Skip to main content
eLife logoLink to eLife
. 2022 Jun 22;11:e75580. doi: 10.7554/eLife.75580

Live imaging of the co-translational recruitment of XBP1 mRNA to the ER and its processing by diffuse, non-polarized IRE1α

Silvia Gómez-Puerta 1, Roberto Ferrero 1, Tobias Hochstoeger 2,3, Ivan Zubiri 1, Jeffrey Chao 2, Tomás Aragón 1,, Franka Voigt 2,
Editors: Jeffrey L Brodsky4, David Ron5
PMCID: PMC9217131  PMID: 35730412

Abstract

Endoplasmic reticulum (ER) to nucleus homeostatic signaling, known as the unfolded protein response (UPR), relies on the non-canonical splicing of XBP1 mRNA. The molecular switch that initiates splicing is the oligomerization of the ER stress sensor and UPR endonuclease IRE1α (inositol-requiring enzyme 1 alpha). While IRE1α can form large clusters that have been proposed to function as XBP1 processing centers on the ER, the actual oligomeric state of active IRE1α complexes as well as the targeting mechanism that recruits XBP1 to IRE1α oligomers remains unknown. Here, we have developed a single-molecule imaging approach to monitor the recruitment of individual XBP1 transcripts to the ER surface. Using this methodology, we confirmed that stable ER association of unspliced XBP1 mRNA is established through HR2 (hydrophobic region 2)-dependent targeting and relies on active translation. In addition, we show that IRE1α-catalyzed splicing mobilizes XBP1 mRNA from the ER membrane in response to ER stress. Surprisingly, we find that XBP1 transcripts are not recruited into large IRE1α clusters, which are only observed upon overexpression of fluorescently tagged IRE1α during ER stress. Our findings support a model where ribosome-engaged, immobilized XBP1 mRNA is processed by small IRE1α assemblies that could be dynamically recruited for processing of mRNA transcripts on the ER.

Research organism: Human

Introduction

Cellular organization depends on the ability of cells to recruit mRNA and protein molecules to precise subcellular localizations. In eukaryotic cells, mRNA transcripts that encode membrane and secreted proteins are targeted to the endoplasmic reticulum (ER) to facilitate the efficient and often co-translational delivery of their protein products to the ER lumen. mRNA targeting is mediated through the co-translational recognition of an N-terminal signal sequence by the signal-recognition particle (SRP; Walter et al., 1981). SRP-ribosome-nascent chain complexes are recruited to the surface of the ER by the SRP receptor (Gilmore et al., 1982), which channels the nascent polypeptide into the ER lumen through interaction with the Sec61 translocon (Görlich et al., 1992).

The unfolded protein response (UPR) acts as a combination of quality control pathways that monitor the folding status of proteins within the ER lumen and adjust the capacity of the ER’s folding machinery (Walter and Ron, 2011). IRE1α (inositol-requiring enzyme 1 alpha) triggers the most conserved branch of the UPR (Cox et al., 1993; Mori et al., 1993). It is an ER membrane resident stress sensor that is activated by the accumulation of misfolded proteins in the ER lumen and signals ER stress through the non-canonical splicing of X-box binding protein 1 mRNA (XBP1, HAC1 in yeast; Sidrauski and Walter, 1997; Tirasophon et al., 1998; Yoshida et al., 2001).

Processing of unspliced XBP1 (XBP1u) mRNA is initiated upon oligomerization and trans-autophosphorylation of IRE1α (Ali et al., 2011), which leads to the allosteric activation of its cytosolic kinase and RNAse domains (Korennykh et al., 2009). Once activated, IRE1α excises a highly conserved 26 nucleotide intron from the XBP1 coding sequence (Calfon et al., 2002; Yoshida et al., 2001) and the severed exons are rejoined by the tRNA ligase RtcB (Jurkin et al., 2014; Kosmaczewski et al., 2014; Lu et al., 2014). Intron excision causes a translational frameshift in the spliced XBP1 (XBP1s) transcript, which encodes a potent transcription factor that increases the folding capacity of the ER through a broad activation of stress response genes (Acosta-Alvear et al., 2007), including expression of ER-associated degradation factors (Brodsky, 2012). Beyond processing XBP1 mRNA, metazoan IRE1α is able to cleave a variety of mRNAs to initiate their rapid degradation in a pathway known as regulated IRE1-dependent decay (RIDD; Hollien et al., 2009; Hollien and Weissman, 2006). Even though RIDD has been found to play a key role in some pathological conditions, XBP1 splicing stands out as the main physiological output of IRE1 activation (Ishikawa et al., 2017).

To efficiently support rapid responses to ER stress, eukaryotic organisms display different strategies to ensure the timely encounter of IRE1α and its substrate mRNAs. In Saccharomyces cerevisiae, acute ER stress triggers the rapid oligomerization of IRE1 protein into a discrete number of foci (Aragón et al., 2009; Kimata et al., 2007). HAC1 mRNA, the yeast homolog of XBP1, is then recruited into these foci through a bipartite element that is located in the HAC1 3' untranslated region (UTR) while translational repression is imposed by the HAC1 intron itself (Aragón et al., 2009; Rüegsegger et al., 2001; van Anken et al., 2014). This swift targeting of HAC1 mRNA to pre-formed IRE1p clusters is essential to allow a timely response to ER stress and to sustain yeast proteostasis (Pincus et al., 2010).

The activation of metazoan IRE1α has been proposed to follow the same principles that were defined in yeast. Under ER stress, ectopic, fluorescently labeled IRE1α was found to cluster into large dynamic foci, and the kinetics of cluster assembly and disassembly approximately correlated with XBP1 splicing rates (Li et al., 2010). Yet, there is no direct evidence that the formation of large IRE1α clusters is required for splicing. Even though oligomerization of IRE1α has been proven to be the regulatory step that coordinates mRNA cleavage (Korennykh et al., 2009; Li et al., 2010) and the disruption of oligomerization interfaces has been shown to diminish RNAse activity (Karagöz et al., 2017; Sanches et al., 2014), the specific oligomeric state of splicing-competent IRE1α assemblies has not been precisely determined. In addition, only a minor fraction (~5%) of all cellular IRE1α protein concentrates in detectable foci (Belyy et al., 2020) and there is no direct evidence that they are indeed the sites of XBP1 processing at the ER.

In contrast to yeast HAC1, metazoan XBP1 mRNA is recruited to the ER surface through co-translational targeting that involves a peptide signal sequence and not a cis-acting localization element. Specifically, XBP1u transcripts encode a hydrophobic stretch (HR2) located at the C-terminal half of the protein that mimics a secretion signal (Yanagitani et al., 2009). On translation, this hydrophobic stretch is recognized by SRP, which delivers the nascent chain complex to the Sec61 translocon in the ER membrane (Plumb et al., 2015). Recognition of the HR2 peptide is aided by a translational pausing mechanism that has been proposed to stall the translating ribosome through high-affinity interactions with the peptide exit tunnel. This conveys stability to the mRNA-ribosome-nascent chain complex that facilitates its delivery to the ER membrane (Kanda et al., 2016; Yanagitani et al., 2011). Such a co-translational targeting mechanism suggests that IRE1α encounters XBP1u mRNA at the Sec61 translocon, where translating ribosomes would be poised. This notion is supported by the reported interaction of IRE1α with the translocon complex as well as by crosslinking data that find IRE1α in close contact with SRP, ribosomal RNAs (rRNAs), and a subset of ER-targeted mRNAs (Acosta-Alvear et al., 2018; Plumb et al., 2015). However, this model is difficult to reconcile with a situation where IRE1α molecules are recruited into large clusters with complex topologies that are not simply 2D patches in the ER membrane but have also been described to exclude the Sec61 translocon from specific regions within the clusters (Belyy et al., 2020).

Here, we have developed a single-molecule imaging approach that visualizes individual XBP1 mRNA transcripts and thus provides an important framework for the investigation of fundamental UPR biology principles and the recruitment of XBP1 mRNA to IRE1α and the ER surface. We image individual XBP1 transcripts that have been recruited for splicing on the ER and show that their recruitment is mediated by a translation-dependent targeting mechanism that involves SRP but functions through a non-canonical signal sequence. We demonstrate that XBP1 mRNAs are mobilized from the ER surface upon induction of ER stress by IRE1α-catalyzed splicing. Using a dual-color live imaging approach, we visualize individual XBP1 mRNA transcripts together with IRE1α-GFP (green fluorescent protein), which only assembles into clusters at increased expression levels and does not stably associate with XBP1 mRNA under splicing inhibition conditions. Instead, when expressed at endogenous levels, IRE1α-GFP simply outlines the ER and cleaves XBP1 mRNA in the absence of cluster formation during ER stress. This finding is further confirmed by a complimentary study that images single IRE1α molecules to characterize their oligomerization dynamics in response to ER stress and also demonstrates that large IRE1α clusters are not required for splicing activity (Belyy et al., 2021).

Results

In order to directly visualize the recruitment of XBP1 mRNA to the ER, we developed a single-molecule imaging approach that takes advantage of the MS2 labeling system to detect individual reporter mRNAs in living cells (Bertrand et al., 1998). We generated an XBP1 wild-type (WT) reporter transcript that comprises the complete Mus musculus open reading frame (ORF) as well as its complete 3'UTR (Figure 1A, red; Calfon et al., 2002; Sugimoto et al., 2015). To enable the detection of single mRNA molecules at high signal-to-noise ratios, we further included 24 MS2 stem-loops in the 3'UTR of all reporter transcripts (Figure 1A) and made use of their specific recognition by fluorescently labeled synonymous tandem MS2 coat proteins (stdMCPs; Bertrand et al., 1998; Wu et al., 2015).

Figure 1. Live imaging of XBP1 mRNA recruitment to the endoplasmic reticulum (ER).

(A) Reporter construct design: XBP1 wild-type (WT; red) features the mouse XBP1 opening reading frame (ORF) and 3' untranslated region (UTR) and contains a 24 × MS2 stem loop array for mRNA detection. XBP1 HR2 mutant (yellow) is identical to the WT construct but contains a point mutation downstream of the ER intron that renders the HR2 peptide out-of-frame. The Gaussia luciferase reporter (gray) is a canonical signal-recognition particle (SRP)-recruited transcript and serves as positive control for ER association. (B) qPCR (quantitative polymerase chain reaction) assay showing splicing of MS2-labeled XBP1 reporter transcripts upon induction of ER stress with thapsigargin (TG). HeLa cells expressing WT and HR2 mutant reporters were treated with 0.2 µg/ml doxycycline (Dox) for 15 hours before addition of 100 nM TG for indicated times. Graph indicates the average ± SD (n=3). Statistical test Kruskal-Wallis and Dunn's multiple comparison test. * p<0.05, ** p<0.01, *** p<0.0001 (C) Western blot against XBP1 protein in response to unfolded protein response (UPR) activation with 100 nM TG for indicated times using an antibody that does not distinguish between XBP1u/s proteins but preferentially recognizes mouse over human XBP1 (human XBP1s background signal is detectable in samples w/o reporter expression = no Dox). Black triangle: 55 kDa band corresponding to endogenous and reporter WT XBP1s, which have the same size as unspliced HR2 mutant protein. White triangle: spliced HR2 mutant XBP1s protein. Asterisk (*): short protein product present before TG treatment. Loading control: Gapdh. (D) Representative live-cell image of the XBP1 WT reporter (red) in a HeLa cell expressing NLS-stdMCP-stdHalo and a fluorescent ER marker (gray). Illustration of the image analysis workflow: diffraction-limited spots (*) are individual mRNA transcripts. (E) Same as in (D) but expressing XBP1 HR2 mutant reporters (yellow). All scale bars = 5 µm. (F) Correlated diffusion and ER colocalization analysis of individual XBP1 WT (red), HR2 mutant (yellow), and Gaussia (gray) transcripts. Dots are single particles that were tracked for at least 30 frames. Y-axis: instantaneous diffusion coefficients. X-axis: cumulative ER localization index. Positive values indicate ER colocalization. (G) Boxplot showing ER association quantified from data shown in (F). Statistical test: unpaired t-test, p-value = 1e-8. For raw data see Figure 1—source data 1.

Figure 1—source data 1. Raw gel images for Figure 1.

Figure 1.

Figure 1—figure supplement 1. Characterization of XBP1 splicing and unfolded protein response (UPR) activation in XBP1 wild-type (WT) reporter expressing cells.

Figure 1—figure supplement 1.

HeLa cells stably expressing XBP1-MS2 wild-type (WT) reporters were treated with 0.2 ug/ml doxycycline (Dox) for 15 hours before addition of 100 nM thapsigargin (TG) or 5 mg/ml tunicamycin (TM) for indicated times. (A) Western blot against PERK, ATF4, inositol-requiring enzyme 1 alpha (IRE1α), XBP1s, and GAPDH (loading control). Ectopic expression of XBP1-MS2 did not affect PERK activation or ATF4 synthesis but increased XBP1s levels under endoplasmic reticulum (ER) stress. Note that tunicamycin elicits a milder UPR. Bottom image: agarose gel documenting XBP1-MS2 reporter splicing by semi-quantitative real time (RT)-PCR analysis using mouse-specific oligonucleotides flanking the XBP1 intron. Fastest migrating band = spliced mRNA; middle band = unspliced mRNA; upper band = hybrid dsDNA product, where one strand is ‘spliced’ and the other ‘unspliced’. (B) Quantitative RT-PCR analysis determining the levels of unspliced and spliced XBP1-MS2 mRNA products to calculate splicing ratios (spliced/unspliced mRNA) in response to Dox and ER stress induction. (C) Quantitative RT-PCR analysis of endogenous transcripts: expression of XBP1-MS2 did not significantly alter the splicing ratio of endogenous XBP1 mRNA (hXBP1) or the mRNA levels of the ATF4-regulated asparagine synthetase (AsnS). And the increase of XBP1s levels in XBP1-MS2 cells led to an increase in the levels of the XBP1s-regulated ERdJ4 mRNA. (D) HeLa cells expressing XBP1 WT reporters with (XBP1-MS2) and w/o (XBP1) stem loop array were incubated in the presence of TG for the indicated time points. Splicing was visualized by semi-quantitative RT-PCR (upper panel) and quantified via qPCR-derived splicing ratios (bottom panels), as described above. In parallel, we confirmed that ectopic, murine XBP1 expression did not interfere with endogenous XBP1 splicing. In B, C and D, graphs shows the average ± SD from three independent experiments. Statistical test Kruskal-Wallis and Dunn's multiple comparison test was applied, and no significant differences were observed. For raw data see Figure 1—figure supplement 1—source data 1.
Figure 1—figure supplement 1—source data 1. Raw gel images for Figure 1—figure supplement 1.

Figure 1—figure supplement 2. Flotation assays to investigate HR2-mediated recruitment of XBP1 reporter transcripts to endoplasmic reticulum (ER) membranes.

Figure 1—figure supplement 2.

(A) HEK293 cells were subjected to hypotonic lysis and cytosolic extracts were subjected to flotation in discontinuous sucrose gradients. Fractions 2–3 include floating membranes (as indicated by the ER protein Calnexin), while cytosolic components concentrate in fractions 6–8 (as indicated by GAPDH). Endogenous XBP1s mRNA predominantly associates with cytosolic fractions, while a significant fraction of XBP1u mRNA is found in membrane fractions, albeit to a lesser extent than signal-recognition particle-targeted mRNAs, such as BiP (binding immunoglobulin protein). (B) Quantification of membrane association for endogenous transcripts and reporter mRNAs. The XBP1 wild-type (WT) reporter (red) behaves similar to the endogenous XBP1u transcript. The XBP1 HR2 mutant reporter (yellow) is not found in the membrane fractions and behaves like the endogenous XBP1s mRNA. Graph indicates the average ± SD (n=3). (C) Cartoon illustration of reporter transcripts used in flotation assays. Constructs ‘intron +1’, ‘exon1 +2’, and ‘exon2 +1’ all introduce frameshift mutations abolishing HR2 expression. Constructs ‘HR2 back’ and ‘HR2 back2’ restore the frameshift introduced above and thereby reconstitute membrane association. (D) Reporter constructs depicted in (C) were used to generate HEK293 Flp-In stable cell lines. Cytosolic extracts from these cultures were separated in flotation experiments and analyzed as shown in (A,B). Bar plot represents the average ± SD of at least three independent experiments. Statistical analysis scored differences between WT and each of the mutants. Unpaired Student t-test was used for statistical analysis ** p<0.01. For raw data see Figure 1—figure supplement 2—source data 1.
Figure 1—figure supplement 2—source data 1. Raw gel images for Figure 1—figure supplement 2.

To complement the XBP1 WT reporter, we introduced a frameshift mutation downstream of the ER intron (Figure 1A, yellow, HR2 mutant) to prevent synthesis of the HR2 peptide, which has been shown to be essential for non-canonical SRP-mediated translocation of XBP1u mRNA to the ER membrane (Kanda et al., 2016; Yanagitani et al., 2009; Yanagitani et al., 2011). In addition, we employed a previously characterized SRP-recruited reporter (Voigt et al., 2017) to benchmark ER association of XBP1 transcripts against this established reporter construct encoding a secreted Gaussia luciferase protein (Figure 1A, gray).

We next generated HeLa cell lines stably expressing these reporter transcripts under a doxycycline-inducible promoter and from single genomic loci (Weidenfeld et al., 2009). To allow detection of individual mRNA particles as diffraction limited spots in the cytoplasm of living cells, we co-expressed nuclear localization signal-encoding fluorescently labeled NLS-stdMCP-stdHalo fusion proteins, which recruit excess stdMCP to the nucleus and thereby increase the signal-over-noise ratio in the cytoplasm (Voigt et al., 2017).

To confirm that these reporter constructs were indeed splicing competent, we first performed qPCR-based splicing assays (Figure 1B). As expected, we detected an increase in the levels of spliced XBP1 WT mRNA (red), and a transient drop in the levels of unspliced WT mRNA in response to the induction of ER stress with thapsigargin (TG). Using these measurements, we calculated the splicing ratio (spliced/unspliced) as a quantitative readout of splicing efficiency. As expected, splicing ratios increased sharply upon induction of ER stress in WT reporter-expressing cells and were much lower in HR2 mutant-expressing cells (yellow). In agreement with the RNA analysis, we detected increased XBP1s protein levels in response to TG treatment in cells expressing WT reporter transcripts (black triangle, Figure 1C). HR2-mutant cells produced only residual levels of XBP1s in response to TG treatment (white triangle, Figure 1C) while the majority of their XBP1 protein products was still derived from unspliced HR2 mutant transcripts (black triangle, same size as WT XBP1s protein).

We validated that MS2 tagging of ectopic XBP1 mRNA did not compromise its capacity to undergo splicing when ER stress was induced with TG or tunicamycin (TM) and ensured it did not compromise the activation of other UPR signaling mechanisms, such as the one initiated by PERK (Figure 1—figure supplement 1).

To assess XBP1 mRNA mobility and investigate particle dynamics of individual transcripts, we acquired streaming movies at fast frame rates (20 Hz) that detected XBP1 mRNAs as Halo-labeled diffraction limited spots in the cytoplasm of individual HeLa cells (Figure 1D, red). We performed single-particle tracking (SPT) over 100 consecutive frames and used the resulting particle coordinates to determine instantaneous diffusion coefficients (IDCs) as a measure of particle mobility (Berg, 1993; Voigt et al., 2017).

According to current models, XBP1u WT mRNA (but not the HR2 mutant) should be constitutively recruited to the ER surface for IRE1α-mediated splicing during ER stress. To investigate XBP1 mRNA association with the ER, we therefore integrated a fluorescently labeled ER marker protein (Sec61b-SNAP) into the reporter cell lines introduced above (analogous to Belyy et al., 2020). We imaged dual-labeled cells using a fluorescence microscope equipped with two parallel light paths and registered cameras for simultaneous detection of mRNA and ER signal in independent channels (Video 1).

Video 1. XBP1 wild-type (WT) mRNA colocalization with the endoplasmic reticulum (ER).

Download video file (1.2MB, mp4)

HeLa cell line stably expressing XBP1 WT reporter transcripts, NLS-stdMCP-stdHalo, and an ER marker. Simultaneous image acquisition for both channels (XBP1 WT, red, and ER, gray) using 50 ms exposure times (100 frames total). The movie is played at 20 fps. The scale bar is 5 μm.

Next, we quantified the mobility of individual particles with respect to their ER localization, which not only allowed us to visualize the recruitment of individual mRNAs to the ER surface (Figure 1D, upper panels; Video 2) but also enabled us to assess whether a particle is stably associated with the ER (Figure 1D, middle panels; Video 3). To this aim, we segmented the ER signal (Figure 1D, lower panels) and used it to generate distance maps that allowed us to correlate particle coordinates with ER boundaries. In these distance maps, positions on the ER were given positive values, and positions away from the ER were defined as negative. Based on particle trajectories, we determined the localization of individual transcripts throughout the entire image series and calculated cumulative ER localization indices that highlight robust localization phenotypes (Voigt et al., 2017). We combined the diffusion and ER colocalization analysis and employed it to benchmark the behavior of a Gaussia luciferase reporter transcript (Figure 1A) that encodes a secreted protein product and that we have previously shown to be predominantly localized to the ER (Voigt et al., 2017). Next, we performed the same analysis to quantify the mobility and ER association of XBP1 WT and HR2 mutant reporters (Figure 1E).

Video 2. Recruitment of a single XBP1 wild-type mRNA transcript to the endoplasmic reticulum (ER).

Download video file (143.2KB, mp4)

Close-up from the same image series as shown in Video 1 but highlighting an example for a single particle that is recruited to the ER surface.

Video 3. Stable association of a single XBP1 wild-type mRNA transcript with an endoplasmic reticulum (ER) sheet.

Download video file (82.4KB, mp4)

Close-up from the same image series as shown in Video 1 but highlighting an example for a single particle that is stably associated with the ER surface.

The combined data show that a large fraction of XBP1 WT transcripts (Figure 1F, red dots) behaves similar to the secreted Gaussia mRNAs (Figure 1F, gray dots). Many XBP1 WT transcripts exhibit low mobility and colocalize with the ER. However, there is another population of WT reporter tracks not observed for the Gaussia reporter that is more mobile and tends to not localize to the ER. Interestingly, the behavior of this population is exactly matched by the XBP1 HR2 mutant tracks (Figure 1F, yellow dots). These reporter mRNAs seem to have lost their ability to be recruited to the ER surface and exhibit a generally higher degree of mobility that is also apparent upon visual inspection (Figure 1F, Video 4). We employed the correlated diffusion and ER colocalization analysis to quantify the fraction of ER-associated particles per cell. To this aim, we used the clearly ER-associated Gaussia cluster to define cut-offs (D<0.06 μm2s−1 and positive ER localization index, dashed lines in Figure 1F) for identification of XBP1 mRNA particles that showed a similar behavior. Based on these parameters, we found an average (per cell) of 27.4 ± 19.4% (mean ± SD) of all XBP1 WT and 3.1 ± 6.2% of all HR2 mutant transcripts to be associated with the ER (Figure 1G).

Video 4. Lack of colocalization with the endoplasmic reticulum (ER) exhibited by XBP1 HR2 mutant transcripts.

Download video file (1.7MB, mp4)

HeLa cell line stably expressing XBP1 HR2 mutant reporter transcripts, NLS-stdMCP-stdHalo and an ER marker. Simultaneous image acquisition for both channels (HR2 mutant, yellow and ER, gray) using 50 ms exposure times (100 frames total). The movie is played at 20 fps. The scale bar is 5 μm.

To corroborate the findings from the single-particle imaging approach through an independent method, we performed membrane flotation assays that allow separation of membrane from cytosolic fractions (Figure 1—figure supplement 2A; Mechler and Rabbitts, 1981). As expected, we found that XBP1 WT reporter mRNAs were detected in the membrane fractions to a similar extent as the endogenous XBP1u mRNA. In contrast, XBP1u HR2 mutant mRNA lacked membrane association and behaved like endogenous XBP1s (Figure 1—figure supplement 2B). Upon reconstitution of the original ORF through integration of two additional nucleotides that restore the HR2 reading frame but not the upstream part of the ORF, membrane association was restored (Figure 1—figure supplement 2C, D). Association of XBP1 reporter transcripts with the ER is therefore unambiguously linked to the expression of the HR2 peptide.

Together, these findings indicate that XBP1 WT reporter mRNA is recruited to the ER surface albeit to a lesser extent than canonical secretion-signal encoding Gaussia transcripts. Recruitment depends on the expression of the HR2 peptide, since a reporter mRNA that does not produce HR2 failed to associate with the ER. Our results are consistent with the non-canonical mechanism of XBP1 delivery to the ER and confirm that HR2 expression conveys stable ER association in a co-translational manner.

To test if translation-dependent recruitment of XBP1 transcripts to the ER membrane is necessary to enable mRNA splicing, we generated an XBP1 translation site reporter that would allow us to directly monitor XBP1u translation on the ER (Figure 2A). Specifically, we used a nascent polypeptide imaging approach that relies on the co-expression of a well-folded protein scaffold (spaghetti monster, SM) containing nine GCN4 antigen repeats (Eichenberger et al., 2018; Morisaki et al., 2016; Yan et al., 2016) and the MS2 stem loop array introduced above. To quantify protein synthesis of XBP1u transcripts on the ER, we generated a XBP1u translation reporter construct that contains the GCN4-SM downstream of the UPR intron but in frame with the XBP1u ORF. Upon splicing and excision of the intron by IRE1α, the ORF changes to XBP1s and the GCN4-SM is no longer in frame. Thus, the translation site signal can only be detected prior to mRNA splicing.

Figure 2. Association of XBP1u mRNA with the endoplasmic reticulum (ER) is translation dependent.

(A) Reporter construct design and illustration of the method: XBP1u translation reporters feature a 9× GCN4 array (green) inserted into the opening reading frame downstream of the ER intron and in frame with the XBP1u protein. Upon translation of GCN4-XBP1u, emerging GCN4 peptide repeats are recognized by GFP-labeled single-chain antibodies (scAB-GFP), which allow detection of translating ribosomes together with mRNA transcripts. Upon splicing, the reading frame is changed and GCN4 expression is lost. (B) qPCR-based splicing assay to test functionality of XBP1u translation reporter (green) as compared to a non-GCN4-tagged control (gray). Shown is the splicing ratio (XBP1s/XBP1u) in response to induction of ER stress with 100 nM thapsigargin (TG). Graph represents the average ± SD (n=3). Statistical test Kruskal-Wallis and Dunn's multiple comparison test. No significant differences were observed.(C) Western blot against XBP1 proteins. Spliced XBP1 appearance is dependent on reporter expression (Dox) and induction of ER stress with 100 nM TG. Black arrows: XBP1 protein products expressed upon TG and Dox treatment. White arrows: unspecific bands present irrespective of reporter expression (Dox) in response to TG. Asterisk: unspecific bands present in all samples. (D) Representative live-cell image of XBP1u translation sites (green diffraction limited spots) in a HeLa cell expressing scAB-GFP and a fluorescent ER marker (gray). (E) Boxplot showing ER association of XBP1u translation sites (green) as compared to secreted protein encoding Gaussia mRNAs (gray) that serve as an ER-associated positive control. Statistical test: unpaired t-test, p-value = 0.49. (F) Combined single-molecule fluorescence in-situ hybridization (smFISH) and immunofluorescence (IF) analysis for colocalization of XBP1 mRNA (magenta) and translation site signal (green) in fixed HeLa cells (DAPI = blue). The majority of translation site spots disappear upon induction of ER stress with 5 µg/ml tunicamycin (TM) for 2 hours. (G) Quantification of data shown in (F). Individual dots represent per-cell averages. Black bars show mean ± SD. All scale bars = 5 µm. For raw data see Figure 2—source data 1.

Figure 2—source data 1. Source data containing raw gel images for Figure 2.

Figure 2.

Figure 2—figure supplement 1. Live imaging of XBP1u translation sites.

Figure 2—figure supplement 1.

(A) Correlated diffusion and endoplasmic reticulum (ER) colocalization analysis for individual XBP1u translation site tracks (green) and Gaussia mRNA transcripts (gray). Dots are single particles that were tracked for at least 30 frames. Y axis: instantaneous diffusion coefficients. X axis: cumulative ER localization index. Positive values indicate ER colocalization. XBP1u translation site tracks scatter similar to Gaussia mRNA tracks. (B) Representative live-cell image of XBP1u translation reporter mRNA (magenta) and translation site (green) spots in a HeLa cell stably expressing NLS-stdMCP-stdHalo and scAB-GFP. In the absence of stress, the majority of mRNA transcripts are translated. (C) Same as (B) but acquired upon addition of puromycin (PUR) (100 µg/ml). Translation site spots (green) vanish upon PUR-mediated translation inhibition. All scale bars = 5 µm. (D) Histogram plot showing distribution of mean spot intensities in exemplary fixed cell experiment (smFISH-IF, replicate 2). Intensities of mRNA spots that did not colocalize with scAB-GFP signal are shown in dark magenta, while intensities of those mRNA spots that did colocalize with scAB-GFP ( = translation sites) are depicted in light magenta.

Figure 2—figure supplement 2. Colocalization control experiment shows no unspecific association of XBP1 mRNA and scAB-GFP spots.

Figure 2—figure supplement 2.

(A) Schematic illustration of experimental design: GCN4-SM translation reporters either encoding Renilla luciferase (left) or XBP1u (right) were stably expressed in the HeLa imaging cell lines introduced above. To test if scAB-GFP could unspecifically associate with MCP (MS2 coat protein)-Halo or any other part of the XBP1 mRNA, a plasmid encoding the XBP1 wild-type (WT) reporter transcript was transfected into cells stably expressing the GCN4-SM-Renilla reporter (Eichenberger et al., in preparation). Expression of all reporter mRNAs was induced through addition of 0.2 ug/ml doxycycline for 1–2 hours. Cells were fixed, processed for single-molecule fluorescence in-situ hybridization (smFISH) against XBP1 mRNA and immunofluorescence (IF) against scAB-GFP, and the degree of colocalization of mRNA and scAB-GFP signal was quantified for both conditions. (B) Combined smFISH and IF experiment to assess colocalization of XBP1 mRNA (magenta) and translation site signal (green) in fixed HeLa cells (DAPI = blue). XBP1 mRNA and scAB-GFP translation site spots only colocalize if expressed from the same mRNA transcript. (C) Quantification of data shown in (B). Individual dots represent per-cell averages. Black bars show mean ± SD (XBP1u only = 0.50 ± 0.17; XBP1 wt + Renilla Luciferase = 0.01 ± 0.03). All scale bars = 5 µm.

Quantitative real-time (RT)-PCR as well as western blot analysis confirmed that this construct was able to undergo splicing upon induction of ER stress (Figure 2B and C). To characterize the translational status of XBP1 mRNA in live imaging experiments, we employed GFP-fused single-chain antibodies (scAB-GFP; Voigt et al., 2017; Yan et al., 2016) that specifically recognize GCN4 peptides and allow for detection of individual translation sites as diffraction-limited spots in the cytoplasm of HeLa cells co-expressing the Sec61b-SNAP ER marker (Figure 2D, Figure 2—figure supplement 1A, Video 5). As a further characterization of this experimental set-up, we performed a similar dual-color live imaging experiment but this time focused on the simultaneous detection of mRNA and translation site signals. To test whether the bright GFP signal corresponded to individual translation sites, we first acquired the NLS-stdMCP-stdHalo mRNA in parallel with the scAB-GFP translation site signal (Figure 2—figure supplement 1B) and then treated the cells with puromycin (PUR) to inhibit translation (Figure 2—figure supplement 1C). Upon PUR treatment, all scAB-GFP spots disappeared, which led us to conclude that they represent active translation sites.

Video 5. Live imaging of XBP1u translation on the endoplasmic reticulum (ER).

Download video file (1.3MB, mp4)

HeLa cell line stably expressing XBP1u translation reporter transcripts, scAB-GFP, and Sec61b-SNAP as ER marker. Simultaneous image acquisition for both channels (XBP1u translation sites, green, and ER, gray) using 50 ms exposure times (100 frames total). The movie is played at 20 fps. The scale bar is 5 μm.

We proceeded to quantify the degree of ER association observed for XBP1u translation sites in individual cells through the correlated diffusion and ER colocalization analysis introduced above (Figure 2E, Figure 2—figure supplement 1A). Interestingly, this analysis revealed that the majority of XBP1u translation sites colocalized with the ER (53.8 ± 22.1%, mean per cell ± SD) and exhibited a low mobility that is comparable to the behavior of predominantly ER-localized Gaussia transcripts (mean ER association = 57.3 ± 16.8%) but very different from the average degree of ER association assumed by XBP1 WT transcripts (mean ER association = 27.4 ± 19.4%). Thus, we conclude that XBP1u reporters are tethered to the ER surface in a translation-dependent manner.

As the translational frameshift induced by IRE1α-mediated splicing should abolish translation of the GCN4 repeats, we assessed the fraction of translating XBP1u transcripts in response to induction of ER stress. We treated the cells with TM and quantified the degree of colocalization for XBP1u mRNA and translation site spots. To maximize detection efficiency and more accurately estimate particle numbers per cell, we performed a combined single-molecule fluorescence in-situ hybridization (smFISH) and immunofluorescence (IF) experiment in fixed cells (Figure 2F, Figure 2—figure supplement 1D). Specifically, we used smFISH probes against the 5'-end of the M. musculus XBP1 ORF and an anti-GFP antibody that allowed for detection of the scAB-GFP labeled nascent polypeptides by IF. We confirmed that XBP1 mRNA and scAB-GFP translation site spots corresponded to single translation sites that only colocalized when expressed from the same mRNA transcripts (Figure 2—figure supplement 2).

Next, we investigated how ER stress affects the association of XBP1 mRNA with the ER and set out to determine how XBP1u molecules encounter IRE1α. In order to distinguish between the behavior of unspliced and spliced mRNA transcripts, we generated a XBP1 reporter variant with point mutations in the 5' and 3' splice sites of the UPR intron that maintain its stem-loop structure but render the substrate cleavage incompetent (unspliceable, dark blue, Figure 3A, Figure 3—figure supplement 1A, B; Calfon et al., 2002; Gonzalez et al., 1999). In addition, we also generated a variant lacking the intron and constitutively expressing the XBP1s protein (spliced, light blue, Figure 3A, Figure 3—figure supplement 1A, B). We performed dual-color live imaging experiments (Figure 3B, Videos 6 and 7) and quantified reporter mobility and their degree of colocalization with the ER through correlated diffusion and ER colocalization analysis under non-stress conditions (Figure 3—figure supplement 1C, D). To further characterize particle behavior and control against potential higher-order oligomeric assemblies of reporter transcripts, we assessed the mean spot intensities detected for unspliceable and spliced reporter transcripts. They were comparable to the mean intensities of XBP1 WT and HR2 mutant spots that were collected in the same imaging experiment (Figure 3—figure supplement 1E) and exhibited a single defined peak confirming that the spot signal originated from single mRNA transcripts that did not associate in larger oligomeric assemblies.

Figure 3. Inositol-requiring enzyme 1 alpha (IRE1α)-dependent processing and endoplasmic reticulum (ER) association of XBP1u transcripts during stress.

(A) Reporter construct design: Unspliceable (dark blue) and spliced (light blue) reporter transcripts are identical to XBP1 wild-type (WT; red) except for point mutations in the intron (unsplicable) or complete lack of it (spliced). (B) Representative live-cell images of XBP1 splice site mutant reporters (blue) in HeLa cells expressing NLS-stdMCP-stdHalo and Sec61b-SNAP as ER marker (gray). (C) Boxplot showing quantification of ER association from correlated diffusion and ER colocalization analysis for XBP1 WT (red), unspliceable (dark blue), and spliced (light blue) reporter transcripts. Different opacities represent experimental conditions: no treatment (Ctrl), ER stress induced with 3–4 hours of 5 µg/ml tunicamycin (TM), ER stress induced with 3–4 hours of 5 µg/ml TM under IRE1α inhibition with 4µ8C (TM + 4µ8C). Statistical test: unpaired t-test, p-values: (p≥0.05)=ns; (p<0.0001)=****. (D) Representative live-cell images of XBP1 WT reporter constructs (red) in HeLa cells expressing NLS-stdMCP-stdHalo and Sec61b-SNAP as ER marker (gray) under ER stress (5 µg/ml TM) as well as ER stress with IRE1α inhibition (5 µg/ml TM and 50 µM 4µ8C). All scale bars = 5 µm.

Figure 3.

Figure 3—figure supplement 1. Validation of splice site mutants.

Figure 3—figure supplement 1.

(A) Western blot analysis of production of spliced XBP1s protein in response to induction of endoplasmic reticulum (ER) stress with 100 nM thapsigargin (TG) as introduced in Figure 1. Only the wild-type (WT) reporter expressing cells, show a response in XBP1s protein production. Cells expressing the spliced mRNA reporter constitutively produce the 55 kDa XBP1s band, and cells expressing the unspliceable XBP1 reporter fail to produce XBP1s protein at all. (B) qPCR-based splicing assays showing the lack of splicing observed for mutant mRNA transcripts (blue) compared to XBP1 WT reporter mRNA (red). Graph shows the average ± SD (n=3). (C) Correlated diffusion and ER colocalization analysis for XBP1 splice site mutants. Unspliceable reporter transcript (dark blue) compared to XBP1 WT (red). Dots are single particles that were tracked for at least 30 frames. Y axis: instantaneous diffusion coefficients. X axis: cumulative ER localization index. Positive values indicate ER colocalization. (D) Same analysis as in (C) but for spliced reporter transcripts (XBP1s). (E) Histogram plot showing distribution of mean spot intensities in exemplary live cell imaging experiment (all tracks longer than three frames, bins = 20). For raw data see Figure 3—figure supplement 1—source data 1.
Figure 3—figure supplement 1—source data 1. Raw gel images for Figure 3—figure supplement 1.

Video 6. Colocalization of XBP1 unspliceable mutant reporter transcripts with the endoplasmic reticulum (ER).

Download video file (930.5KB, mp4)

HeLa cell line stably expressing XBP1 splice site mutant transcripts, NLS-stdMCP-stdHalo and an ER marker. Simultaneous image acquisition for both channels (XBP1 Unspliceable, blue and ER, gray) using 50 ms exposure times (100 frames total). The movie is played at 20 fps. The scale bar is 5 μm.

Video 7. Lack of colocalization with the endoplasmic reticulum (ER) exhibited by XBP1 spliced reporter transcripts.

Download video file (975.1KB, mp4)

HeLa cell line stably expressing spliced XBP1 transcripts, NLS-stdMCP-stdHalo, and an ER marker. Simultaneous image acquisition for both channels (XBP1 spliced, light blue and ER, gray) using 50 ms exposure times (100 frames total). The movie is played at 20 fps. The scale bar is 5 μm.

As expected, unspliceable reporter transcripts often exhibited a lower mobility (Figure 3—figure supplement 1C) and associated with the ER to a degree that is comparable to WT transcripts (Figure 3C) while spliced reporter mRNAs tended to diffuse at higher mobilities (Figure 3—figure supplement 1D) and displayed a lower degree of ER association (Figure 3C) comparable to cytoplasmic protein-encoding mRNAs (Voigt et al., 2017).

To determine the effect of ER stress on the ER association of WT, unspliceable and spliced reporter transcripts, we induced ER stress with TM (5 µg/ml) at least 3 hours before the start of the imaging session (Video 8). In addition, and to specifically assess the involvement of IRE1α in such association, we performed the same imaging experiments including 50 µM 4µ8C, a small molecule inhibitor that blocks substrate access to the active site of the IRE1α RNase domain and thereby selectively inactivates XBP1 cleavage (Video 9; Cross et al., 2012). As anticipated, ER stress-induced processing of WT reporters caused a strong decrease of their mean ER association from 27.4 ± 19.4% (mean ± SD) in the untreated condition to 10.1 ± 9.3% under TM treatment (Figure 3C, red). This result supports the idea that, upon completion of the splicing reaction, WT mRNAs are released from the ER membrane and behave like intron-free transcripts (Figure 3C, light blue) in the absence of ER stress (10.0 ± 9.1%). ER stress-induced mobilization of spliced WT reporter transcripts was a genuine consequence of IRE1α catalysis, since addition of 4µ8C to the TM condition restored ER association of WT reporters back to 33.2 ± 15.6% (Figure 3C, red). Taken together, these findings suggest that IRE1α-mediated splicing drives the release of translationally active, ER-tethered mRNAs.

Video 8. Lack of colocalization with the endoplasmic reticulum (ER) exhibited by XBP1 WT transcripts in response to ER stress.

Download video file (814KB, mp4)

HeLa cell line stably expressing XBP1 wild-type (WT) reporter transcripts, NLS-stdMCP-stdHalo, and an ER marker. Cells were treated with 5 µg/ml tunicamycin (TM) for 3–4 hours prior to image acquisition. Simultaneous image acquisition for both channels (XBP1 WT, red, and ER, gray) using 50 ms exposure times (100 frames total). The movie is played at 20 fps. The scale bar is 5 μm.

Video 9. XBP1 WT mRNA colocalization with the endoplasmic reticulum (ER) during ER stress and inhibition of inositol-requiring enzyme 1 alpha RNase activity.

Download video file (862.9KB, mp4)

HeLa cell line stably expressing XBP1 wild-type (WT) reporter transcripts, NLS-stdMCP-stdHalo, and an ER-marker. Cells were treated with 5 µg/ml tunicamycin and 50 µM 4µ8C for 3–4 hours prior to image acquisition. Simultaneous image acquisition for both channels (XBP1 WT, red, and ER, gray) using 50 ms exposure times (100 frames total). The movie is played at 20 fps. The scale bar is 5 μm.

In line with this notion, unspliceable reporter transcripts (Figure 3C, dark blue) not only associate with the ER to a high level (32.4 ± 13.5%) but also fail to show a similar reduction in ER association upon treatment with TM (23.7 ± 18.4%) and TM + 4µ8C (20.3 ± 12.6%) (Figure 3C). The same holds true for the spliced reporter construct. Since it does not encode the HR2 peptide and can therefore not be delivered to the translocon, it only associates with the ER to a limited extent (10.0 ± 9.1%). Upon induction of ER stress, its ER association rate is further reduced and similar to the unspliceable reporter, we do not observe significant changes in ER association between ER stress conditions in the absence (4.8 ± 5.0%) and presence (4.6 ± 4.4%) of 4µ8C.

We noticed that, for unspliceable and spliced reporters, ER stress caused a slight reduction of ER association when compared to untreated conditions. This effect may result from the general inhibition of cellular translation initiation triggered by the eIF2α kinase PERK, that promotes the UPR branch of the integrated stress response (Pakos-Zebrucka et al., 2016). It is plausible that the slightly reduced levels of ER association under ER stress conditions are due to the decreased recruitment of translating mRNPs to the ER surface, affecting all mRNAs to a limited extent (Voigt et al., 2017). This effect is not observed for the XBP1 WT reporter, where conversion of unspliced into spliced molecules is the major driver of mobilization from the ER. In summary, these experiments demonstrate that IRE1α activity is not required for ER association of XBP1 reporter mRNAs but suggest that IRE1α-mediated catalysis might contribute to the release of spliced mRNA molecules to the cytosol.

In combination, our findings support a model where IRE1α-mediated splicing is instrumental for the mobilization of XBP1 transcripts that are anchored to the ER in a translation-dependent manner. Based on this hypothesis, we sought to further investigate and visualize the sites of XBP1 processing on the ER membrane. To this aim, we developed an approach that allowed us to detect IRE1α in the reporter transcript-expressing HeLa cell lines introduced above and that was complementary to the single-molecule imaging approach, which detects endogenously tagged IRE1α protein molecules and is published in parallel to this study (Belyy et al., 2021). We knocked out the endogenous IRE1α using CRISPR/Cas9 and reconstituted its expression with a GFP-tagged IRE1α protein (Figure 4A). Identical to the previously published design of a splicing competent IRE1α-GFP construct, we introduced a GFP moiety in between the lumenal and kinase/RNase domains on the cytoplasmic site of the transmembrane protein (Belyy et al., 2020; Li et al., 2010).

Figure 4. Inositol-requiring enzyme 1 alpha (IRE1α) is able to splice XBP1u mRNA in the absence of foci formation.

(A) Schematic representation of IRE1α-GFP construct design analogous to Belyy et al., 2020. To reduce expression of IRE1α-GFP to match endogenous levels, part of the Emi1 5’ untranslated region (UTR) was inserted upstream of the IRE1α-GFP opening reading frame. (B) HeLa cells (wild-type [WT] or IRE1α knock-out) expressing either no IRE1α (Neg) or reconstituted IRE1α-GFP at low levels (Emi1-IRE1α-GFP) or at high levels (IRE1α-GFP) were kept untreated or treated with 100 nM thapsigargin (TG) for indicated time points. Upper panels: western blot analysis of IRE1α and XBP1s levels in response to TG treatment. XBP1s immunodetection identifies two bands, a lower one corresponding to endogenous XBP1s and an upper one corresponding to the murine, FLAG-tagged XBP1s reporter protein. GAPDH (run in a different gel) was used as a loading control. Bottom panel: semiquantitative analysis of splicing of WT XBP1 mRNA. Total RNA was isolated from cells that were treated with TG as described above and subjected to RT-PCR with primers flanking the XBP1 intron. Lower band = spliced XBP1, middle band = unspliced XBP1, upper band = hybrid splicing intermediate (one strand spliced, one strand unspliced). (C) Quantification of the IRE1α expression levels in cell lines described in (B) under non-stress conditions. Graph depict the average ± SD (n=3). Revert staining of western blot membranes was used as a normalization value. (D) Quantitative RT-PCR to determine the levels of XBP1s mRNA and splicing ratios for the same RNA samples as shown in (B). Graph represents the average ± SD (n=3) (E) Representative live-cell images of the HeLa cell lines introduced in (C). In cells overexpressing IRE1α-GFP, foci can already be detected at 2 hour treatment with 5 µg/ml tunicamycin (TM). But there are no detectable IRE1α-GFP foci even after prolonged exposure to 5 µg/ml TM under standard imaging conditions in cells expressing Emi1-IRE1α-GFP. Only long exposure times allow for detection of low intensity GFP signal outlining the endoplasmic reticulum (ER) in the absence and presence of 5 µg/ml TM. (F) Quantification of the fraction of cells containing IRE1α-GFP foci in imaging cell lines under control (Ctrl) and ER stress (≥2 hour of 5 µg/ml TM) conditions. Cells are counted as foci-containing if ≥1% of the total cellular GFP signal is detected in IRE1α-GFP foci, which are defined as a ≥fivefold enrichment of GFP signal over cellular background. (G) Representative live-cell images of XBP1 WT reporters (red) in HeLa cells expressing NLS-stdMCP-stdHalo and IRE1α-GFP (gray) under ER stress (5 µg/ml TM) and IRE1α inhibition (50 µM 4µ8C). Dashed box indicates magnified inset and shows individual frames of the image series in the right part of the panel. The time series illustrates how individual mRNA particles (red) come close to IRE1α-GFP foci (gray) but do not associate stably nor accumulate in foci. All scale bars = 5 µm, except in single frame magnifications = 1 µm. For raw data see Figure 1—source data 1.

Figure 4—source data 1. Raw gel images for Figure 4.

Figure 4.

Figure 4—figure supplement 1. Characterization of unfolded protein response (UPR) activation in Emi1-IRE1α-GFP expressing cells.

Figure 4—figure supplement 1.

HeLa cells, wild-type (WT) or inositol-requiring enzyme 1 alpha (IRE1α) KO (knock out) expressing either no IRE1α (Neg) or reconstituted (Emi1-) IRE1α-GFP at low levels were kept untreated or treated with 100 nM thapsigargin (TG) for indicated time points. (A) Western blot analysis of IRE1α, XBP1s, PERK, and ATF4 levels in response to TG treatment. (B) Agarose gel for semi-quantitative analysis XBP1-MS2 WT reporter mRNA splicing. Lower band = spliced XBP1, middle band = unspliced XBP1, upper band = hybrid splicing intermediate (one strand ‘spliced’, one strand ‘unspliced’). (C) Quantitative PCR analysis to determine endogenous XBP1 splicing ratio from the same RNA samples. (D) RT-PCR-based quantification of the levels of three UPR-induced mRNAs: BiP (ATF6-dependent), ERdJ4 (XBP1-dependent), and asparagin synthetase (AsnS; ATF4-dependent). As anticipated, the levels of BiP and AsnS mRNA increased upon TG addition, while ERdJ4 expression was impaired in IRE1α KO cells and restored by ectopic IRE1α-GFP. Graphs represent the average ± SD of three independent experiments. For raw data see Figure 4—figure supplement 1—source data 1.
Figure 4—figure supplement 1—source data 1. Raw gel images for Figure 4—figure supplement 1.

IRE1α has been shown to form large oligomeric assemblies and microscopically visible clusters upon induction of ER stress in a number of studies (Belyy et al., 2020; Kimata et al., 2007; Li et al., 2010; Tran et al., 2021). Yet, the physiological relevance of these clusters remains unclear. To determine if the extent of IRE1α-GFP expression could artificially affect IRE1α clustering, we generated lentiviral constructs that induced different IRE1α-GFP expression levels. Specifically, we took advantage of the previously characterized Emi1 5'UTR that has been shown to downregulate translation approximately 40-fold (Yan et al., 2016). Since this 5'UTR was derived from the cell cycle protein Emi1, we termed the construct Emi1-IRE1α-GFP. For comparison, we also generated an IRE1α-GFP expression construct that was lacking the Emi1 5'UTR and expressed the IRE1α-GFP at higher levels.

As anticipated, western blot analysis confirmed that reconstituted IRE1α at low (Emi1-IRE1α-GFP) as well as at high levels (IRE1α-GFP) restored the functionality of IRE1α in KO cells, albeit to different extents (Figure 4B). While Emi1-IRE1α-GFP levels were similar to those of endogenous IRE1α, IRE1α-GFP expression was approximately 10-fold higher (Figure 4C). In both cell lines, ectopic IRE1α-GFP expression rescued XBP1 mRNA splicing under ER stress conditions, as determined by quantitative RT-PCR (Figure 4D) and by western blot detection of the resulting XBP1s protein (Figure 4B). At the same time, we noticed that GFP tagging slightly reduced XBP1 splicing levels both in the endogenous XBP1 mRNA and the WT reporter transcript (Figure 4—figure supplement 1A-C and Figure 4D). Other than that, IRE1α-GFP expressed from the Emi1 promoter supported transcription of XBP1-regulated genes, like ErdJ4, and did not significantly affect other signaling branches (Figure 4—figure supplement 1D). In line with previous reports (Li et al., 2010), strong overexpression of IRE1α-GFP triggered XBP1 mRNA splicing (and XBP1s synthesis) even in the absence of ER stress, underscoring the importance of adequate IRE1α expression levels for fine-tuning of the UPR.

In order to investigate if IRE1α clusters were the sites of XBP1 mRNA splicing on the ER, we imaged IRE1α-GFP in the HeLa cell lines stably expressing XBP1 reporter transcripts along with NLS-stdMCP-stdHalo and Sec61b-SNAP introduced above (Figure 4E). In agreement with earlier reports (Li et al., 2010) as well as a parallel study (Belyy et al., 2021), we detected IRE1α-GFP foci (defined as a ≥fivefold enrichment of GFP signal over background) in 21.89 ± 7.31% of cells expressing high levels of the fusion protein already after relatively short induction of ER stress with TM (5 µg/ml) for 2 hours (Figure 4F). Surprisingly, this was not the case for cells expressing Emi1-IRE1α-GFP at low levels, where we were unable to detect IRE1α-GFP clusters even after prolonged exposure to TM (5 µg/ml) for up to 7 hours. To make sure that we were not missing IRE1α clusters due to imaging conditions optimized for detection of fast-moving mRNA particles (e.g. short 50 ms exposure times), we acquired IRE1α-GFP signal from the same cells in the presence and absence of ER stress but this time using longer exposures (2000 ms) and maximum laser intensities. Under such conditions, we were able to detect IRE1α-GFP signal, which exhibited a characteristic ER-like distribution pattern but no IRE1α clusters (Figure 4E, right panel).

This observation suggested that IRE1α clusters are not necessary for the production of XBP1s, which we were able to detect in the absence of cluster formation (Figure 4D). To ensure that we were not missing a potential function of the previously observed IRE1α foci, we proceeded to image XBP1 WT mRNA recruitment to these oligomeric assemblies at high temporal and spatial resolution (Figure 4F, Video 10). Interestingly, we did not find XBP1 WT transcripts accumulating in IRE1α-GFP clusters even after prolonged TM treatment (5 µg/ml for up to 4 hours) and inhibition of IRE1α cleavage activity. XBP1 particles freely diffuse around IRE1α-GFP foci and only very rarely colocalize with the IRE1α-GFP signal (Video 11). This observation was true for both XBP1 WT (in the presence of 4µ8C) as well as unspliceable reporter transcripts (Video 12).

Video 10. No accumulation of XBP1 wild-type (WT) transcripts in inositol-requiring enzyme 1 alpha (IRE1α)-GFP foci during IRE1α inhibition.

Download video file (809.9KB, mp4)

HeLa cell line stably expressing XBP1 WT reporter transcripts, NLS-stdMCP-stdHalo and IRE1α-GFP. Cells were treated with 5 µg/ml tunicamycin and 50 µM 4µ8C for 2–3 hours prior to image acquisition. Simultaneous image acquisition for both channels (XBP1 WT, red, and IRE1α-GFP, gray) using 50 ms exposure times (100 frames total). The movie is played at 20 fps. The scale bar is 5 μm.

Video 11. Detection of single XBP1 wild-type (WT) transcripts in inositol-requiring enzyme 1 alpha (IRE1α)-GFP foci is possible but extremely rare.

Download video file (2.4MB, mp4)

HeLa cell line stably expressing XBP1 WT reporter transcripts, NLS-stdMCP-stdHalo, and IRE1α-GFP. Cells were treated with 5 µg/ml tunicamycin and 50 µM 4µ8C for 2–3 hours prior to image acquisition. Simultaneous image acquisition for both channels (XBP1 WT, red, and IRE1α-GFP, gray) using 50 ms exposure times (100 frames total). The movie is played at 20 fps. The scale bar is 5 μm. White arrow indicates a single XBP1 mRNA particle that colocalizes with an IRE1α cluster.

Video 12. No accumulation of XBP1 splice site mutant transcripts in inositol-requiring enzyme 1 alpha (IRE1α)-GFP foci.

Download video file (2.4MB, mp4)

HeLa cell line stably expressing XBP1 splice site mutant reporter transcripts, NLS-stdMCP-stdHalo, and IRE1α-GFP. Cells were treated with 5 µg/ml tunicamycin for 3–4 hours prior to image acquisition. Simultaneous image acquisition for both channels (Unspliceable XBP1 reporter, blue, and IRE1α-GFP, gray) using 50 ms exposure times (100 frames total). The movie is played at 20 fps. The scale bar is 5 μm.

Taken together, our data indicate that Emi1-IRE1α-GFP supports splicing in the absence of foci formation. This suggests that XBP1 mRNA is spliced by lower oligomeric assemblies of IRE1α molecules, which can easily contact ER-associated ribosome-mRNPs, while IRE1α foci or large oligomeric clusters are not the sites of XBP1 mRNA processing during the UPR.

Discussion

In this study, we present a single-molecule imaging approach that allows visualization of individual XBP1 transcripts and use it to investigate the recruitment of XBP1 mRNA to ER-localized IRE1α, which is a fundamental step of the XBP1 splicing mechanism. Based on previous yeast studies and the visualization of overexpressed IRE1α, splicing of XBP1 mRNA has been suggested to take place in large clusters of IRE1α oligomers that form during the UPR and could function as ER stress response centers (Li et al., 2010). Our findings challenge this view and suggest a different model for mammalian cells, where IRE1α might be recruited to the XBP1 mRNA and not vice versa.

Direct visualization of the recruitment of XBP1 mRNAs to the ER surface using single-molecule imaging revealed that XBP1 molecules become ER-associated in an HR2-dependent manner that is consistent with the targeting model proposed previously (Kanda et al., 2016; Yanagitani et al., 2009; Yanagitani et al., 2011). Furthermore, assessment of the translational status of single mRNA particles demonstrated that their ER association depends on interactions with the ribosome-nascent chain complex. Co-translational membrane tethering therefore immobilizes XBP1 transcripts on the ER surface and hints at a substrate recruitment mechanism where IRE1α diffuses through the ER membrane until it encounters XBP1u mRNAs at the Sec61 translocon. Direct interactions that have been reported for IRE1α and the translocon, SRP, as well as RNAs (Acosta-Alvear et al., 2018; Plumb et al., 2015) further increase the affinity of the interaction and underline the potential significance of such a recruitment mechanism.

Upon induction of ER stress, XBP1 transcripts are spliced and released from the ER surface. However, even though we can derive from our data that ER association correlates with IRE1α cleavage activity, we did not find XBP1 mRNAs colocalizing with IRE1α clusters. Moreover, large, microscopy-visible clusters were only detected when IRE1α-GFP was overexpressed at high levels. Thus, IRE1α foci are not the primary sites of XBP1 splicing. Instead, our findings support a model where ER-associated XBP1 transcripts are processed by small IRE1α oligomers that could dynamically assemble throughout the ER membrane.

These observations are in good agreement with an earlier study, in which the pharmacological activation of IRE1α with the flavonol luteolin promoted strong splicing of XBP1 in the absence of IRE1α clustering (Ricci et al., 2019). In addition, and directly related to our work, a parallel study shows that endogenously tagged IRE1α also fails to assemble into large clusters upon induction of ER stress (Belyy et al., 2021). In this work, the authors characterize IRE1α oligomerization during ER stress and find that the resting pool of IRE1α in the ER membrane is dimeric, while in response to stress transient IRE1α tetramers are assembled as the functional subunits that are required for trans-autophosphorylation and XBP1 splicing. Most likely, such a dynamic equilibrium between dimers and small oligomers allows cells to build timely, fine-tuned responses to local or transient perturbations in ER protein folding.

In combination, our findings suggest a novel mechanism for XBP1 recruitment to functional, dynamic IRE1α assemblies that continuously patrol the ER membrane to encounter substrates that are targeted there.

Following a different strategy, yeast IRE1p foci arrange the recruitment of unspliced HAC1 mRNA to the ER membrane and efficiently localize the mRNA for splicing (Aragón et al., 2009; van Anken et al., 2014). Given the strong conservation of most UPR principles, upon visualization of large IRE1α clusters in human cells (Li et al., 2010; Tran et al., 2021) it was plausible to speculate that polarization of IRE1α might build splicing centers. However, these studies mostly relied on overexpression of ectopic IRE1α, which likely contributed to the perception that clusters were required for XBP1 splicing and explains the discrepancies between this and previous reports.

Our findings shed light on a fundamental step of the XBP1 splicing mechanism, which is the recruitment of IRE1α to ER-localized XBP1 transcripts. Yet, several open questions remain:

  1. Are XBP1 mRNAs that are tethered to the ER surface as part of ribosome-nascent chain complexes continuously translated? Or is translation stably stalled while the mRNA remains poised for recruitment by IRE1α? And if so, how is translation resumed? And how relevant is the translational status of XBP1 mRNA for splicing?

  2. Does IRE1α also bind XBP1 transcripts in the absence of the ribosome/translocon interaction? Since we observe a low degree of splicing for HR2-mutant reporters, we speculate that translation-independent recruitment of XBP1 transcripts and recognition through IRE1α might also be possible.

  3. How does IRE1α discriminate between its distinct substrates? Beyond XBP1 splicing, IRE1α processes a broad range of substrates including RIDD mRNAs (Hollien et al., 2009; Hollien and Weissman, 2006) and a recently described, larger group of mRNAs that are processed through an unanticipated mode of cleavage with looser specificity (RIDDLE) (Le Thomas et al., 2021). Most of these mRNA substrates encode signal sequence-containing proteins and are delivered to the ER by SRP. While we know that activation of the IRE1α RNAse domain requires IRE1α dimerization/oligomerization as well as trans-autophosphorylation, the specific role and substrate specificity of the distinct assemblies remain unclear. It is tempting to speculate that the interplay of different oligomeric IRE1α assemblies with the translocon/ribosome/SRP environment may define the code for selective processing of distinct IRE1α substrates, avoiding the detrimental cleavage that might result from unrestrained RNA degradation.

In summary, our data have allowed us to uncover unanticipated features of one of the key steps of UPR initiation, the encounter of XBP1 mRNA with IRE1α to undergo splicing. Additional studies will be needed to further dissect the underlying mechanisms behind the regulation of IRE1α activity in homeostasis and disease.

Materials and methods

DNA constructs

The Gaussia luciferase reporter was the same as previously described (Voigt et al., 2017). Using the same plasmid backbone, we generated an XBP1 WT reporter, expressing an N-terminally FLAG-tagged M. musculus XBP1 coding sequence and 3' UTR (3'UTR covers nucleotides 1–948, considering +1 as the first nucleotide after the unspliced mRNA stop codon), followed by 24 MS2 stem loops. Nuclear introns were inserted into this construct to facilitate stability, nuclear export, and translation of the reporter mRNA.

HR2 mutant, spliced, and unspliceable constructs were generated by site-directed mutagenesis of WT RNA. In the HR2 mutant, one A nucleotide was inserted 45 nucleotides downstream the 3' splice site of murine XBP1. This insertion facilitates a translational frameshift that prevents HR2 synthesis, such that the amino acid sequence of the unspliced HR2 mutant protein is identical at the C-terminus to WT XBP1s. The spliced reporter plasmid is identical to WT but lacking the 26-nucleotide UPR intron. The unspliceable mutant bears point mutations at the 5' and 3' splice site loops. Almost invariant through evolution, positions 1, 3, and 6 of the splice site loops follow the consensus CNGNNGN (Gonzalez et al., 1999; Hooks and Griffiths-Jones, 2011). Mutation of either of these nucleotides disrupts IRE1α cleavage in vitro and in vivo. Mutations in the 5' and 3' splice loops were tCGCAGC and CTaCAGC, respectively (mutation in lowercase).

For the translation reporter of XBP1u mRNA, a 9xGCN4 spaghetti monster (Eichenberger et al., 2018) was inserted 35 nucleotides downstream the 3' splice site, such that the spaghetti monster is in frame with the unspliced polypeptide. In this construct, we removed the last XBP1 nuclear intron, because the insertion of repeats in the close vicinity of its 5' splice site affected nuclear processing of the transcript.

We used KDEL-Turq2 (Addgene #36,204) and Sec61b-SNAP as fluorescent ER markers. Sec61b-SNAP was generated from Addgene construct #121,159 (GFP-Sec61b) through replacing the GFP with a SNAP moiety. Single-chain antibodies fused to GFP (scAB-GFP, Addgene #104,998) were used for imaging translation sites through nascent polypeptide labeling. NLS-stdMCP-stdHalo (Addgene #104,999) was employed for detection of single mRNA particles.

IRE1α-GFP was generated analogous to the construct design described by Belyy et al., 2020. The fusion protein includes a GFPuv tag (Crameri et al., 1996) and was integrated into a phage plasmid for lentiviral expression under the control of a constitutively active UbiC promotor. To reduce expression levels post-transcriptionally, the Emi1 5'UTR (Yan et al., 2016) was added upstream of the ORF.

Cell line generation

HeLa cell lines stably expressing XBP1 and Gaussia luciferase reporter constructs were generated and maintained as previously described (Voigt et al., 2017). Briefly, reporter cassettes were stably integrated into parental HeLa 11ht cells that contain a single FLP site and express the reverse tetracycline-controlled transactivator (rtTA2-M2) for inducible expression (Weidenfeld et al., 2009). Cells were grown at 37°C and 5% CO2 in DMEM + 10% FBS + 1% penicillin, streptomycin (Pen/Strep). Parental cells were authenticated via STR profiling (Eurofins). Mycoplasma contamination was regularly controlled for using mycoplasma detection PCR and smFISH.

IRE1 was knocked out by CRISPR/Cas9 editing of HeLa cells by transient transfection with the pX459v2-910 plasmid as in Bakunts et al., 2017 kindly provided by Dr Eelco van Anken.

NLS-stdMCP-stdHalo, scAB-GFP, KDEL-Turq2, Sec61b-SNAP, IRE1α-GFP, and Emi1-IRE1α-GFP fusion proteins were stably integrated into the HeLa cell lines described above via lentiviral transduction. All cell lines were sorted using fluorescence-activated cell sorting to select for appropriate expression levels for single-molecule imaging.

Western blots

For protein extraction in most experiments cells were treated with 100 nM TG (Sigma, stock 1 mM in dimethyl sulfoxide (DMSO)), HeLa cell monolayers were washed twice with ice-cold phosphate saline buffer (PBS), and then resuspended directly in Laemmli buffer, supplemented with protease and phosphatase inhibitors (Complete, Roche). Samples were heated to 95°C for 5 min, loaded on polyacrylamide gels (Thermo Fischer Scientific) and then transferred onto nitrocellulose (GE Healthcare). Successful protein transfer onto nitrocellulose was confirmed by reversible ponceau or revert staining. Immunoblot analysis was performed using standard techniques. All antibodies used in this study are listed in Table 1. Loading correction of immunoblot signals was performed by using GAPDH or tubulin signals as controls, or by quantifying revert fluorescence after transfer.

Table 1. List of antibodies used for western blotting.

Protein Provider Cat. # Notes
XBP1 Santa Cruz Biotechnology sc-7160 (M-186) Detects murine XBP1 much better than endogenous, human XBP1
XBP1 Cell Signaling #12,782 Used to detect both human and murine XBP1 proteins
IRE1α Cell Signaling #3294
Calnexin Novus Biologicals NBP1-97485
Alpha-tubulin Sigma T6074
GAPDH Cell Signaling #2118

Detection of immunolabeled proteins was performed using a commercial chemiluminescent assay (ECL prime; Amersham). Visualization and quantitative measurements were made with a CCD camera and software for western blot image analysis (Odissey Fc Imager System and Image Studio Lite v 4.0, respectively; Li-COR, Bad Homburg, Germany).

RNA analysis

RNA extraction was performed using the guanidine isothyocyanate and phenol-chloroform method (TRIzol; Invitrogen). 1 μg of total RNA was treated with DNAse I and used for subsequent reverse transcription. 50–100 ng of total cDNA was used for RT-PCR using SybrGreen (BIORAD). RT-PCR primer sequences are listed in Table 2. For semi-quantitative assessment of splicing by PCR, we used primers flanking the XBP1 intron that specifically amplify murine but not endogenous human XBP1 mRNA. PCR products were resolved on 3% agarose gels.

Table 2. List of primers used for RT-PCR analysis.

Oligonucleotides used in this study (1st Fwd; 2nd Rev.)
H.s. Histone
AAAGCCGCTCGCAAGAGTGCG
A CTTGCCTCCTGCAAAGCAC
H.s. GRP78
GAGCTGTGCAGAAACTCCGGCG
ACCAACTGCTGAATCTTTGGAATTCGAGT
H.s. XBP1u
CACTCAGACTACGTGCACCTC
CAGGGTGATCATTCTCTGAGGGGCTG
H.s. XBP1s
CGGGTCTGCTGAGTCCGCAGCAG
CAGGGTGATCATTCTCTGAGGGGCTG
M.m. XBP1u
CACTCAGACTACGTGCACCTC
CAGGGTGATCATTCTCTGAGGGGCTG
M.m XBP1s
CGGGTCTGCTGAGTCCGCAGCAG
CAGGGTGATCATTCTCTGAGGGGCTG
PCR to analyze M.m splicing by agarose electrophoresis
ACGCTGGATCCTGACGAGGTTC C
GAGAAAGGGAGGCTGGTAAGGAACTA

Membrane flotation assay

For flotation assays, we followed the method originally described by Mechler and Vassalli (Mechler and Rabbitts, 1981). 5 min before harvesting, subconfluent monolayers of cells were treated with 50 μg/ml cycloheximide (Sigma, Stock 50 mg/ml in DMSO) to prevent ribosomal runoff from mRNAs. Cultures were washed twice with chilled PBS and resuspended in hypotonic buffer medium (10 mM KCl, 1.5 mM MgCl2, 10 mM Tris-HCl pH7.4, 50 μg/ml cycloheximide and protease and phospatase inhibitor) cocktail (Complete, Roche). Cells were allowed to swell for 5 min on ice, and then mechanically ruptured with a Dounce tissue grinder and spun for 2 min at 1000× g and 4°C. The supernatant was transferred to a new tube and supplemented with 2.5 M sucrose in TKM buffer (50 mM Tris-HCl pH7.4, 150 mM KCl, 5 mM MgCl2, 50 μg/ml cycloheximide, protease and phosphatase inhibitors), to a final concentration of 2.25 M sucrose. This mixture was layered on top of 1.5 ml of 2.5 M-TKM in a SW40 polyallomer ultracentrifugation tube. On top of the extract-sucrose mix, we layered 6 ml of 2.05 M sucrose-TKM and 2.5 ml of 1.25 M sucrose-TMK. After centrifugation for 10 hours at 25,000 rpm in a SW40 Ti Beckman rotor, 1.5 ml fractions were collected from top to bottom and subjected to RNA and protein analysis.

Single-molecule fluorescence in situ hybridization and immunofluorescence (smFISH-IF)

High precision glass coverslips (170 μm, 18 mm diameter, Paul Marienfeld GmbH) were placed into a 12-well tissue culture plate. 0.5 × 105 HeLa cells per well were seeded onto these cover slips and grown for 48 hours. Reporter expression was induced by addition of Dox (Sigma) to the medium for 2 hours. To ensure strong ER association phenotypes, Dox was removed from the medium after that and cells were grown for another 2 hours until fixation. For ER stress conditions, 5 µg/ml TM (stock 5 mg/ml in DMSO, Sigma) was added at induction and maintained in the medium until fixation.

Combined smFISH-IF was performed as described previously (Dave et al., 2021). Briefly, single-molecule RNA detection was done using Stellaris FISH probes labeled with Quasar 570 (Biosearch Technologies) and designed against the 5' end of the M. musculus XBP1 ORF (Table 3). HeLa cells were washed with PBS twice and fixed with 4% paraformaldehyde (Electron Microscopy Sciences) for 10 min at room temperature (RT). This was followed by permeabilization in 0.5% Triton-X for another 10 min at RT. After two more washes with PBS, cells were preblocked in wash buffer (2 × SSC [Invitrogen], 10% v/v deionized formamide [Ambion], and 3% BSA [Sigma]) for 30 min at RT. Then hybridization buffer (150 nM smFISH probes, 2 × SSC, 10% v/v formamide, 10% w/v dextran sulphate [Sigma]) containing 1:1000 diluted anti-GFP antibody (Aves labs, GFP-1010) was added for 4 hours at 37°C. After hybridization, cells were washed with wash buffer twice for 30 min each, followed by incubation with antichicken IgY secondary antibody conjugated with Alexa-fluor 488 (1:1000 in PBS, Thermo Fisher, A-11,039) for 30 min. Coverslips were washed twice in PBS and then mounted on microscopy slides using ProLong Gold antifade reagent incl. DAPI (Molecular Probes).

Table 3. List of smFISH probes to detect mouse XBP1 mRNA.

1 taagagtagcactttggggg
2 gctactctgtttttcagttt
3 ctttctttctatctcgagca
4 ctgatttcctagctggagtt
5 cgtgagttttctcccgtaaa
6 tctggaacctcgtcaggatc
7 agaggtgcacatagtctgag
8 ttctggggaggtgacaactg
9 tgtcagagtccatgggaaga
10 actcagaatctgaagaggca
11 ccagaatgcccaaaaggata
12 aacatgacagggtccaactt
13 actctggggaaggacatttg
14 tggtaaggaactaggtcctt
15 gagttcattaatggcttcca
16 gcttggtgtatacatggtca
17 cagaggggatctctaaaact
18 acgttagtttgactctctgt
19 tgcttcctcaattttcacta
20 cctcttctgaagagcttaga
21 gagacaatgaattcagggtg
22 ttccaaaggctctttcttca
23 ccagctctgggatgaagtca
24 gctggatgaaagcaggtttg
25 caagaaggtggtctcagaca
26 atatccacagtcactgtgag
27 gtctgtaccaagtggagaag
28 cattggcaaaagtatcctcc
29 cactaatcagctgggggaaa
30 cagtgttatgtggctcttta
31 ctaggcaatgtgatggtcag
32 aagagacaggcctatgctat
33 cctctactttggcttttaac
34 ggaattcttctaaggccaga
35 cttggaagtcatctatgaga
36 ataccttagacagctgagtg
37 agctgtagtactggaatacc
38 tttagagtatactaccacct
39 aaactgtcaaatgaccctcc
40 catgtccacctgacatgtcg
41 gaaatgctaagggccattca
42 cgaaacctgggaagcagaga
43 cataagggaaaacaagcccc
44 agatccatcaagcatttaca

smFISH-IF images were acquired on an inverted Zeiss AxioObserver7 microscope equipped with a Yokogawa CSU W1 scan head, a Plan-APOCHROMAT 100 × 1.4 NA oil objective, a sCMOS camera with chroma ZET405/488/561/647 nm emission filter and an X-Cite 120 EXFO metal halide light source. Z-stacks were acquired in 0.2 μm steps. Exposure times were 500 ms for Quasar 570 and 100 ms for the DAPI channel at maximum laser intensities while the IF signal was acquired at 20% 488 nm laser intensity for 200 ms.

smFISH-IF data analysis

Detection of single mRNA and translation site spots from fixed cell imaging experiments was performed in KNIME (Berthold et al., 2009) as described previously (Voigt et al., 2019a; Voigt et al., 2019b).

Briefly, individual slices were projected as maximum intensity projections. mRNA and translation site spots were then separately detected using a custom-built KNIME node that runs the spot detection module of TrackMate (Tinevez et al., 2017) in batch mode. This node is available in the KNIME Node Repository: KNIME Image Processing / ImageJ2 /FMI / Spot Detection (Subpixel localization). Detected mRNA and translation site spots in each channel were then colocalized using a nearest neighbor search to link mutual nearest neighbors between the two channels using a distance cut-off of three pixels. Nuclear segmentation was performed on the DAPI signal using the Otsu thresholding method while cytoplasmic segmentation was done using the smFISH background signal in the Q570 channel and a manual intensity threshold.

Live-cell imaging

For live-cell imaging, cells were seeded in 35 mm glass-bottom µ-Dishes (ibidi GmbH) 48 hours prior to the experiment. Depending on the type of experiment, SNAP and Halo fusion proteins were labeled with JF549 or JF646 dyes (HHMI Janelia Research Campus) (Grimm et al., 2015) or SNAP-Cell Oregon Green (NEB, S9104S).

XBP1 mRNA expression was induced by addition of 1 µg/ml Dox to the medium. After 1–2 hours, Dox was removed to allow proper localization of XBP1 mRNAs to the ER membrane. To inhibit translation, cells were treated with 100 μg/mL PUR (stock 10 mg/ml in water, Invivogen) that was added to the cells directly prior to imaging. To induce ER stress, cells were treated with 5 µg/ml TM (stock 5 mg/ml in DMSO) that was added together with Dox at induction of mRNA expression and maintained in the imaging medium throughout the entire experiment. To inhibit IRE1α activity, the small molecule inhibitor 4µ8C (50 mM stock in DMSO, Sigma) was added at 50 µM together with Dox and maintained in the medium throughout the imaging experiment. Image acquisition was started not earlier than 1–2 hours after Dox removal to allow for localization of mRNA molecules and/or induction of the UPR.

Samples were imaged on an inverted Ti2-E Eclipse (Nikon) microscope equipped for live-cell imaging and featuring a CSU-W1 scan head (Yokogawa), two back-illuminated EMCCD cameras iXon-Ultra-888 (Andor) with chroma ET525/50 m and ET575lp emission filters, and an MS-2000 motorized stage (Applied Scientific Instrumentation). Illumination was achieved through 561 Cobolt Jive (Cobolt), 488 iBeam Smart, 639 iBeam Smart (Toptica Photonics) lasers, and a VS-Homogenizer (Visitron Systems GmbH). We used a CFI Plan Apochromat Lambda 100× Oil/1.45 objective (Nikon) that resulted in a pixel size of 0.134 μm. For all dual-color experiments, cells were imaged in both channels (single particles and ER) simultaneously and acquiring fast image series (20 Hz, 100 frames) in a single plane with two precisely aligned cameras. To correct for camera misalignment and chromatic aberrations, images of fluorescent TetraSpeck beads were acquired at each imaging session. Cells were maintained at 37°C and 5% CO2 throughout the entire experiment.

Correlated diffusion and ER colocalization analysis

Images of TetraSpeck beads were used to correct for the channel shift in affine transformation mode using the descriptor-based registration plugin (Preibisch et al., 2010) in Fiji (Schindelin et al., 2012). The transformation model obtained after aligning the bead images was then reapplied to translate the single mRNA/translation site channel onto the ER channel using as custom-made Fiji macro (Mateju et al., 2020).

Single-particle diffusion and ER colocalization analysis were performed as described previously (Voigt et al., 2017). Briefly, we used the KNIME analytics platform (Berthold et al., 2009) and a data processing workflow that allows for segmentation of the ER signal through trainable pixel classification using ilastik (Berg et al., 2019). The resulting probability maps are transformed to binary images, which are in turn used to generate distance maps that attribute intensity values to each pixel position with respect to its distance to the closest ER boundary. Positions on the ER are given positive values, while positions away from the ER are defined as negative values. The workflow further correlates mRNA positions (X and Y coordinates) obtained from SPT to the ER boundaries at any time point throughout the experiment and computes a cumulative ER localization index through addition of all intensity values that correspond to the positions assumed by a transcript over the experimental time course. To obtain a measure for particle mobility, the workflow further determines IDCs for each track. These are calculated as the mean of all displacements measured by SPT over 100 frames (Berg, 1993) and can be computed by a custom-made component node that is also available from the KNIME hub (KNIME Hub >Users > imagejan >Public > fmi-basel >components > Instantaneous diffusion coefficient).

ER association was quantified for all particles that could be tracked for at least 30 frames and was performed based on IDCs and cumulative ER colocalization indices as described before (Voigt et al., 2017). Values were plotted as scatter plots using the ggplot2 package in R. For the quantification of the degree of ER association per cell, only cells including at least three tracks were included. The analysis was also performed in KNIME and box plots were generated using the ggplot2 and ggpubr packages in R. Data overview and statistics for all live imaging experiments are summarized in Table 4.

Table 4. Imaging data statistics.

Data statistics for live imaging experiments
Reporter Experiment Independent replicates ID experiments Cells Mean tracks (≥3 frames) per cell Tracks ≥3 frames Tracks ≥10 frames Tracks ≥30 frames
Gaussia Ctrl 2 20200323, 20200420 19 149 2822 1480 864
XBP1 wt Ctrl 4 20191023, 20191108, 20200313,20210702 37 141 5200 2588 997
XBP1u translation reporter Ctrl 3 20211018, 20211022, 20211023 50 36 1815 923 519
XBP1 HR2 mutant Ctrl 3 20191023, 20191108, 20200313 25 206 5144 2454 653
Spliced Ctrl 3 20200313, 20210226, 20211022 36 193 6943 3261 955
Unspliceable Ctrl 3 20200313, 20210226, 20211025 34 194 6612 2997 1120
XBP1 wt TM 3 20210218, 20210322, 20210702 37 117 4326 2183 741
Spliced TM 3 20210218, 20210322, 20211022 35 152 5309 2571 817
Unspliceable TM 3 20210218, 20210322, 20211025 43 120 5143 2491 1001
XBP1 wt TM +4µ8C 3 20210219, 20210702, 20211017 41 119 4896 2509 1046
Spliced TM +4µ8C 3 20210219, 20211017, 20211022 35 173 6,044 2,792 793
Unspliceable TM +4µ8C 3 20210219, 20211017, 20211025 48 120 5750 2766 1031
Data statistics for smFISH experiments
Experiment Colocalization control
Condition Ctrl TM XBP1 wt +Renilla Luciferase XBP1u only
Cells 278 170 208 114
Replicates 2 2 1 1
scAB-GFP spots 4172 1928 4086 1928
XBP1 mRNA spots 6704 4186 5230 2313
Mean fraction of transl. mRNAs 0.47 0.18 0.011 0.498
Data statistics for IRE1a-GFP foci quantification
Experiment Construct name Replicate 1 Replicate 2 Replicate 3 Replicate 4
TM Emi1-IRE1α-GFP 20220510_577 20220510_630 20220513_630
Cells total 233 115 167
Cells w/o foci 233 115 167
Cells with foci 0 0 0
Mean(Fraction in foci) 0 0 0
SD (Fraction in foci) 0 0 0
Fraction(Cells with foci) 0 0 0
Image series 10 10 10
IRE1α-GFP 20200826_631 20220510_630 20220513_630
Cells total 55 178 301
Cells w/o foci 43 152 213
Cells with foci 12 26 88
Mean(Fraction in foci) 0.01920605 0.02054973 0.02550403
SD (Fraction in foci) 0.00850352 0.01393375 0.01711448
Fraction(Cells with foci) 0.21818182 0.14606742 0.2923588
Image series 8 10 15
Ctrl Emi1-IRE1α-GFP 20220427_630 20220428_577 20220428_630 20220513_630
Cells total 76 107 53 136
Cells w/o foci 76 107 53 136
Cells with foci 0 0 0 0
Mean(Fraction in foci) 0 0 0 0
SD (Fraction in foci) 0 0 0 0
Fraction(Cells with foci) 0 0 0 0
Image series 5 5 5 10
IRE1α-GFP 20220427_577 20220428_577 20220428_630 20220513_630
Cells total 52 46 123 105
Cells w/o foci 52 46 123 105
Cells with foci 0 0 0 0
Mean(Fraction in foci) 0 0 0 0
SD (Fraction in foci) 0 0 0 0
Fraction(Cells with foci) 0 0 0 0
Image series 5 4 5 5

Data and software availability

All data were analyzed using custom-made KNIME image analysis workflows that have been published before (Voigt et al., 2017). Specialized KNIME component nodes are available from the KNIME Hub (Users > imagejan > Public > fmi-basel). To prepare exemplary microscopy data for publication, image series were processed in Fiji (Schindelin et al., 2012). Manuscript figures were prepared using Adobe InDesign and Illustrator 2021. All processed and raw microscopy data generated in this study are available from Zenodo (Gómez-Puerta et al., 2022a; Gómez-Puerta et al., 2022b; Gómez-Puerta et al., 2022c; Gómez-Puerta et al., 2022d; Gómez-Puerta et al., 2022e). All other raw data, including full gel images have been uploaded as source data to this manuscript.

Acknowledgements

This work was funded by the Ministerio de Ciencia e Innovación (PID2020-120497RB-I00/financiado por MCIN/ AEI /10.13039/501100011033) (TA), the Novartis Research Foundation (JAC), and a Boehringer Ingelheim Fonds PhD fellowship (TH). The authors thank L Gelman, L Plantard, and J Eglinger (FMI) for microscopy and image analysis support and H Kohler (FMI) for cell sorting. We thank Urs Greber and Maite Huarte for critical reading of the manuscript and all members of the Chao and Aragón labs for their input and support.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Tomás Aragón, Email: taragon@unav.es.

Franka Voigt, Email: franka.voigt@fmi.ch.

Jeffrey L Brodsky, University of Pittsburgh, United States.

David Ron, University of Cambridge, United Kingdom.

Funding Information

This paper was supported by the following grants:

  • Ministerio de Ciencia, Innovación y Universidades PID2020‐120497RB‐I00 to Tomás Aragón.

  • Boehringer Ingelheim Fonds PhD fellowship to Tobias Hochstoeger.

Additional information

Competing interests

No competing interests declared.

No competing interests declared.

Author contributions

Investigation.

Investigation.

Investigation.

Investigation.

Funding acquisition.

Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Supervision, Validation, Visualization, Writing – original draft, Writing – review and editing.

Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review and editing.

Additional files

Transparent reporting form

Data availability

All imaging data generated in this study have been uploaded to Zenodo.

The following datasets were generated:

Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Live imaging data of XBP1 mRNA under control conditions. Zenodo.

Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Live imaging data of XBP1 mRNA under ER stress conditions. Zenodo.

Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Live imaging data of XBP1 mRNA under ER stress and IRE1a inhibition. Zenodo.

Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Live cell imaging data of IRE1a-GFP foci formation. Zenodo.

Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Fixed cell imaging data of XBP1 mRNA. Zenodo.

References

  1. Acosta-Alvear D, Zhou Y, Blais A, Tsikitis M, Lents NH, Arias C, Lennon CJ, Kluger Y, Dynlacht BD. XBP1 controls diverse cell type- and condition-specific transcriptional regulatory networks. Molecular Cell. 2007;27:53–66. doi: 10.1016/j.molcel.2007.06.011. [DOI] [PubMed] [Google Scholar]
  2. Acosta-Alvear D, Karagöz GE, Fröhlich F, Li H, Walther TC, Walter P. The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1. eLife. 2018;7:e43036. doi: 10.7554/eLife.43036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ali MMU, Bagratuni T, Davenport EL, Nowak PR, Silva-Santisteban MC, Hardcastle A, McAndrews C, Rowlands MG, Morgan GJ, Aherne W, Collins I, Davies FE, Pearl LH. Structure of the Ire1 autophosphorylation complex and implications for the unfolded protein response. The EMBO Journal. 2011;30:894–905. doi: 10.1038/emboj.2011.18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Aragón T, van Anken E, Pincus D, Serafimova IM, Korennykh AV, Rubio CA, Walter P. Messenger RNA targeting to endoplasmic reticulum stress signalling sites. Nature. 2009;457:736–740. doi: 10.1038/nature07641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bakunts A, Orsi A, Vitale M, Cattaneo A, Lari F, Tadè L, Sitia R, Raimondi A, Bachi A, van Anken E. Ratiometric sensing of BiP-client versus BiP levels by the unfolded protein response determines its signaling amplitude. eLife. 2017;6:e27518. doi: 10.7554/eLife.27518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Belyy V, Tran NH, Walter P. Quantitative microscopy reveals dynamics and fate of clustered IRE1α. PNAS. 2020;117:1533–1542. doi: 10.1073/pnas.1915311117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Belyy V, Zuazo-Gaztelu I, Alamban A, Ashkenazi A, Walter P. Endoplasmic Reticulum Stress Activates Human IRE1α through Reversible Assembly of Inactive Dimers into Small Oligomers. bioRxiv. 2021 doi: 10.1101/2021.09.29.462487. [DOI] [PMC free article] [PubMed]
  8. Berg HC. Berg: Diffusion: Microscopic theory in “Random Google scholar. Random Walk Models in Biology. 1993;5:813–824. doi: 10.1098/rsif.2008.0014. [DOI] [Google Scholar]
  9. Berg S, Kutra D, Kroeger T, Straehle CN, Kausler BX, Haubold C, Schiegg M, Ales J, Beier T, Rudy M, Eren K, Cervantes JI, Xu B, Beuttenmueller F, Wolny A, Zhang C, Koethe U, Hamprecht FA, Kreshuk A. ilastik: interactive machine learning for (bio)image analysis. Nature Methods. 2019;16:1226–1232. doi: 10.1038/s41592-019-0582-9. [DOI] [PubMed] [Google Scholar]
  10. Berthold MR, Cebron N, Dill F, Gabriel TR, Kötter T, Meinl T, Ohl P, Thiel K, Wiswedel B. KNIME - the Konstanz information miner: Version 2.0 and beyond. ACM SIGKDD Explorations Newsletter. 2009;11:26–31. doi: 10.1145/1656274.1656280. [DOI] [Google Scholar]
  11. Bertrand E, Chartrand P, Schaefer M, Shenoy SM, Singer RH, Long RM. Localization of ASH1 mRNA particles in living yeast. Molecular Cell. 1998;2:437–445. doi: 10.1016/s1097-2765(00)80143-4. [DOI] [PubMed] [Google Scholar]
  12. Brodsky JL. Cleaning up: ER-associated degradation to the rescue. Cell. 2012;151:1163–1167. doi: 10.1016/j.cell.2012.11.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Calfon M, Zeng H, Urano F, Till JH, Hubbard SR, Harding HP, Clark SG, Ron D. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 2002;415:92–96. doi: 10.1038/415092a. [DOI] [PubMed] [Google Scholar]
  14. Cox JS, Shamu CE, Walter P. Transcriptional induction of genes encoding endoplasmic reticulum resident proteins requires a transmembrane protein kinase. Cell. 1993;73:1197–1206. doi: 10.1016/0092-8674(93)90648-a. [DOI] [PubMed] [Google Scholar]
  15. Crameri A, Whitehorn EA, Tate E, Stemmer WP. Improved green fluorescent protein by molecular evolution using DNA shuffling. Nature Biotechnology. 1996;14:315–319. doi: 10.1038/nbt0396-315. [DOI] [PubMed] [Google Scholar]
  16. Cross BCS, Bond PJ, Sadowski PG, Jha BK, Zak J, Goodman JM, Silverman RH, Neubert TA, Baxendale IR, Ron D, Harding HP. The molecular basis for selective inhibition of unconventional mRNA splicing by an IRE1-binding small molecule. PNAS. 2012;109:E869–E878. doi: 10.1073/pnas.1115623109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dave P, Griesbach E, Roth G, Mateju D, Chao JA. Single-Molecule Imaging Reveals the Coupling of Translation and mRNA Decay. SSRN Electronic Journal. 2021;1:5982. doi: 10.2139/ssrn.3885982. [DOI] [Google Scholar]
  18. Eichenberger BT, Griesbach E, Chao JA. Imaging Translation Dynamics of Single mRNA Molecules in Live Cells. Methods of Molecular Biology. 2018;1:385–404. doi: 10.1007/978-1-4939-7213-5_26. [DOI] [PubMed] [Google Scholar]
  19. Gilmore R, Blobel G, Walter P. Protein translocation across the endoplasmic reticulum. I. Detection in the microsomal membrane of a receptor for the signal recognition particle. The Journal of Cell Biology. 1982;95:463–469. doi: 10.1083/jcb.95.2.463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao JA, Aragón T, Voigt F. Live imaging data of XBP1 mRNA under control conditions. Zenodo. 2022a doi: 10.5281/zenodo.6559201. [DOI] [PMC free article] [PubMed]
  21. Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao JA, Aragón T, Voigt F. Live imaging data of XBP1 mRNA under ER stress conditions. Zenodo. 2022b doi: 10.5281/zenodo.6557623. [DOI] [PMC free article] [PubMed]
  22. Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao JA, Aragón T, Voigt F. Live imaging data of XBP1 mRNA under ER stress and IRE1a inhibition. Zenodo. 2022c doi: 10.5281/zenodo.6559058. [DOI] [PMC free article] [PubMed]
  23. Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao JA, Aragón T, Voigt F. Dataset Open AccessLive cell imaging data of IRE1a-GFP foci formation. Zenodo. 2022d doi: 10.5281/zenodo.6559109. [DOI]
  24. Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao JA, Aragón T, Voigt F. Fixed cell imaging data of XBP1 mRNA. Zenodo. 2022e doi: 10.5281/zenodo.6559125. [DOI] [PMC free article] [PubMed]
  25. Gonzalez TN, Sidrauski C, Dörfler S, Walter P. Mechanism of non-spliceosomal mRNA splicing in the unfolded protein response pathway. The EMBO Journal. 1999;18:3119–3132. doi: 10.1093/emboj/18.11.3119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Görlich D, Prehn S, Hartmann E, Kalies KU, Rapoport TA. A mammalian homolog of SEC61p and SECYp is associated with ribosomes and nascent polypeptides during translocation. Cell. 1992;71:489–503. doi: 10.1016/0092-8674(92)90517-g. [DOI] [PubMed] [Google Scholar]
  27. Grimm JB, English BP, Chen J, Slaughter JP, Zhang Z, Revyakin A, Patel R, Macklin JJ, Normanno D, Singer RH, Lionnet T, Lavis LD. A general method to improve fluorophores for live-cell and single-molecule microscopy. Nature Methods. 2015;12:244–250. doi: 10.1038/nmeth.3256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Hollien J, Weissman JS. Decay of endoplasmic reticulum-localized mRNAs during the unfolded protein response. Science (New York, N.Y.) 2006;313:104–107. doi: 10.1126/science.1129631. [DOI] [PubMed] [Google Scholar]
  29. Hollien J, Lin JH, Li H, Stevens N, Walter P, Weissman JS. Regulated Ire1-dependent decay of messenger RNAs in mammalian cells. The Journal of Cell Biology. 2009;186:323–331. doi: 10.1083/jcb.200903014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Hooks KB, Griffiths-Jones S. Conserved RNA structures in the non-canonical Hac1/Xbp1 intron. RNA Biology. 2011;8:552–556. doi: 10.4161/rna.8.4.15396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ishikawa T, Kashima M, Nagano AJ, Ishikawa-Fujiwara T, Kamei Y, Todo T, Mori K. Unfolded protein response transducer IRE1-mediated signaling independent of XBP1 mRNA splicing is not required for growth and development of medaka fish. eLife. 2017;6:e26845. doi: 10.7554/eLife.26845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Jurkin J, Henkel T, Nielsen AF, Minnich M, Popow J, Kaufmann T, Heindl K, Hoffmann T, Busslinger M, Martinez J. The mammalian tRNA ligase complex mediates splicing of XBP1 mRNA and controls antibody secretion in plasma cells. The EMBO Journal. 2014;33:2922–2936. doi: 10.15252/embj.201490332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kanda S, Yanagitani K, Yokota Y, Esaki Y, Kohno K. Autonomous translational pausing is required for XBP1u mRNA recruitment to the ER via the SRP pathway. PNAS. 2016;113:E5886–E5895. doi: 10.1073/pnas.1604435113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Karagöz GE, Acosta-Alvear D, Nguyen HT, Lee CP, Chu F, Walter P. An unfolded protein-induced conformational switch activates mammalian IRE1. eLife. 2017;6:e30700. doi: 10.7554/eLife.30700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Kimata Y, Ishiwata-Kimata Y, Ito T, Hirata A, Suzuki T, Oikawa D, Takeuchi M, Kohno K. Two regulatory steps of ER-stress sensor Ire1 involving its cluster formation and interaction with unfolded proteins. The Journal of Cell Biology. 2007;179:75–86. doi: 10.1083/jcb.200704166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Korennykh AV, Egea PF, Korostelev AA, Finer-Moore J, Zhang C, Shokat KM, Stroud RM, Walter P. The unfolded protein response signals through high-order assembly of Ire1. Nature. 2009;457:687–693. doi: 10.1038/nature07661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kosmaczewski SG, Edwards TJ, Han SM, Eckwahl MJ, Meyer BI, Peach S, Hesselberth JR, Wolin SL, Hammarlund M. The RtcB RNA ligase is an essential component of the metazoan unfolded protein response. EMBO Reports. 2014;15:1278–1285. doi: 10.15252/embr.201439531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Le Thomas A, Ferri E, Marsters S, Harnoss JM, Modrusan Z, Li W, Rudolph J, Wang W, Wu TD, Walter P, Ashkenazi A. Noncanonical MRNA Decay by the Endoplasmic-Reticulum Stress Sensor IRE1α Promotes Cancer-Cell Survival. bioRxiv. 2021 doi: 10.1101/2021.03.16.435520. [DOI]
  39. Li H, Korennykh AV, Behrman SL, Walter P. Mammalian endoplasmic reticulum stress sensor IRE1 signals by dynamic clustering. PNAS. 2010;107:16113–16118. doi: 10.1073/pnas.1010580107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Lu Y, Liang FX, Wang X. A synthetic biology approach identifies the mammalian UPR RNA ligase RtcB. Molecular Cell. 2014;55:758–770. doi: 10.1016/j.molcel.2014.06.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Mateju D, Eichenberger B, Voigt F, Eglinger J, Roth G, Chao JA. Single-Molecule Imaging Reveals Translation of mRNAs Localized to Stress Granules. Cell. 2020;183:1801–1812. doi: 10.1016/j.cell.2020.11.010. [DOI] [PubMed] [Google Scholar]
  42. Mechler B, Rabbitts TH. Membrane-bound ribosomes of myeloma cells. IV. mRNA complexity of free and membrane-bound polysomes. The Journal of Cell Biology. 1981;88:29–36. doi: 10.1083/jcb.88.1.29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Mori K, Ma W, Gething MJ, Sambrook J. A transmembrane protein with A cdc2+/CDC28-related kinase activity is required for signaling from the ER to the nucleus. Cell. 1993;74:743–756. doi: 10.1016/0092-8674(93)90521-q. [DOI] [PubMed] [Google Scholar]
  44. Morisaki T, Lyon K, DeLuca KF, DeLuca JG, English BP, Zhang Z, Lavis LD, Grimm JB, Viswanathan S, Looger LL, Lionnet T, Stasevich TJ. Real-time quantification of single RNA translation dynamics in living cells. Science (New York, N.Y.) 2016;352:1425–1429. doi: 10.1126/science.aaf0899. [DOI] [PubMed] [Google Scholar]
  45. Pakos-Zebrucka K, Koryga I, Mnich K, Ljujic M, Samali A, Gorman AM. The integrated stress response. EMBO Reports. 2016;17:1374–1395. doi: 10.15252/embr.201642195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Pincus D, Chevalier MW, Aragón T, van Anken E, Vidal SE, El-Samad H, Walter P. BiP binding to the ER-stress sensor Ire1 tunes the homeostatic behavior of the unfolded protein response. PLOS Biology. 2010;8:e1000415. doi: 10.1371/journal.pbio.1000415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Plumb R, Zhang ZR, Appathurai S, Mariappan M. A functional link between the co-translational protein translocation pathway and the UPR. eLife. 2015;4:53. doi: 10.7554/eLife.07426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Preibisch S, Saalfeld S, Schindelin J, Tomancak P. Software for bead-based registration of selective plane illumination microscopy data. Nature Methods. 2010;7:418–419. doi: 10.1038/nmeth0610-418. [DOI] [PubMed] [Google Scholar]
  49. Ricci D, Marrocco I, Blumenthal D, Dibos M, Eletto D, Vargas J, Boyle S, Iwamoto Y, Chomistek S, Paton JC, Paton AW, Argon Y. Clustering of IRE1α depends on sensing ER stress but not on its RNase activity. FASEB Journal. 2019;33:9811–9827. doi: 10.1096/fj.201801240RR. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Rüegsegger U, Leber JH, Walter P. Block of HAC1 mRNA translation by long-range base pairing is released by cytoplasmic splicing upon induction of the unfolded protein response. Cell. 2001;107:103–114. doi: 10.1016/s0092-8674(01)00505-0. [DOI] [PubMed] [Google Scholar]
  51. Sanches M, Duffy NM, Talukdar M, Thevakumaran N, Chiovitti D, Canny MD, Lee K, Kurinov I, Uehling D, Al-awar R, Poda G, Prakesch M, Wilson B, Tam V, Schweitzer C, Toro A, Lucas JL, Vuga D, Lehmann L, Durocher D, Zeng Q, Patterson JB, Sicheri F. Structure and mechanism of action of the hydroxy-aryl-aldehyde class of IRE1 endoribonuclease inhibitors. Nature Communications. 2014;5:4202. doi: 10.1038/ncomms5202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. Fiji: an open-source platform for biological-image analysis. Nature Methods. 2012;9:676–682. doi: 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Sidrauski C, Walter P. The transmembrane kinase Ire1p is a site-specific endonuclease that initiates mRNA splicing in the unfolded protein response. Cell. 1997;90:1031–1039. doi: 10.1016/s0092-8674(00)80369-4. [DOI] [PubMed] [Google Scholar]
  54. Sugimoto Y, Vigilante A, Darbo E, Zirra A, Militti C, D’Ambrogio A, Luscombe NM, Ule J. hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1. Nature. 2015;519:491–494. doi: 10.1038/nature14280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Tinevez JY, Perry N, Schindelin J, Hoopes GM, Reynolds GD, Laplantine E, Bednarek SY, Shorte SL, Eliceiri KW. TrackMate: An open and extensible platform for single-particle tracking. Methods (San Diego, Calif.) 2017;115:80–90. doi: 10.1016/j.ymeth.2016.09.016. [DOI] [PubMed] [Google Scholar]
  56. Tirasophon W, Welihinda AA, Kaufman RJ. A stress response pathway from the endoplasmic reticulum to the nucleus requires A novel bifunctional protein kinase/endoribonuclease (Ire1p) in mammalian cells. Genes & Development. 1998;12:1812–1824. doi: 10.1101/gad.12.12.1812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Tran N-H, Carter SD, De Mazière A, Ashkenazi A, Klumperman J, Walter P, Jensen GJ. The stress-sensing domain of activated IRE1α forms helical filaments in narrow ER membrane tubes. Science (New York, N.Y.) 2021;374:52–57. doi: 10.1126/science.abh2474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. van Anken E, Pincus D, Coyle S, Aragón T, Osman C, Lari F, Gómez Puerta S, Korennykh AV, Walter P. Specificity in endoplasmic reticulum-stress signaling in yeast entails a step-wise engagement of HAC1 mRNA to clusters of the stress sensor Ire1. eLife. 2014;3:e05031. doi: 10.7554/eLife.05031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Voigt F, Zhang H, Cui XA, Triebold D, Liu AX, Eglinger J, Lee ES, Chao JA, Palazzo AF. Single-Molecule Quantification of Translation-Dependent Association of mRNAs with the Endoplasmic Reticulum. Cell Reports. 2017;21:3740–3753. doi: 10.1016/j.celrep.2017.12.008. [DOI] [PubMed] [Google Scholar]
  60. Voigt F, Eglinger J, Chao JA. Quantification of mRNA Turnover in Living Cells: A Pipeline for TREAT Data Analysis. Methods in Molecular Biology (Clifton, N.J.) 2019a;2038:75–88. doi: 10.1007/978-1-4939-9674-2_6. [DOI] [PubMed] [Google Scholar]
  61. Voigt F, Gerbracht JV, Boehm V, Horvathova I, Eglinger J, Chao JA, Gehring NH. Detection and quantification of RNA decay intermediates using XRN1-resistant reporter transcripts. Nature Protocols. 2019b;14:1603–1633. doi: 10.1038/s41596-019-0152-8. [DOI] [PubMed] [Google Scholar]
  62. Walter P, Ibrahimi I, Blobel G. Translocation of proteins across the endoplasmic reticulum. I. Signal recognition protein (SRP) binds to in-vitro-assembled polysomes synthesizing secretory protein. The Journal of Cell Biology. 1981;91:545–550. doi: 10.1083/jcb.91.2.545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Walter P, Ron D. The unfolded protein response: from stress pathway to homeostatic regulation. Science (New York, N.Y.) 2011;334:1081–1086. doi: 10.1126/science.1209038. [DOI] [PubMed] [Google Scholar]
  64. Weidenfeld I, Gossen M, Löw R, Kentner D, Berger S, Görlich D, Bartsch D, Bujard H, Schönig K. Inducible expression of coding and inhibitory RNAs from retargetable genomic loci. Nucleic Acids Research. 2009;37:e50. doi: 10.1093/nar/gkp108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Wu B, Miskolci V, Sato H, Tutucci E, Kenworthy CA, Donnelly SK, Yoon YJ, Cox D, Singer RH, Hodgson L. Synonymous modification results in high-fidelity gene expression of repetitive protein and nucleotide sequences. Genes & Development. 2015;29:876–886. doi: 10.1101/gad.259358.115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Yan X, Hoek TA, Vale RD, Tanenbaum ME. Dynamics of Translation of Single mRNA Molecules In Vivo. Cell. 2016;165:976–989. doi: 10.1016/j.cell.2016.04.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Yanagitani K, Imagawa Y, Iwawaki T, Hosoda A, Saito M, Kimata Y, Kohno K. Cotranslational targeting of XBP1 protein to the membrane promotes cytoplasmic splicing of its own mRNA. Molecular Cell. 2009;34:191–200. doi: 10.1016/j.molcel.2009.02.033. [DOI] [PubMed] [Google Scholar]
  68. Yanagitani K, Kimata Y, Kadokura H, Kohno K. Translational pausing ensures membrane targeting and cytoplasmic splicing of XBP1u mRNA. Science (New York, N.Y.) 2011;331:586–589. doi: 10.1126/science.1197142. [DOI] [PubMed] [Google Scholar]
  69. Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K. XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell. 2001;107:881–891. doi: 10.1016/s0092-8674(01)00611-0. [DOI] [PubMed] [Google Scholar]

Editor's evaluation

Jeffrey L Brodsky 1

We agree that this study, especially when considered in parallel with the work from Belyy et al., significantly furthers our understanding of how early events in the unfolded protein response pathway trigger downstream signals. This pathway is essential to respond and protect against potentially toxic insults to ER homeostasis. On a more general note, the advances in single-molecule optical imaging, which were developed for your work, will benefit others who wish to probe dynamic signaling events at the ER membrane and beyond.

Decision letter

Editor: Jeffrey L Brodsky1

Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for submitting the paper "Live imaging of the co-translational recruitment of XBP1 mRNA to the ER and its processing by diffuse, non-polarized IRE1α" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The reviewers have opted to remain anonymous.

Comments to the Authors:

While there was significant interest in the topic and preliminarily findings, we are sorry to say that, after consultation with the reviewers, we have decided that this work will not be considered further for publication by eLife.

As you will read below, whilst all three reviewers concur with the importance of the paper's subject matter they independently concluded that the study would need significant additional work to become suitable for publication. The reviewers have laid out a non-trivial number of additional controls and experiments that are considered essential. In brief, the absence of these experiments indicates that many of the claims currently lack experimental support to the level required by ELife. More specifically, the clustering analysis is of limited scope and significance, temporal aspects of the observed events are absent, the tools used for this study need to be better validated, and single particle analysis was--in contrast to what was stated--not performed rigorously. There is also a consensus amongst the reviewers that a substantial portion of the paper is simply confirmatory based on prior work performed by the Kohno and Argon labs.

Reviewer #1 (Recommendations for the authors):

In this study, the authors explore key steps in the mammalian unfolded protein response (UPR). They focus on the IRE1a branch, specifically, the recruitment of target mRNA XBP1 to the endoplasmic reticulum (ER) surface, the fate of the mRNA, and organization of IRE1a, itself, in response to unfolded protein stress. The novelty of this study is the use of live cell imaging techniques to follow XBP1 mRNA localization and dynamics. The translational recruitment model of XBP1 to the ER membrane surface has been previously described by others and is confirmed in live cells, here. Different reporters were used to visualize localization and translation of spliced and unspliced forms of XBP1. The authors make additional claims regarding the stress-induced clustering behavior of IRE1a. Overall, this study adds visual data, with some dynamics information to potentially help refine models of steps of XBP1 mRNA trafficking and splicing in response to ER stressors. The novelty of the study approach is undercut by the need for more thorough characterization of the reporters, better descriptions of the reagents, and more accurate descriptions of experiments and results. With the additional requested details and modifications to the text, this manuscript could be a useful addition to the ER stress literature and of broader interest to groups interested in trafficking and translation on the ER membrane.

The authors make two claims that are well supported by imaging data, mutants, and biochemical fractionation.

Splicing activity by IRE1a or the presence or expression of XBP1 message in an already spliced form decreases the fraction of XBP1 associated with the ER. These observations are supported by membrane fractionation experiments.

The authors have confirmed that stable ER association of unspliced XBP1 mRNA is established through HR2-dependent targeting and relies on active translation. The experimental data support this claim.

Other claims are less well supported or less accurate.

First, the authors claim to "directly monitor recruitment of individual XBP1 transcripts to the ER surface." I was unable to find a single movie or data series demonstrating the movement of a single particle from the cytoplasm to the ER membrane. Experiments show mRNAs on the ER or report amount of cytoplasmic vs. membrane bound. The results, presumably, of recruitment are observed and reported, not the process.

The authors state "Next, we quantified the mobility of individual particles with respect to their ER localization and therefore assessed when an mRNA particle associates with the ER." What appears to be assessed is whether a particle is associated with the ER, not "when." I assume the authors did not mean "when" as part of temporal order, but it would be less confusing to claim to assess whether or if.

The authors claim to show that IRE1a-catalyzed splicing mobilizes XBP1 mRNA from the ER membrane in response to ER stress. Here the data are mostly supportive of the claim. However, what the authors actually show is that splicing is necessary for an increase in XBP1 mRNA localization in the cytoplasm. No data are presented showing interactions with IRE1a and/or movement of XBP1 mRNA from the ER membrane to the cytoplasm. Based on multiple studies, the interpretation is likely correct, but the microscopy data do not show the process.

The matter of IRE1a clustering is more problematic.

The authors state, "Surprisingly, we find that XBP1 transcripts are not recruited into large IRE1a clusters, which only assemble upon overexpression of fluorescently-tagged IRE1a during ER stress. Our findings support a model where ribosome-engaged, ER-poised XBP1 mRNA is processed by functional IRE1a assemblies that are homogenously distributed throughout the ER membrane."

The authors state, "ER-poised XBP1 transcripts are processed by functional IRE1a assemblies that are homogenously distributed throughout the ER membrane." No data are provided on what fraction of the IRE1a is in an active state. There is no method used to detect the active state or information on the spatial distribution of stress-activated IRE1a. This claim is not supported.

"Our data have allowed us to visualize and uncover unanticipated features of one of the key steps of UPR initiation, the encounter of XBP1 mRNA with IRE1a to undergo splicing." This is another claim that is not quite accurate. The authors observed tagged XBP1 mRNA dynamics in co-expressing cells treated with an inhibitor of IRE1a activity. An encounter in which splicing could actually occur is never presented. Whether XBP1 mRNA is stimulated to dissociate from the ER membrane following an encounter with IRE1a-GFP is not presented. The ability of drug inhibited IRE1a-GFP to bind XBP1 mRNA is not tested or reported.

The authors have made a significant point of weighing in on the matter of IRE1a clustering in both the abstract and text. While their findings are potentially interesting, the investigation of this matter has not been sufficiently rigorous. First, the authors simply describe the attached fluorescent protein as a GFP. Is this monomeric GFP? Emerald? mNeonGreen? or? With the wide variety of fluorescent proteins available, the minimal expectation is to state what was inserted and imaged. Given the potential of many fluorescent proteins to oligomerize, the choice of fluorescent protein matters.

Second, the systems used may be inducing some constitutive stress. For example, in 2C, there appears to be splicing of the reporter, even in the absence of thapsigargin or expression of IRE1-fluorescent protein. Induction with Dox is for 15 hours. That's long enough for stimulation of a stress response and perhaps even some degree of adaptation. I'd like to see some other assays of ER stress before and during induction up to the time normally used to apply stress. Similarly, in the Ire1a-KO cells in 4B, there appears to be spliced XBP1, with and without stress. Importantly, the ratio of spliced XBP1 for the emi1 variant is much lower than for wt, even though immunoblotting suggests there is significantly more EMI-1-IRE1a-GFP protein present than for wt IRE1a. Please comment. Is the GFP tagged variant less active? Is it possible that the GFP tagged variant is less activatable?

More fundamentally, the authors claim that large IRE1a clusters… only assemble upon overexpression of fluorescently-tagged IRE1a during ER stress. At the very least, the more accurate thing would be to say fluorescently-tagged IRE1a only forms inducible observable clusters under overexpression conditions. In this study, there has been no testing of oligomeric/cluster status of native IRE1a. There has been no use of other assays to determine if low expressed IRE1a-fluorescent protein forms oligomers of any size during stress. Nor has there been investigation of whether a version with a small epitope tag might form clusters. What about the ability of other stress conditions, such as acute thapsigargin or DTT, for the ability to induce observable clustering for the lower expressed IRE1a-GFP? Ultimately, the clustering analysis has been too limited to draw any major conclusions. The ability to cluster and its relevance are important to popular models of IRE1a activity. A nuanced study of the clustering regulation of IRE1a would be immensely useful to the field. The observation that clustering observed in mammalian cells is stress inducible, suggests that observable clustering is probably reporting on some aspect of IRE1 regulation. Clusters may represent an extreme manifestation of normal physiology. That is, even an artifact of expression does not rule out the potential importance of forming small clusters in the normal stress response. Note that the overexpressed IRE1a-GFP is constitutively maximally active. There is no stress induced increase in splicing activity, yet there is a stress-inducible change in distribution. This redistribution could reflect some sort of stress inducible regulatory step, for example sequestering of excess unengaged IRE1a, inactivated IRE1a or something else. Whatever causes visible clustering seems to be more than a simple artifact.

It would be helpful for the authors to compare the functionality of their constructs/system relative to untagged versions. Specifically, rates of processing. While I think the authors have demonstrated reasonably well that their XBP1 MS2 reporter does get targeted to the ER and spliced in response to ER stress, it would be useful to know if the 24 MS2 sites and attached MCS-GFP reporters (5nm+ diameter for each) affect rates of XBP1 mRNA processing. Is it possible that the construct is so large that it is relatively immobilized on the ER membrane by sterics and/or sheer size? Could the size of the reporter slow the approach of IRE1a to the cleavage site? Does high expression of the XBP1 substrate impact the efficiency of processing? That is, if client is saturating, then encountering and splicing by activated IRE1a on the ER membrane could compensate for potential issues due to size or mobility. In addition, it would be useful to determine how much XBP1 reporter mRNA is expressed and how this compares to endogenous levels of XBP1 mRNA in unstressed and stressed cells.

Reviewer #2 (Recommendations for the authors):

This manuscript develops a different reporters to monitor XBP1 targeting to the ER, which are used to confirm previous results showing that XBP1 is directed to the ER through a mechanism involving translation of the HR2 mRNA sequence. As indicated in the manuscript, this mechanism had been previously reported by Kohno, and, while the work presented here confirms this model, it does not extend it. The major advance from this manuscript, apart from the reporter development, relates to the fact that IRE1 clusters are not observed in cells expressing endogenous levels of IRE1-GFP and subjected to ER stress. This is in contrast to previous reports where IRE1 clusters were proposed to be the primary site of XBP1 splicing; however, IRE1 clustering from XBP1s splicing has been shown to been separable previously in Ricci et al. (2019) FASEB J (where they showed that the flavinoid luteolin induces robust XBP1 splicing independent of clustering). Herein, the authors demonstrated that the clustering of IRE1-GFP is an artifact of overexpression, which is not observed upon expression of IRE1-GFP to endogenous levels. This is consistent with another recent report submitted to eLife from Peter Walters group showing that endogenous IRE1 does not cluster, despite previous reports (Belyy et al. 2021).

Ultimately, while the experiments appear well performed, the advance of this current manuscript is limited, although it does provide some of the controls requested of the Walter manuscript to compare to previous reports (specifically some of the experiments described in Figure 4). The data included in Figure 1-3 validate previous mechanisms proposed for XBP1 targeting to the ER using new approaches. While important to validate mechanisms using different approaches, there is no new insight included in this aspect of the work. In combination with the Walter manuscript, this work does correct the misinterpretation of the IRE1 activation mechanism resulting from overexpression artifacts, by supporting the fact that endogenous IRE1 does not appear to cluster, but instead splices XBP1 mRNA distributed through ER. Individually, this paper would not be considered strong enough to be published in eLife, but combined with the Walter manuscript they do correct a mechanism of IRE1 activation that is important to highlight in the literature.

Reviewer #3 (Recommendations for the authors):

1. Showing that the MCP-Halo and scAB-GFP do not associate with each more than chance would predict would help to at least show that the dots visualized by both techniques are not likely to be clusters of mRNAs. It is less clear to me how to show that MCP-Halo and scAB-GFP are detecting all of the relevant transcripts, but I would think this point would be important to address one way or another.

2. Would it be possible to engineer an Xbp1 RNA with both the MS2 tag and the SM tag? Presumably, in that case MCP-Halo and scAB-GFP signals should overlap for individual molecules until after splicing. More specifically for point 2, do Xbp1 RNAs that encounter IRE1 then leave the ER, or do they stay associated? Or can Xbp1 RNA leave the ER without encountering an IRE1 cluster?

3. Some statements that are in my mind not warranted:

a. Page 5, "…different from the canonical SRP-mediated recruitment…"; the SRP pathway is not examined. The pathway might use canonical SRP-mediated targeting, just relatively inefficiently.

b. Page 5, "…does not recruit XBP1 mRNA to these higher order oligomeric assemblies."; that there is no stable association is justified, but that there is no recruitment is not, in my opinion.

c. Page 12, "…drives the release of translationally active, translocon-engaged mRNAs."; there is no direct evidence for this claim, as translocons are not examined.

d. Page 12, "ER stress caused a reduction of ER association when compared to untreated conditions." There is no statistical analysis of this for these reporters, so this conclusion is not warranted.

4. Technical points:

a. The authors should explain why there is an NLS on the MCP-Halo protein.

b. The authors should state in the text or legend where the antibody used in Figure 1C recognizes XBP1 protein. If the antibody recognizes spliced wild-type XBP1 but not unspliced, that suggests that the antibody is downstream of the intron, which would also allow it to detect the HR2 mutant when unspliced, but then it shouldn't detect the HR2 mutant when spliced.

c. If the SM tag is place in frame with the spliced Xbp1 mRNA, is that species excluded from the ER membrane, as the authors' interpretations would suggest?

d. Why is 4u8C added to Figure 4F? The logic there is not clear.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

We have considered carefully your appeal of our decision not to invite a revised version of the manuscript "Live imaging of the co-translational recruitment of XBP1 mRNA to the ER and its processing by diffuse, non-polarized IRE1α" for consideration at eLife. As a consequence of these deliberations, we are prepared to consider (with no guarantees of acceptance) a revised submission addressing that specific concerns that follow:

1. The authors have claimed that they "coordinated our study with the one from the Walter lab", which they provide as a reason for not needing to do certain suggested experiments/controls (since they are outlined in the paper from Belyy et al.), most notably the single molecule time-resolved tracking experiments and measurements of the IRE1 oligomeric state. Our understanding of the facts is that the papers were not submitted together as there are non adjoining cover letters indicating that these papers were linked. Thus, the papers were not considered as co-submitted. Moreover, key controls and experiments were not cross-referenced between the two papers. Only after the review process was complete for the Belyy et al. paper where we made aware of your paper. So, the current manuscript was considered as a stand alone study, and therefore we agree with the concerns of 2/3 reviewers that all of the requested experiments are imperative for publication.

If, however, revised versions of the papers are co-submitted and fully cross-referenced in the future, then in the next round of the editorial process it may be possible to consider the exclusion of some requested experiments from this study.

2. We find that in several instances your paper gives the impression that you were measuring dynamics and quantifying single molecules under these conditions, when in fact this may not have been the case. (The rebuttal letter states that the completion of the text was rushed to try to submit as soon as possible.) The authors note that the text will be edited, which is fine if, again, resubmitted papers are cross-referenced and returned to eLife in tandem. If the papers are returned independently without substantial cross-referencing, then the revised manuscript must stand on its own merits and dynamics and quantifying single molecules must be part of it to reach the level of novelty required by eLife

3. A reviewer rightfully asks for other measurements of ER stress since some splicing is apparent in the absence thapsigargin. Shorter induction times and, indeed, other measurements of ER stress should be shown.

4. We also agree that a side-by-side comparison of the tagged constructs to untagged constructs is valuable. It is more than reasonable that one should always confirm the full function of a tagged protein in relation to the untagged protein, thereby validating the behavior of the former. This would better lay out any caveats to the use of the new system, which is vital if others are to take advantage of it.

5. While the authors are indeed using a method that was previously pioneered by their lab, there are critical controls/information that should be added (e.g. spot intensity distributions) to the supplemental information.

6. The need for an experiment to measure detection efficiencies would indeed show "that the MCP-Halo and scAB-GFP do not associate with each more than chance".

7. In the rebuttal letter, it is noted that several other experiments to address the reviewers' comments are ongoing or can be started. The completion of these experiments will significantly strengthen the manuscript, and we encourage the authors to be as thorough as possible in completing these experiments.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for extensively editing and resubmitting your work entitled "Live imaging of the co-translational recruitment of XBP1 mRNA to the ER and its processing by diffuse, non-polarized IRE1α" for further consideration by eLife. As you will note below, we have asked the original three reviewers of this study to again offer their opinions and insights on your work. While they appreciate the extensive work that has gone into the revision, there are still some issues that need to be addressed prior to final acceptance of this report. Based on the reviewers' thoughtful comments, subsequent discussions, and our evaluation of the work, they are:

1. The need for improved quantitation of select data, which is required to better support some of the claims in the study (Reviewer #1).

2. Based on this analysis, a clear statement of how you are defining "puncta" in this study (Reviewer #1 and JLB). The need for this is accentuated by the fact that the companion paper also uses the word freely, and since scientists in the field will be reading both papers in tandem, it is vital that this definition is in harmony between the two studies.

3. An attempt to better position the paper, in the Abstract, Significance Statement, and Introduction, as a technological advance, rather than only a ground-breaking study on the UPR. As two of the Reviewers continue to firmly maintain (Reviewers #2-3), most of the scientific advances were embedded in the literature and/or are outlined in the companion paper.

4. With regard to this last point, please better coordinate with Belyy et al. to ensure that additional cross-references are included.

The specific comments from the Reviewers are:

Reviewer #1 (Recommendations for the authors):

The authors have satisfactorily addressed many of the issues raised by this reviewer. A few issues still remain unresolved.

1. Regarding the relationship between IRE1a expression level and stress inducible cluster formation, the data in figure 4 are supportive of this claim but insufficiently quantitative. Given the previously claimed importance of the IRE1a clusters in the literature, it would be important for this manuscript's claim and extremely helpful for the field for the authors to (a) provide a quantitative definition of stress inducible clusters and (b) perform quantitative analyses of the two reporter cell lines unstressed and stressed (what fraction of cells have puncta and how many puncta?). It would be even better if the authors could determine whether there is a relationship between ER intensity/IRE1a-GFP expression and propensity to form puncta, assuming only some fraction of cells form puncta, as described in the 2019 Belyy et al. PNAS paper. Note that a puncta definition would be useful for distinguishing between the structures observed in Figure 4E IRE1a-GFP and the relatively bright puncta in the "No stress" Emi1-IRE1a-GFP cell.

2. The wording of the manuscript matters. The authors have not changed their claim: "ER-poised XBP1 transcripts are processed by functional IRE1a assemblies that are homogeneously distributed throughout the ER membrane." No data are provided on what fraction of the IRE1a is in an active state.

Up to this point in the manuscript, this claim is not actually supported and the authors agree. Later, the authors cite the Belyy et al. manuscript, which also does not support the claim. There is no assay for visualizing the active form of IRE1a. The fully phosphorylated IRE1a and inactive dimer do not have physical characteristics that should significantly alter the diffusion coefficient or trajectory correlation. At this time, the Belyy et al. group can detect what appears to be dimers and tetramers/possibly larger oligomers which are presumably in the process of activating. The immunoblots do not establish what fraction of total IRE1a is phosphorylated. Therefore, the matter of where active IRE1a is distributed remains unexamined. It's an interesting question worthy of addressing. That said, the authors simply need to modify their text.

3. The authors have not mentioned sources for 4u8C, dox, tunicamycin or puromycin.

Reviewer #2 (Recommendations for the authors):

In the revised submission, the authors attempted to address many of the comments brought up in the previous review. However, some of the underlying problems still remain. Notably, the assay developed simply validates previous mechanistic insights into IRE1-dependent XBP1 splicing. The authors seem to agree with this in their rebuttal, making the point that this represents the first time that this process has been 'visualized' and that this assay now can be used to further probe XBP1 biology. However, this manuscript is written in such a way to suggest the focus was on improving our understanding of XBP1 splicing, not developing an assay for future work. Further, I would argue previous work clearly did a nice job of working out the mechanism, largely independent of microscopy, so I just don't see the advance here. This manuscript does provide support for a manuscript co-submitted with this revision by Peter Walter's group showing that IRE1 clusters are not required for activity, which is fine, but this is something that was previously described in published reports (see Ricci et al). I still don't feel like this work rises to the level suitable for publication in eLife on its own and it is relying on co-submission with the Walter manuscript to get over that bar.

Reviewer #3 (Recommendations for the authors):

I believe that the authors have addressed most of the technical concerns outlined, and I also find their rebuttal to be persuasive. I now appreciate that the sort of experiment I was envisioning, that underlay several of my comments (but was perhaps not obvious from them individually) would be to test the prediction that an Xbp1 mRNA would lose association with the ER membrane and its splicing could be detected by loss of scAB-GFP. But, as the authors point out, that would require simultaneous 3 channel visualization and also possibly a time scale that would be unfeasible (i.e., that the mRNA not only leaves the ER membrane), but that the ribosomes translating the GCN4 region completed their synthesis. It would also require presumably using milder conditions of ER stress, where it would be reasonable to expect some significant fraction of the Xbp1 mRNAs were unspliced.

I also think the revision benefits from more careful wording, and think the untempered claims in the original manuscript contributed to its perception.

I continue to hold the view that the majority of the paper represents a technical advance of somewhat limited general interest because this group has already established the technique, and here uses it largely to confirm a pathway that is well-accepted. I think where this manuscript complements its companion from the Walter lab is that the Walter lab shows that higher clusters of IRE1 need not form under "normal" conditions, and this paper shows that, when they do form, Xbp1 is likely not spliced there.

eLife. 2022 Jun 22;11:e75580. doi: 10.7554/eLife.75580.sa2

Author response


[Editors’ note: The authors appealed the original decision. What follows is the authors’ response to the first round of review.]

Comments to the Authors:

While there was significant interest in the topic and preliminarily findings, we are sorry to say that, after consultation with the reviewers, we have decided that this work will not be considered further for publication by eLife.

As you will read below, whilst all three reviewers concur with the importance of the paper's subject matter they independently concluded that the study would need significant additional work to become suitable for publication.

We thank the reviewers for their feedback and genuinely appreciate the time and effort spent on improving our study.

The reviewers have laid out a non-trivial number of additional controls and experiments that are considered essential. In brief, the absence of these experiments indicates that many of the claims currently lack experimental support to the level required by ELife.

We respectfully disagree. Instead, we propose that there is not a single experiment proposed by the reviewers that we could not provide in a reasonable time frame.

More specifically, the clustering analysis is of limited scope and significance,

We argue that developing a mammalian model system in which XBP1 processing clearly takes place despite the absence of visible stress-induced IRE foci is in itself a major advance that, together with the manuscript of Belyy et al. (2021), clarifies a long-standing misunderstanding about the role of IRE1 clusters.

temporal aspects of the observed events are absent, the tools used for this study need to be better validated,

Please propose experiments for further validation of the RNA imaging tools. The IRE1a-GFP construct was already validated/established by the Walter lab in 2020 (Belyy et al., 2020, PNAS). We regret not having explained this more clearly.

and single particle analysis was--in contrast to what was stated--not performed rigorously.

This statement is incorrect. Single-particle analysis was performed with state-of-the-art methodology that has also been published before (e.g. Voigt et al., 2017). We argue that there is a conceptual misunderstanding amongst the reviewers. Please see the detailed response (i.e. to reviewer 3) below.

There is also a consensus amongst the reviewers that a substantial portion of the paper is simply confirmatory based on prior work performed by the Kohno and Argon labs.

This is correct, a substantial portion of the findings are confirmatory. Which is precisely, why it serves to validate the RNA imaging tools that we have established.

At the same time our work not only confirms a model but solves a debate about how/where UPR splicing takes place, favoring a model that supports the non-polarized splicing of XBP1 and discarding the model whereby ER stress signaling would initiate from specific sites within the ER. That is, we believe, the biological importance of our work.

Reviewer #1 (Recommendations for the authors):

In this study, the authors explore key steps in the mammalian unfolded protein response (UPR). They focus on the IRE1a branch, specifically, the recruitment of target mRNA XBP1 to the endoplasmic reticulum (ER) surface, the fate of the mRNA, and organization of IRE1a, itself, in response to unfolded protein stress. The novelty of this study is the use of live cell imaging techniques to follow XBP1 mRNA localization and dynamics. The translational recruitment model of XBP1 to the ER membrane surface has been previously described by others and is confirmed in live cells, here. Different reporters were used to visualize localization and translation of spliced and unspliced forms of XBP1. The authors make additional claims regarding the stress-induced clustering behavior of IRE1a. Overall, this study adds visual data, with some dynamics information to potentially help refine models of steps of XBP1 mRNA trafficking and splicing in response to ER stressors. The novelty of the study approach is undercut by the need for more thorough characterization of the reporters, better descriptions of the reagents, and more accurate descriptions of experiments and results. With the additional requested details and modifications to the text, this manuscript could be a useful addition to the ER stress literature and of broader interest to groups interested in trafficking and translation on the ER membrane.

Thank you for helping us improve our manuscript. We will be happy to provide more accurate descriptions as well as any characterization of the reporter transcripts asked for and agree that the manuscript is a useful addition to the ER stress literature.

The authors make two claims that are well supported by imaging data, mutants, and biochemical fractionation.

Splicing activity by IRE1a or the presence or expression of XBP1 message in an already spliced form decreases the fraction of XBP1 associated with the ER. These observations are supported by membrane fractionation experiments.

The authors have confirmed that stable ER association of unspliced XBP1 mRNA is established through HR2-dependent targeting and relies on active translation. The experimental data support this claim.

Other claims are less well supported or less accurate.

First, the authors claim to "directly monitor recruitment of individual XBP1 transcripts to the ER surface." I was unable to find a single movie or data series demonstrating the movement of a single particle from the cytoplasm to the ER membrane. Experiments show mRNAs on the ER or report amount of cytoplasmic vs. membrane bound. The results, presumably, of recruitment are observed and reported, not the process.

We apologize for this suboptimal phrasing and thank the reviewer for pointing it out. Of course, we are happy to provide individual example movies from amongst our large dataset to show single XBP1 transcripts as they are being recruited to the ER surface.

As the reviewer rightly points out, our analysis quantifies how wt and mutant XBP1 mRNAs are associated with the ER to different degrees. Since some of these transcripts only differ in individual nucleotide substitutions in elements involved in recruitment to the ER, we used their degree of association as a means to characterize the recruitment mechanism. At no point did we mean to insinuate that we had actually quantified recruitment dynamics.

The authors state "Next, we quantified the mobility of individual particles with respect to their ER localization and therefore assessed when an mRNA particle associates with the ER." What appears to be assessed is whether a particle is associated with the ER, not "when." I assume the authors did not mean "when" as part of temporal order, but it would be less confusing to claim to assess whether or if.

We thank the reviewer for pointing this out and did indeed not use “when” in a temporal context. We will use a different conjunction in the revised version of the manuscript.

The authors claim to show that IRE1a-catalyzed splicing mobilizes XBP1 mRNA from the ER membrane in response to ER stress. Here the data are mostly supportive of the claim. However, what the authors actually show is that splicing is necessary for an increase in XBP1 mRNA localization in the cytoplasm. No data are presented showing interactions with IRE1a and/or movement of XBP1 mRNA from the ER membrane to the cytoplasm. Based on multiple studies, the interpretation is likely correct, but the microscopy data do not show the process.

Again, we thank the reviewer for reading the manuscript attentively. What we actually show is an increase in ER association upon inhibition of IRE1a cleavage activity. Please point out how this result could be interpreted in any other way but the one proposed in the manuscript.

– We are happy to provide movies that show individual mRNAs leaving the ER, however, did not provide them in the first place because we did not consider them very informative (compared to the combined analysis of thousands of individual mRNAs and the heterogeneity of their mobility that we derived from that).

– With respect to showing interactions of individual transcripts with IRE1a clusters, we would like to point out that we did provide a specific example for this extremely rare event (Supplementary Movie 9, white arrow indicates a single XBP1 mRNA particle that colocalizes with an IRE1a cluster) to demonstrate that we were indeed able to detect those and that the absence of colocalization was no artifact of the experimental set-up.

The matter of IRE1a clustering is more problematic.

The authors state, "Surprisingly, we find that XBP1 transcripts are not recruited into large IRE1a clusters, which only assemble upon overexpression of fluorescently-tagged IRE1a during ER stress. Our findings support a model where ribosome-engaged, ER-poised XBP1 mRNA is processed by functional IRE1a assemblies that are homogenously distributed throughout the ER membrane."

The authors state, "ER-poised XBP1 transcripts are processed by functional IRE1a assemblies that are homogenously distributed throughout the ER membrane." No data are provided on what fraction of the IRE1a is in an active state. There is no method used to detect the active state or information on the spatial distribution of stress-activated IRE1a. This claim is not supported.

The reviewer is correct in that we do not provide any data to quantify what fraction of stress-activated IRE1a is functional or how it might be spatially distributed with respect to non-functional IRE1a assemblies. This is due to the nature of our experimental set-up and is exactly what Belyy et al. (2021) demonstrate in their complimentary manuscript. We urge the reviewer to consider both manuscripts together since they were submitted back-to-back. In respect of our agreement with Belyy et al., we refrained from performing the same single-molecule IRE1a imaging experiment that they have set-up.

However, we do demonstrate that IRE1a expressed at physiological levels is homogeneously distributed throughout the ER membrane, does not accumulate in large microscopically visible clusters (contrary to many previous reports) and that even when formed, these clusters are not sites of XBP1 processing. With this experiment, we address a major open question in the field where large IRE1a clusters have been proposed to function as the sites of XBP1 splicing for a long time.

"Our data have allowed us to visualize and uncover unanticipated features of one of the key steps of UPR initiation, the encounter of XBP1 mRNA with IRE1a to undergo splicing." This is another claim that is not quite accurate. The authors observed tagged XBP1 mRNA dynamics in co-expressing cells treated with an inhibitor of IRE1a activity. An encounter in which splicing could actually occur is never presented. Whether XBP1 mRNA is stimulated to dissociate from the ER membrane following an encounter with IRE1a-GFP is not presented. The ability of drug inhibited IRE1a-GFP to bind XBP1 mRNA is not tested or reported.

We thank the reviewer for raising this argument. As before, we should re-phrase and differentiate clearly between observing single-mRNA dynamics and the quantification of ER association of many individual mRNA transcripts, which is what we are showing in this manuscript.

The reviewer is correct, we do not show an individual mRNA molecule that is cleaved by IRE1a and leaves the ER surface in response to that. However, we do show that IRE1a is homogenously distributed throughout the ER membrane (Figure 4E) and that XBP1 transcripts are present/absent there in response to IRE1a cleavage activity (Figure 3C). This observation is not only dependent on treatment with an IRE1a inhibitor but was also observed for non-cleavable mutant transcripts that accumulate on the ER surface. We argue that the increase in ER association that we observe for these non-spliceable mutant mRNAs clearly shows that ER dissociation depends on mRNA cleavage even though we do not show (and do not claim to show) the actual dynamics of the process.

The authors have made a significant point of weighing in on the matter of IRE1a clustering in both the abstract and text. While their findings are potentially interesting, the investigation of this matter has not been sufficiently rigorous. First, the authors simply describe the attached fluorescent protein as a GFP. Is this monomeric GFP? Emerald? mNeonGreen? or? With the wide variety of fluorescent proteins available, the minimal expectation is to state what was inserted and imaged. Given the potential of many fluorescent proteins to oligomerize, the choice of fluorescent protein matters.

We apologize for the lack of specificity. As mentioned in the methods, we have reproduced the construct design established by the Walter lab in 2019. Our fusion protein design includes a GFPuv tag.

Second, the systems used may be inducing some constitutive stress. For example, in 2C, there appears to be splicing of the reporter, even in the absence of thapsigargin or expression of IRE1-fluorescent protein. Induction with Dox is for 15 hours. That's long enough for stimulation of a stress response and perhaps even some degree of adaptation. I'd like to see some other assays of ER stress before and during induction up to the time normally used to apply stress.

We thank the reviewer for this comment. Doxycycline-inducible expression of imaging reporter constructs does not induce ER stress, as indicated by the splicing rate of endogenous XBP1 mRNA or the low expression of other UPR transcripts or trigger any kind of detectable adaptation. In the experiments where splicing/translation of reporter mRNAs were characterized, we typically induced their expression for 15 hours to reach steady-state levels of mRNA expression. Please note that IRE1a-GFP expression was not controlled by Dox-inducible promoters, but by constitutive promoters.

We would be happy to include this information in the manuscript, or to repeat the characterization experiments using shorter induction times.

Similarly, in the Ire1a-KO cells in 4B, there appears to be spliced XBP1, with and without stress. Importantly, the ratio of spliced XBP1 for the emi1 variant is much lower than for wt, even though immunoblotting suggests there is significantly more EMI-1-IRE1a-GFP protein present than for wt IRE1a. Please comment. Is the GFP tagged variant less active? Is it possible that the GFP tagged variant is less activatable?

We thank the reviewer for this accurate comment. The reviewer is right, in the gel provided there is a faint band that co-migrates with the band that corresponds to the spliced mRNA. Since quantitative RT-PCR of XBP1 mRNA failed to detect any spliced XBP1 mRNA, and Western blot analysis shows no XBP1s protein in IRE1a-KO cells, this band could represent a non-specific PCR product that migrates like the “spliced” PCR band. We are conducting PCRs with a different set of primers to rule out that possibility.

Also, Emi1-IRE1a-GFP promotes splicing with lower efficiency than endogenous IRE1a, as the PCR and qPCR analyses indicate, we thank the reviewer for giving us the opportunity to mention this aspect properly.

More fundamentally, the authors claim that large IRE1a clusters… only assemble upon overexpression of fluorescently-tagged IRE1a during ER stress. At the very least, the more accurate thing would be to say fluorescently-tagged IRE1a only forms inducible observable clusters under overexpression conditions. In this study, there has been no testing of oligomeric/cluster status of native IRE1a.

We thank the reviewer for pointing this out and will re-phrase to “no observation of microscopically visible IRE1a clusters”.

There has been no use of other assays to determine if low expressed IRE1a-fluorescent protein forms oligomers of any size during stress. Nor has there been investigation of whether a version with a small epitope tag might form clusters. What about the ability of other stress conditions, such as acute thapsigargin or DTT, for the ability to induce observable clustering for the lower expressed IRE1a-GFP? Ultimately, the clustering analysis has been too limited to draw any major conclusions. The ability to cluster and its relevance are important to popular models of IRE1a activity. A nuanced study of the clustering regulation of IRE1a would be immensely useful to the field. The observation that clustering observed in mammalian cells is stress inducible, suggests that observable clustering is probably reporting on some aspect of IRE1 regulation. Clusters may represent an extreme manifestation of normal physiology. That is, even an artifact of expression does not rule out the potential importance of forming small clusters in the normal stress response. Note that the overexpressed IRE1a-GFP is constitutively maximally active. There is no stress induced increase in splicing activity, yet there is a stress-inducible change in distribution. This redistribution could reflect some sort of stress inducible regulatory step, for example sequestering of excess unengaged IRE1a, inactivated IRE1a or something else. Whatever causes visible clustering seems to be more than a simple artifact.

Thank you for raising all of these points. As above, we would like to refer to the manuscript of Belyy et al. (2021) that is also under review at eLife and does exactly this. The focus of our work (which purposefully does not repeat the excellent study performed in the Walter lab) is on the recruitment of XBP1 transcripts to IRE1a assemblies. We fully agree that visible clusters might have other physiologically relevant functions but simply state that they are not sites of XBP1 processing.

This is no obvious finding but has been controversially discussed in the literature for more than a decade (Li et al., 2010; Korennykh et al., 2009) and is still discussed today (Belyy et al., 2019; Tran et al., 2021) especially since HAC1 mRNAs have been shown so early on to be recruited to discrete Ire1p foci in yeast (Aragón et al., 2009; Kimata et al., 2007).

It would be helpful for the authors to compare the functionality of their constructs/system relative to untagged versions. Specifically, rates of processing. While I think the authors have demonstrated reasonably well that their XBP1 MS2 reporter does get targeted to the ER and spliced in response to ER stress, it would be useful to know if the 24 MS2 sites and attached MCS-GFP reporters (5nm+ diameter for each) affect rates of XBP1 mRNA processing. Is it possible that the construct is so large that it is relatively immobilized on the ER membrane by sterics and/or sheer size?

Thank you for proposing this experiment. While we agree with the reviewer that it is always useful to assay mRNA processing rates, our data clearly show that the ER association of our MS2 tagged reporter transcripts is abolished upon introduction of a single point mutation in the HR2 sequence (Figure 1F,G) or removal of the ER intron (Figure 3C). In addition, our RT-PCR assays clearly show that reporter transcripts are efficiently spliced only in response to ER stress (Figure 1B,C).

Therefore, we do not understand how differences in processing rates (compared to endogenous transcripts) would affect the findings presented here, where the same kind of bias (potentially introduced by the MS2 labeling) affects all reporter transcripts in the same way. The observed differences in ER association in between different reporters can therefore only be due to differences in experimental set-up (mutants, inhibitors) and are not caused by the labeling method.

Could the size of the reporter slow the approach of IRE1a to the cleavage site? Does high expression of the XBP1 substrate impact the efficiency of processing? That is, if client is saturating, then encountering and splicing by activated IRE1a on the ER membrane could compensate for potential issues due to size or mobility.

All of these are fair questions and could be assessed at a later time. However, they are not relevant to our main conclusions, which are qualitative (microscopically visible IRE1a clusters are not sites of XBP1 processing) and highly relevant to the research community.

In addition, it would be useful to determine how much XBP1 reporter mRNA is expressed and how this compares to endogenous levels of XBP1 mRNA in unstressed and stressed cells.

We can provide this information based on the qPCR assays that we have performed.

Reviewer #2 (Recommendations for the authors):

This manuscript develops a different reporters to monitor XBP1 targeting to the ER, which are used to confirm previous results showing that XBP1 is directed to the ER through a mechanism involving translation of the HR2 mRNA sequence. As indicated in the manuscript, this mechanism had been previously reported by Kohno, and, while the work presented here confirms this model, it does not extend it.

Please see comment above. The experiments provide important validation and were used to establish the single molecule imaging tools, which will be extremely useful for further characterization of mRNA processing during the UPR on the ER.

The major advance from this manuscript, apart from the reporter development, relates to the fact that IRE1 clusters are not observed in cells expressing endogenous levels of IRE1-GFP and subjected to ER stress. This is in contrast to previous reports where IRE1 clusters were proposed to be the primary site of XBP1 splicing; however, IRE1 clustering from XBP1s splicing has been shown to been separable previously in Ricci et al. (2019) FASEB J (where they showed that the flavinoid luteolin induces robust XBP1 splicing independent of clustering). Herein, the authors demonstrated that the clustering of IRE1-GFP is an artifact of overexpression, which is not observed upon expression of IRE1-GFP to endogenous levels. This is consistent with another recent report submitted to ELIFE from Peter Walters group showing that endogenous IRE1 does not cluster, despite previous reports (Belyy et al. 2021).

Please see comment above. Apart from the study of Ricci and colleagues that the reviewer mentions, earlier works from the Walter lab (Belyy et al. PNAS 2020) as well as their manuscript currently under review at eLife (Belyy et al., 2021), are consistent with our observation that large IRE1a foci only form whenever IRE1a is overexpressed.

More importantly, however, we show for the first time that the ability of such foci to recruit IRE1a is indeed very limited. The direct observation of this lack of recruitment of XBP1 mRNA solves a long-standing debate in the field. Of course, our findings do not rule out the possibility that under specific conditions or in specific cell types (for instance, in multiple myeloma cells, where IRE1a is strongly overexpressed), these foci may be able to recruit other RNA substrates, or to promote other processes in the stressed cell.

Ultimately, while the experiments appear well performed, the advance of this current manuscript is limited, although it does provide some of the controls requested of the Walter manuscript to compare to previous reports (specifically some of the experiments described in Figure 4). The data included in Figure 1-3 validate previous mechanisms proposed for XBP1 targeting to the ER using new approaches. While important to validate mechanisms using different approaches, there is no new insight included in this aspect of the work.

We agree with the reviewer but would like to stress that even if XBP1 targeting mechanisms have been proposed and discussed in the literature for a while, our study is the first to directly test them.

In combination with the Walter manuscript, this work does correct the misinterpretation of the IRE1 activation mechanism resulting from overexpression artifacts, by supporting the fact that endogenous IRE1 does not appear to cluster, but instead splices XBP1 mRNA distributed through ER. Individually, this paper would not be considered strong enough to be published in eLife, but combined with the Walter manuscript they do correct a mechanism of IRE1 activation that is important to highlight in the literature.

We thank the reviewer for this important comment.

Reviewer #3 (Recommendations for the authors):

1. Showing that the MCP-Halo and scAB-GFP do not associate with each more than chance would predict would help to at least show that the dots visualized by both techniques are not likely to be clusters of mRNAs. It is less clear to me how to show that MCP-Halo and scAB-GFP are detecting all of the relevant transcripts, but I would think this point would be important to address one way or another.

To answer your question concerning detection efficiencies: This could be done in e.g. a FISH experiment where two different probe sets are used to detect the same transcript species. The degree of colocalization between both labels can then be used to calculate detection efficiencies for each fluorescent label. For further information please see Voigt*, Gerbracht* et al., 2019, Nat Prot. We are happy to provide such an experiment in a revised manuscript if needed.

2. Would it be possible to engineer an Xbp1 RNA with both the MS2 tag and the SM tag? Presumably, in that case MCP-Halo and scAB-GFP signals should overlap for individual molecules until after splicing. More specifically for point 2, do Xbp1 RNAs that encounter IRE1 then leave the ER, or do they stay associated? Or can Xbp1 RNA leave the ER without encountering an IRE1 cluster?

This is precisely what we have done. Please see the cartoon in Figure 2A. XBP1u translation reporter transcripts contain both, the SM and MS2 tags. This is why MCP-Halo and scAB-GFP spots need to colocalize. XBP1 mRNAs that are processed by IRE1a eventually leave the ER as illustrated by differences in ER association upon induction of ER stress and treatment with 4µ8C in Figure 3C. The dynamics of the cleavage reaction cannot be inferred from the kind of live imaging experiment that we have performed here.

Last, yes, it is possible that XBP1 mRNAs could leave the ER without encountering IRE1a, yet, this would only mean that we are underestimating the efficiency of XBP1 recruitment to the ER. Since our conclusions from the ER association analysis are qualitative, not quantitative, we believe that this possibility is of minor relevance.

3. Some statements that are in my mind not warranted:

a. Page 5, "…different from the canonical SRP-mediated recruitment…"; the SRP pathway is not examined. The pathway might use canonical SRP-mediated targeting, just relatively inefficiently.

Please excuse the vague phrasing. This is exactly what we mean. As well as the lack of a canonical signal sequence in the XBP1 ORF.

b. Page 5, "…does not recruit XBP1 mRNA to these higher order oligomeric assemblies."; that there is no stable association is justified, but that there is no recruitment is not, in my opinion.

We will re-phrase this sentence.

c. Page 12, "…drives the release of translationally active, translocon-engaged mRNAs."; there is no direct evidence for this claim, as translocons are not examined.

This is correct. We are working on this at the moment.

d. Page 12, "ER stress caused a reduction of ER association when compared to untreated conditions." There is no statistical analysis of this for these reporters, so this conclusion is not warranted.

This is correct. We will add the analysis.

4. Technical points:

a. The authors should explain why there is an NLS on the MCP-Halo protein.

To recruit excess/unbound MCP-Halo protein away from the cytoplasm and thereby increase signal/noise. We will add this detail to the revised manuscript.

b. The authors should state in the text or legend where the antibody used in Figure 1C recognizes XBP1 protein. If the antibody recognizes spliced wild-type XBP1 but not unspliced, that suggests that the antibody is downstream of the intron, which would also allow it to detect the HR2 mutant when unspliced, but then it shouldn't detect the HR2 mutant when spliced.

As indicated by the provider (Santa Cruz Biotechnology), the antibody recognizes a region within the N-terminal half of XBP1 protein, encoded upstream the UPR intron. Thus, this antibody should recognize both XBP1u and XBP1s proteins. Yet, we can only detect XBP1s protein. We believe this lack of recognition is due to the translational regulation of XBP1u mRNA and the low stability of XBP1u protein.

c. If the SM tag is place in frame with the spliced Xbp1 mRNA, is that species excluded from the ER membrane, as the authors' interpretations would suggest?

This experiment is in progress.

d. Why is 4u8C added to Figure 4F? The logic there is not clear.

In order to inhibit IRE1a cleavage activity and allow accumulation/detection of XBP1 mRNA in IRE1a clusters. We have performed the experiment with the same result in absence and presence of the compound. Here, we show the lack of accumulation in 4µ8C treated cells to illustrate that even a “kiss-and-run” mechanism (very fast turnover) could be detected in this experimental set-up.

[Editors’ note: what follows is the authors’ response to the second round of review.]

1. The authors have claimed that they "coordinated our study with the one from the Walter lab", which they provide as an reason for not needing to do certain suggested experiments/controls (since they are outlined in the paper from Belyy et al.), most notably the single molecule time-resolved tracking experiments and measurements of the IRE1 oligomeric state. Our understanding of the facts is that the papers were not submitted together as there are non adjoining cover letters indicating that these papers were linked. Thus, the papers were not considered as co-submitted. Moreover, key controls and experiments were not cross-referenced between the two papers. Only after the review process was complete for the Belyy et al. paper where we made aware of your paper. So, the current manuscript was considered as a stand alone study, and therefore we agree with the concerns of 2/3 reviewers that all of the requested experiments are imperative for publication.

Thank you for explaining the details of the editorial process, through which our manuscript proceeded. While we did indeed submit our manuscript a few weeks after the Belyy et al. paper, both cover letters actually mentioned the other’s manuscript and suggested a parallel revision process. We regret that this could not happen in a more coordinated manner and aimed to address both, missing controls as well as cross-references, in the revised version of the manuscript.

If, however, revised versions of the papers are co-submitted and fully cross-referenced in the future, then in the next round of the editorial process it may be possible to consider the exclusion of some requested experiments from this study.

We co-submit our revised and cross-referenced manuscript together with the revised manuscript of Belyy et al..

2. We find that in several instances your paper gives the impression that you were measuring dynamics and quantifying single molecules under these conditions, when in fact this may not have been the case. (The rebuttal letter states that the completion of the text was rushed to try to submit as soon as possible.) The authors note that the text will be edited, which is fine if, again, resubmitted papers are cross-referenced and returned to eLife in tandem. If the papers are returned independently without substantial cross-referencing, then the revised manuscript must stand on its own merits and dynamics and quantifying single molecules must be part of it to reach the level of novelty required by eLife.

We apologize for any confusion caused by the single-molecule terminology used.

Our study indeed quantifies single particles and their degree of association with the ER using both live and fixed single-molecule imaging approaches. While it is correct that we quantify instantaneous diffusion coefficients as a measure of the mobility (or “dynamics”) of individual mRNA particles, this does not mean that we are also able to characterize the “recruitment dynamics” (as in the complete trajectory travelled) of individual mRNAs on their way to the ER. This is due to experimental limitations such as the high particle number and mobility as well as low signal/noise and rapid photo bleaching of diffraction-limited spots (as which we detect single particles) that are inherent to any single-molecule imaging experiment. Instead, our analysis relies on the quantification of the mobility and subcellular localization of single particles that were imaged over short periods of time at high temporal resolution.

In summary, our work relies on the quantification of single molecules and their diffusive properties (“dynamics”) over short time frames (ms scale). However, this is not the same as the analysis of “recruitment dynamics” that would involve tracking individual mRNAs over the extend of time (min scale) that a particle requires to travel after translation initiation in the cytoplasm to the ER surface, which is not possible in currently available live single particle imaging set-ups.

We thank the reviewers for pointing out how confusingly we have applied the term “dynamics” and have made sure to re-phrase accordingly in the revised version of our manuscript.

3. A reviewer rightfully asks for other measurements of ER stress since some splicing is apparent in the absence thapsigargin. Shorter induction times and, indeed, other measurements of ER stress should be shown.

We thank the reviewers for requesting a more thorough analysis of the behavior of our reporter mRNAs and their effect on ER stress signaling. We now include a more detailed characterization of UPR signaling in the cell lines used in this study both under non-stress and stress conditions (Figure 1—figure supplement 1 and Figure 4—figure supplement 1).

4. We also agree that a side-by-side comparison of the tagged constructs to untagged constructs is valuable. It is more than reasonable that one should always confirm the full function of a tagged protein in relation to the untagged protein, thereby validating the behavior of the former. This would better lay out any caveats to the use of the new system, which is vital if others are to take advantage of it.

We agree with the reviewer’s sensible comment and include these control experiments (Figure 4—figure supplement 1) in the updated version of our manuscript.

5. While the authors are indeed using a method that was previously pioneered by their lab, there are critical controls/information that should be added (e.g. spot intensity distributions) to the supplemental information.

Thank you for pointing this out. We now provide intensity distributions for single-particle signal from live (Figure 3figure supplement 1E) as well as fixed cell (Figure 2—figure supplement 1D) imaging experiments.

6. The need for an experiment to measure detection efficiencies would indeed show "that the MCP-Halo and scAB-GFP do not associate with each more than chance".

To address this concern and test if MCP-Halo and scAB-GFP could associate unspecifically, we have performed a targeted imaging experiment (Figure 2—figure supplement 2A), for which we provide data (Figure 2—figure supplement 2B) and quantification (Figure 2—figure supplement 2C) in the revised manuscript.

In brief, we imaged mRNA reporters that encode MCP-Halo and scAB-GFP binding sites either combined on a single or separately on two individual transcripts. Image data analysis shows that the fraction of co-localizing MCP-Halo and scAB-GFP spots is reduced to background levels (Mean ± SD = 0.01 ±0.03) when binding sites are co-expressed from separate reporter transcripts in the same cell (as opposed to 0.50 ±0.17 when expressed from a single transcript), and thus demonstrates that scAB-GFP and MCP-Halo do not associate or co-localize by more than chance (Figure 2—figure supplement 2C).

7. In the rebuttal letter, it is noted that several other experiments to address the reviewers' comments are ongoing or can be started. The completion of these experiments will significantly strengthen the manuscript, and we encourage the authors to be as thorough as possible in completing these experiments.

Several experiments to characterize the translation of XBP1 reporters on the ER are on their way. We have performed ribosome run-off experiments (after Harringtonine treatment) to characterize translation elongation rates on ER associated transcripts and found that ribosome occupancy was too low to fit our data and quantify specific elongation rates. Thus, we are now in the process of engineering a new, brighter XBP1u translation site reporter. In addition, we have also started to generate XBP1s reporter cell lines. Unfortunately, their generation was beyond the time frame that we agreed on for the coordinated re-submission of the two manuscripts.

[Editors’ note: what follows is the authors’ response to the second round of review.]

1. The need for improved quantitation of select data, which is required to better support some of the claims in the study (Reviewer #1).

We have added the quantification in Figure 4F.

2. Based on this analysis, a clear statement of how you are defining "puncta" in this study (Reviewer #1 and JLB). The need for this is accentuated by the fact that the companion paper also uses the word freely, and since scientists in the field will be reading both papers in tandem, it is vital that this definition is in harmony between the two studies.

Thank you for pointing this out. We now define IRE1a-GFP foci as intensity aggregates that can be detected as an enrichment of GFP intensity, which is ≥ 5-fold over background. Similarly, we define cells as containing IRE1a-GFP foci if at least 1% of all cellular GFP signal is contained in foci. This quantification is in accordance with the quantification employed in the manuscript of Belyy et al.

3. An attempt to better position the paper, in the Abstract, Significance Statement, and Introduction, as a technological advance, rather than only a ground-breaking study on the UPR. As two of the Reviewers continue to firmly maintain (Reviewers #2-3), most of the scientific advances were embedded in the literature and/or are outlined in the companion paper.

We have modified Abstract, Significance Statement and Introduction accordingly.

4. With regard to this last point, please better coordinate with Belyy et al. to ensure that additional cross-references are included.

We have included additional cross references and discussed this with Belyy et al.

The specific comments from the Reviewers are:

Reviewer #1 (Recommendations for the authors):

The authors have satisfactorily addressed many of the issues raised by this reviewer. A few issues still remain unresolved.

1. Regarding the relationship between IRE1a expression level and stress inducible cluster formation, the data in figure 4 are supportive of this claim but insufficiently quantitative. Given the previously claimed importance of the IRE1a clusters in the literature, it would be important for this manuscript's claim and extremely helpful for the field for the authors to (a) provide a quantitative definition of stress inducible clusters and (b) perform quantitative analyses of the two reporter cell lines unstressed and stressed (what fraction of cells have puncta and how many puncta?). It would be even better if the authors could determine whether there is a relationship between ER intensity/IRE1a-GFP expression and propensity to form puncta, assuming only some fraction of cells form puncta, as described in the 2019 Belyy et al. PNAS paper. Note that a puncta definition would be useful for distinguishing between the structures observed in Figure 4E IRE1a-GFP and the relatively bright puncta in the "No stress" Emi1-IRE1a-GFP cell.

Thank you for this input. We have added a quantification of our data in Figure 4F. In agreement with Belyy et al., we define cells as IRE1-foci containing if ≥ 1% of the total cellular IRE1a-GFP fluorescence can be attributed to puncta that are detected via thresholding (of normalized images) using a 5-fold fluorescence intensity enrichment over background as cut-off.

2. The wording of the manuscript matters. The authors have not changed their claim: "ER-poised XBP1 transcripts are processed by functional IRE1a assemblies that are homogeneously distributed throughout the ER membrane." No data are provided on what fraction of the IRE1a is in an active state.

Up to this point in the manuscript, this claim is not actually supported and the authors agree. Later, the authors cite the Belyy et al. manuscript, which also does not support the claim. There is no assay for visualizing the active form of IRE1a. The fully phosphorylated IRE1a and inactive dimer do not have physical characteristics that should significantly alter the diffusion coefficient or trajectory correlation. At this time, the Belyy et al. group can detect what appears to be dimers and tetramers/possibly larger oligomers which are presumably in the process of activating. The immunoblots do not establish what fraction of total IRE1a is phosphorylated. Therefore, the matter of where active IRE1a is distributed remains unexamined. It's an interesting question worthy of addressing. That said, the authors simply need to modify their text.

Thank you for pointing this out. We had originally misunderstood the reviewer’s point and have now modified the text to reflect that we have no information on what fraction of IRE1a assemblies is functional or how it is distributed throughout the membrane.

3. The authors have not mentioned sources for 4u8C, dox, tunicamycin or puromycin.

We have added their sources in the methods section.

Reviewer #2 (Recommendations for the authors):

In the revised submission, the authors attempted to address many of the comments brought up in the previous review. However, some of the underlying problems still remain. Notably, the assay developed simply validates previous mechanistic insights into IRE1-dependent XBP1 splicing. The authors seem to agree with this in their rebuttal, making the point that this represents the first time that this process has been 'visualized' and that this assay now can be used to further probe XBP1 biology. However, this manuscript is written in such a way to suggest the focus was on improving our understanding of XBP1 splicing, not developing an assay for future work. Further, I would argue previous work clearly did a nice job of working out the mechanism, largely independent of microscopy, so I just don't see the advance here. This manuscript does provide support for a manuscript co-submitted with this revision by Peter Walter's group showing that IRE1 clusters are not required for activity, which is fine, but this is something that was previously described in published reports (see Ricci et al). I still don't feel like this work rises to the level suitable for publication in eLife on its own and it is relying on co-submission with the Walter manuscript to get over that bar.

Seeing is believing, which is why we strongly advocate the development of single-molecule tools that can test biological hypotheses. In addition, we have modified Abstract, Significance Statement and Introduction to also highlight the methodological advance of our work.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Data Citations

    1. Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Live imaging data of XBP1 mRNA under control conditions. Zenodo. [DOI] [PMC free article] [PubMed]
    2. Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Live imaging data of XBP1 mRNA under ER stress conditions. Zenodo. [DOI] [PMC free article] [PubMed]
    3. Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Live imaging data of XBP1 mRNA under ER stress and IRE1a inhibition. Zenodo. [DOI] [PMC free article] [PubMed]
    4. Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Live cell imaging data of IRE1a-GFP foci formation. Zenodo. [DOI] [PMC free article] [PubMed]
    5. Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Fixed cell imaging data of XBP1 mRNA. Zenodo. [DOI] [PMC free article] [PubMed]

    Supplementary Materials

    Figure 1—source data 1. Raw gel images for Figure 1.
    Figure 1—figure supplement 1—source data 1. Raw gel images for Figure 1—figure supplement 1.
    Figure 1—figure supplement 2—source data 1. Raw gel images for Figure 1—figure supplement 2.
    Figure 2—source data 1. Source data containing raw gel images for Figure 2.
    Figure 3—figure supplement 1—source data 1. Raw gel images for Figure 3—figure supplement 1.
    Figure 4—source data 1. Raw gel images for Figure 4.
    Figure 4—figure supplement 1—source data 1. Raw gel images for Figure 4—figure supplement 1.
    Transparent reporting form

    Data Availability Statement

    All data were analyzed using custom-made KNIME image analysis workflows that have been published before (Voigt et al., 2017). Specialized KNIME component nodes are available from the KNIME Hub (Users > imagejan > Public > fmi-basel). To prepare exemplary microscopy data for publication, image series were processed in Fiji (Schindelin et al., 2012). Manuscript figures were prepared using Adobe InDesign and Illustrator 2021. All processed and raw microscopy data generated in this study are available from Zenodo (Gómez-Puerta et al., 2022a; Gómez-Puerta et al., 2022b; Gómez-Puerta et al., 2022c; Gómez-Puerta et al., 2022d; Gómez-Puerta et al., 2022e). All other raw data, including full gel images have been uploaded as source data to this manuscript.

    All imaging data generated in this study have been uploaded to Zenodo.

    The following datasets were generated:

    Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Live imaging data of XBP1 mRNA under control conditions. Zenodo.

    Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Live imaging data of XBP1 mRNA under ER stress conditions. Zenodo.

    Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Live imaging data of XBP1 mRNA under ER stress and IRE1a inhibition. Zenodo.

    Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Live cell imaging data of IRE1a-GFP foci formation. Zenodo.

    Gómez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J A, Aragón T, Voigt F. 2022. Fixed cell imaging data of XBP1 mRNA. Zenodo.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES