without dechorionation (CisPt). CisPt concentrations were 15 mg/L. T-tests were conducted between Con and CisPt as well as D. Con and D. CisPt. Similar letters indicate significance differences between groups for T-tests, P < 0.05. E) Sagittal and axial views of treatment groups. Cranio-facial impairments are indicted in the CisPt treated larvae with black arrows. Otoliths (OT) and other areas of bone formation involving the gills: the opercle (OP) and ceratobranchial 5 bone (CB), and cleithrum (C) are indicated with labels. Note that these structures are not present in CisPt treated groups.

SDS PAGE was conducted to determine alterations in protein size by CisPt crosslinking and adduct formation. Embryos were treated with egg water, 30 mg/L, or 60 mg/L concentration of CisPt. Concentrations were chosen for maximum delayed hatching and embryos were manually dechorionated prior to the release of hatching enzyme at 22 hpf (Fig. 3) (Sano et al., 2008). Samples were collected as composites of 15 chorions. Wash steps were included to remove excess pronase reagent prior to denaturing with temperature and laemmli (PW). This was done in order to inhibit complete degradation, which can be observed in the pronase without was treatments (P). Within the control groups, pronase treated samples degraded larger proteins, which is evident by the attenuation of high molecular weight bands (100–250 kDA) with a mirrored increase in the appearance and size of lower molecular weight bands (10–25 kDA). CisPt treated groups without the addition of pronase were extremely resistant to degradation even after incubation in laemmli denaturing agent as designated by arrows; although some low molecular weight bands are apparent indicating minor degradation. CisPt treated chorions with subsequent pronase treatment were successfully degraded as evidenced by a lack of protein within the wells, and low molecular weight bands.

Fig. 3.

SDS PAGE was conducted on chorions treated with egg water (control), 30 or 60 mg/mL CisPt. CisPt-treated chorions are resistant to degradation and do not migrate through the gel (arrows). Pronase (P) treatment and pronase treatment with a rinse/wash (PW) degraded CisPt-treated chorions and allowed migration.

Evaluation of RNA transcript levels for zhe1 were conducted at concentrations of 7.5 and 15 mg/L CisPt in order to avoid non-lethal lesions while maintaining significant differences in delayed hatching. Treatments were conducted from 3–24 hpf, rinsed 3xs with DI water and snap-frozen in liquid nitrogen. RNA was isolated from composite samples of 50 embryos using RNAzol (Sigma-Aldrich). Reverse transcription was performed to produce cDNA using a High-Capacity cDNA Reverse Transcription Kit (Thermofischer) and a PTC-200 Peltier Thermal Cycler. RT-PCR was performed in triplicate using PowerUp SYBR Green Master Mix (ThermoFischer) and cDNA amplification was performed for 40 cycles on a QuantStudio 3 (Applied Biosystems) and recorded with QuantStudio Design and Analysis Software and analyzed in Thermocloud (ThermoFischer). Analysis was conducted as ΔΔCT using 28S as an endogenous control. No significant fold change was identified between control (RQ: 1.0 +/− 0.3) and either dose of CisPt treated fish, RQ: 1.16 ± 0.3 and 0.87 ± 0.3 for 7.5 and 15 mg/L CisPt, respectively. These data indicate that the delay in hatching is not due to impaired expression of the hatching enzyme. Zhe1 primers: F: GCCCGGTCTGGAAACCA, R: GTCCGATCTGCACGTTTTCA and 28s: F: CCTCACGATCCTTCTGGCTT, R: AATTCTGCTTCACAATGATA

The alkylating mechanism of CisPt-induced apoptosis as well as its off-target binding has been well-established. We had hypothesized that CisPt protein crosslinking within the chorion caused a delayed hatching phenomenon, supported by our previous studies which demonstrate significant platinum accumulation in the chorion compared to larval tissue (Karas et al., 2019). Here we demonstrated that extracted chorions exposed to CisPt are resistant to denaturing caused by heating and di-sulfide bond breakage (Fig. 3). Furthermore, CisPt impacts to the transcript levels of zhe1 were also investigated and showed no significant difference between mRNA levels of control fish and fish treated with two concentrations of CisPt with confirmed delayed hatching. As such, CisPt may be causing a reinforcement effect of the chorion and/or binding to zhe1 rendering it ineffective. Although these studies support the mechanistic activity of CisPt in zebrafish, chorionic interferences alter endpoint severity as determined the by differences in certain morphological endpoints including cranio-facial development (Fig. 2A, C, D and E). However, regardless of dechorionation, cisplatin enacts toxicological effects in zebrafish identified in higher vertebrates including ototoxicity and inhibited osteogenesis as demonstrated by lack of Alizarian Red staining for calcium deposits and bone (Fig. 2E) (Stine et al., 2014; Dantas et al., 2019; Sheth et al., 2017). These studies demonstrate that not only was recapitulation of mechanistic activity supported in zebrafish, but a highly relevant off-target toxicities were identified.

If future studies are conducted to determine alkylating activity of novel compounds, the chorion may play an advantageous role. Furthermore, dechorionation to study toxicological effects should depend on whether the compound is intended to study pharmacology or environmental impacts, as dechorionation is not a natural phenomenon. However, studies to determine efficacy and toxicity for higher vertebrate translation may consider small preliminary studies without dechorionation in order to determine dose impediment or off-target adducting.

Abbreviations:

CisPt

Cisplatin

ICP-MS

Inductively Coupled Plasma – Mass Spectrometry

D

dechorionated

zhe1

zebrafish hatching enzyme 1

dpf

days post fertilization

hpf

hours post fertilization

con

control

P

pronase

W

wash

PW

pronase with wash

ZIRC

Zebrafish International Research Center

DMSO

dimethyl sulfoxide

SDS

Sodium dodecyl sulfate