Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2000 Sep;66(9):3664–3673. doi: 10.1128/aem.66.9.3664-3673.2000

Microbial Community Dynamics during Production of the Mexican Fermented Maize Dough Pozol

Nabil ben Omar 1, Frédéric Ampe 1,*
PMCID: PMC92204  PMID: 10966374

Abstract

The dynamics of the microbial community responsible for the traditional fermentation of maize in the production of Mexican pozol was investigated by using a polyphasic approach combining (i) microbial enumerations with culture media, (ii) denaturing gradient gel electrophoresis (DGGE) fingerprinting of total community DNA with bacterial and eukaryotic primers and sequencing of partial 16S ribosomal DNA (rDNA) genes, (iii) quantification of rRNAs from dominant microbial taxa by using phylogenetic oligonucleotide probes, and (iv) analysis of sugars and fermentation products. A Streptococcus species dominated the fermentation and accounted for between 25 and 75% of the total flora throughout the process. Results also showed that the initial epiphytic aerobic microflora was replaced in the first 2 days by heterofermentative lactic acid bacteria (LAB), including a close relative of Lactobacillus fermentum, producing lactic acid and ethanol; this heterolactic flora was then progressively replaced by homofermentative LAB (mainly close relatives of L. plantarum, L. casei, and L. delbrueckii) which continued acidification of the maize dough. At the same time, a very diverse community of yeasts and fungi developed, mainly at the periphery of the dough. The analysis of the DGGE patterns obtained with bacterial and eukaryotic primers targeting the 16S and 18S rDNA genes clearly demonstrated that there was a major shift in the community structure after 24 h and that high biodiversity—according to the Shannon-Weaver index—was maintained throughout the process. These results proved that a relatively high number of species, at least six to eight, are needed to perform this traditional lactic acid fermentation. The presence of Bifidobacterium, Enterococcus, and enterobacteria suggests a fecal origin of some important pozol microorganisms. Overall, the results obtained with different culture-dependent or -independent techniques clearly confirmed the importance of developing a polyphasic approach to study the ecology of fermented foods.


In most tropical countries where dairy products are difficult to store, starchy foods (cassava, maize, sorghum, etc.) are the basis of the daily diet. To improve the storage possibilities, traditional processes using spontaneous fermentations have been developed over the centuries. In southeastern México and Guatemala, Indians and mestizos use maize as a staple of the daily diet and prepare a traditional fermented maize dough called pozol (47, 50). Cobs of white maize are shelled, and the kernels are cooked in the presence of lime and washed to remove the pericarps. The grains are then coarsely ground, shaped into balls, wrapped in banana leaves, and allowed to ferment at ambient temperature for 2 to 7 or more days. The resulting fermented dough is suspended in water and drunk daily as a refreshing beverage. A wide variety of microorganisms, including fungi, yeasts, lactic acid bacteria (LAB), and non-LAB, have been isolated from this spontaneous fermentation (33, 47, 51). In order to demonstrate the role of these organisms (particularly the LAB) in the production of pozol, it is essential to quantify the predominating groups of organisms and to investigate the dynamics of the overall community. In addition, the final quality of the product and storage of the product strongly rely on the way the fermentation was performed. Identifying the key organisms is a necessary step in the development of a mixed starter culture that would standardize the manufacture of this product.

In the last decade, it was shown that conventional microbial techniques do not allow us to obtain a real view of microbial diversity (5, 23, 35, 54). This was first demonstrated for environments such as hot springs (52), the rumen (26), or wastewater treatment plants (19), where many microorganisms are difficult to cultivate or thought to be nonculturable. Recently, we showed that the same statement applies to apparently simpler environments, such as traditional fermented foods in which “culturable” microorganisms predominate: culture methods not only underestimated biodiversity but failed to quantify precisely some dominant taxa (8). Culture-independent techniques derived from studies of other environments were therefore adapted to (i) extract total nucleic acids (6), (ii) quantify rRNAs with phylogenetic probes targeting food-related organisms (7), and (iii) obtain a fingerprint of total species diversity by denaturing gradient gel electrophoresis (DGGE) (8). Due to the inherent biases of both culture-dependent and -independent methods, it is very important to combine several methods to obtain the most realistic view of the structure of the microbial communities studied.

In this work, we applied this polyphasic approach of microbial ecology to study the dynamics of the microbial community responsible for the fermentation of maize dough during the production of pozol. The stratification of microorganisms within a ball of pozol has already been demonstrated (8); in this study the dynamics of the microbial community was monitored both in space and in time.

MATERIALS AND METHODS

Pozol sampling.

Freshly prepared pozol balls wrapped in banana leaves were bought at Atasta market (Villahermosa, México) and incubated at 30°C. Sampling was performed at 0, 4, 24, 48, 72, and 96 h. Each ball weighed between 200 and 300 g. Two approximately 50-g samples were taken from each ball (periphery and center; see reference 8 for details), aseptically diluted 10-fold in sterile 0.9% NaCl, and blended with a Waring blender. Each sample was immediately subsampled in identical portions for further analysis. The portions used for microbial enumeration and pH determination were immediately processed. For high-pressure liquid chromatography (HPLC) analysis, 0.2 ml of 2 N H2SO4 was added to 1.3-ml portions, tubes were centrifuged for 10 min at 10,000 × g, and supernatants were analyzed as described below. The portions used for RNA and DNA extraction were frozen (−20°C) until they were analyzed.

Enumeration of microorganisms.

Serial dilutions of blended pozol samples in 0.9% NaCl were used for microbial enumerations with the following media: plate count agar (PCA) (Difco) for estimation of total aerobic mesophilic bacteria; MRS-glucose (Difco) for LAB (12); MRS-starch (containing 2% soluble starch [Prolabo, Paris, France] instead of glucose) for amylolytic LAB (18); EPS (10 g of tryptone per liter, 5 g of yeast extract per liter, 100 g of sucrose per liter, 1 g of sodium citrate per liter, 5 g of glucose per liter, 2.5 g of gelatin per liter, 15 g of agar 15 per liter) for exopolysaccharide-producing strains (17); violet red bile glucose (VRBG) (Difco) for enterobacteria (28); and potato dextrose agar (Merck) containing 14 mg of tartaric acid per liter, 50 mg of chloramphenicol per liter, and 50 mg of rose bengal per liter for yeasts and other fungi.

All enumerations were done by plate counting. Portions (0.1 ml) of appropriate dilutions were spread plated in triplicate. LAB and amylolytic LAB were plated with an overlay of the same medium. Counts were obtained after 48 h and 5 days of incubation at 30°C. Results were calculated as the means of three determinations.

Analysis of sugars and fermentation products.

The concentrations of soluble starch, sugars, ethanol, and organic acids were assayed by HPLC as previously described (8).

Preparation of rRNA standards from pure cultures.

Several rRNA standards were prepared by extracting RNA from laboratory cultures of the following strains: Escherichia coli JM109, Lactococcus lactis subsp. lactis ATCC 11454T, Lactobacillus plantarum DSM20174T, Leuconostoc mesenteroides ATCC 10832, Lactobacillus fermentum ATCC 14931T, and Bifidobacterium minimum ATCC 15707T. All strains were grown in appropriate rich media, and total RNA was extracted from exponentially grown cells as previously described (6).

RNA and DNA isolation from pozol.

Total RNA was extracted from pozol by a previously described method adapted to samples with a high starch content, including pozol (6), and total DNA was isolated from pozol as previously described (8).

Hybridization probes.

The oligonucleotide probes used are described in Table 1. All of the probes used target the small subunit (SSU) of rRNA, and the temperatures used for the stringent washes are indicated in Table 1. The specificity of the probes was checked with the PROBE_MATCH command of a recent release of the Ribosomal Database Project (RDP) (27) (last verification, September 1999). Synthetic HPLC-purified oligonucleotides (Eurogentec, Seraing, Belgium) were 3′ end labeled with digoxigenin by following the instructions of the manufacturer (Boehringer Mannheim).

TABLE 1.

16S rRNA-targeted oligonucleotide probes and PCR primers used in this study

Short name Target taxon(a) Sequence (5′-3′) Positiona OPD full nameb Wash temp (°C)c Reference
Univ1390 Universal GAC GGG CGG TGT GTA CAA 1407–1390 S-*-Univ-1390-a-A-18 44 55
Entero Enterobacteria CTT TTG CAR CCC ACT 1432–1418 not available 44 31
Lacb0722 All LAB YCA CCG CTA CAC ATG RAG TTC CAC T 746–722 S-*-Lab-0722-a-A-25 54 42
Strc493 Streptococcus, Lactococcus, some Leuconostoc GTT AGC CGT CCC TTT CTG G 511–493 S-*-Strc-0493-a-A-19 50 16
212RLa Lactococcus CTT TGA GTG ATG CAA TTG CAT C 233–212 S-S-L.lac-0212-a-A-22 46 38
Lab158 Lactobacillus, Enterococcus, Pediococcus, Leuconostoc, Weissella GGT ATT AGC AYC TGT TTC CA 177–158 S-G-Lab-0158-a-A-20 45 7 
LU2 Leuconostoc GAT CCA TCT CTA GGT GAC GCC G 242–220 not available 46 32
Lbfe L. fermentum GCG ACC AAA ATC AAT CAG G 90–72 S-S-Lb.ferm-0072-a-A-19 50 40
Lbpe L. plantarum TCA AAT GTA AAT CAT GAT G 90–72 S-S-Lb.plan-0072-a-A-19 38 40
lm3 Bifidobacterium CGG GTG CTI CCC ACT TTC ATG 1432–1412 S-G-Bif-1412-a-A-21 49.5 24
Euk1427fd NAe TCT GTG ATG CCC TTA GAT GTT CTG GG 1453–1427 NA NA 48
Euk1616r NA GCG GTG TGT ACA AAG GGC AGG G 1616–1637 NA NA 48
338fd NA ACT CCT ACG GGA GGC AGC AG 357–338 NA NA 25
518r NA ATT ACC GCG GCT GCT GG 534–518 NA NA 30
a

E. coli numbering, except for Euk1427f and Euk1616r (Saccharomyces cerevisiae numbering). 

b

OPD, Oligonucleotide Probe Database (4). 

c

Wash temperature in 1× SSC–1% sodium dodecyl sulfate (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). 

d

A GC clamp was attached to the 5′ ends of the 338f and Euk1427f primers to obtain primers gc338f and gcEuk1427f (GC clamp: 5′CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG) (30). 

e

NA, not applicable. 

rRNA quantitative hybridization.

RNA quantitative hybridization was performed as described before (7, 45). The abundance of microorganisms is expressed as the fraction of the total rRNA in the sample (RNA indices). The lower limit for detecting a unique rRNA SSU in the 2 μg of nucleic acid spotted on the membrane was between 2 and 10 ng of SSU-like rRNA.

PCR-DGGE.

Amplification of total pozol DNA was performed with a Perkin-Elmer model 9400 thermal cycler. The bacterial community DNA was amplified with primers gc338f and 518r spanning the V3 region of the 16S ribosomal DNA (rDNA) (Table 1) (34) as previously described (8). The eukaryotic community DNA was amplified with primers gcEuk1427f and Euk1616r spanning the 1427–1637 region of the 18S rDNA (48). Each mixture contained 1 μl of template DNA, each primer at a concentration of 0.5 μM, each deoxynucleoside triphosphate at a concentration of 200 μM, 1.5 mM MgCl2, 2.5 μl of 10× PCR buffer, 8 mg of bovine serum albumin per liter, and 1.25 U of Taq polymerase (Eurogentec) in a final volume of 25 μl. Template DNA was denatured for 5 min at 94°C. Twenty-five cycles of denaturation (1 min at 94°C), annealing (1 min at 52°C), and extension (1 min at 72°C) were performed. The tubes were then incubated for 10 min at 72°C (final extension).

Aliquots (2 μl) of the amplification products were analyzed first by electrophoresis in agarose gels. The PCR products were then analyzed by DGGE by using gels containing a 25 to 50% urea-formamide gradient (100% corresponded to 7 M urea and 40% [vol/vol] formamide) as described elsewhere (8).

Analysis of the DGGE patterns.

Scanned gels were analyzed with the QuantityOne software package (Bio-Rad, Richmond, Calif.) by using the strategy proposed by Eichner et al. (13). The patterns were analyzed in two ways, as follows.

(i) After bands were assigned to the gel tracks and the corresponding bands in independent tracks were matched, Dice's coefficients of similarity [SD = (2nAB)/(nA + nB), where nA and nB are the total numbers of bands in tracks A and B, respectively, and nAB is the number of bands common to tracks A and B] and the clustering algorithm of Ward (53) were used to calculate dendrograms.

(ii) Two parameters were used to assess the structural diversity and the concentration dominance in the microbial community studied. After bands were assigned to the gel tracks, the Shannon-Weaver index of general diversity (H′) (43) was calculated with the following equation: H′ = −ΣPi · log2Pi, where Pi is the importance probability of the bands in a track. H′ was calculated on the basis of the bands in the gel tracks by using the intensities of the bands as judged by peak heights in the densitometric curves. Pi was calculated as follows: Pi = ni/N, where ni is the height of a peak and N is the sum of all peak heights in the densitometric curve.

Using the same data, the Simpson index of dominance concentration (D) (44) was calculated by using the following function: D = ΣPi2.

The bands corresponding to DNA amplified from maize chloroplasts, mitochondria, or nuclei were not included in the analyses. The results given below are the means of two independent determinations performed after independent DNA extractions, PCR amplifications, and DGGE separations.

Sequencing of DGGE fragments.

DGGE fragments were excised with a sterile scalpel. The DNA of each fragment was rapidly rinsed with 100 μl of sterile water and eluted in 20 μl of sterile water overnight at 4°C. One microliter of the eluted DNA of each DGGE band was reamplified by using the conditions described above. The success of this procedure was checked by electrophoresing 3-μl portions of the PCR products in DGGE gels as described above with pozol amplified DNA as a control. PCR products which yielded a single band that comigrated with the original band were then purified and sequenced.

Sequences of these gene fragments were determined by the dideoxy chain termination method with an ABI PRISM dye terminator kit (Perkin-Elmer) using primer gc338f.

Analysis of the sequence data.

To determine the closest known relatives of the partial 16S rDNA sequences obtained, searches were performed in public data libraries (RDP and GenBank) with the BLAST and RDP programs (27). The CHECK_CHIMERA command of the RDP was used to try to detect chimeric sequences.

Nucleotide sequence accession numbers.

The GenBank accession numbers for 16S rDNA partial sequences retrieved from DGGE bands are given in Table 2.

TABLE 2.

Identities of bands obtained from DGGE analysis of the bacterial community

Banda Closest relative % Identityb Accession no.
1 Zea mays mitochondria 100 AF175745
3 Exiguobacterium aurantiacum 99.4 AF175746
5 Lactobacillus casei 100 AF175747
6 Bifidobacterium minimum 93.7 AF175748
7 Sphingomonas sp. 97.9 AF175749
8 Oxalophagus oxalicus 93.7 AF175750
10 Exiguobacterium acetylicum 99.3 AF175751
11 Zea mays chloroplast 98.5 AF175752
12 Streptococcus bovis 100 AF175753
13 Lactobacillus delbrueckii 99.3 AF175754
15 Enterococcus saccharolyticus 100 AF175755
16 Lactobacillus fermentum 100 AF175756
17 Lactobacillus plantarum 99.3 AF175757
a

Bands were extracted from the DGGE gel shown in Fig. 2. We were not able to obtain sequences from bands 2, 4, 9, 14, and 11. 

b

Percentage of identical nucleotides in the sequence retrieved from the DGGE gel and the sequence of the closest relative found in the GenBank and RDP databases. 

RESULTS

The dynamics of the microbial community of pozol balls from Villahermosa (Tabasco, México) was monitored during a 4-day fermentation by (i) microbial enumeration with culture media, (ii) DGGE fingerprinting of total community DNA with bacterial and eukaryotic primers and identification of the bands by sequencing, (iii) quantification of rRNAs from microbial taxa using phylogenetic oligonucleotide probes, and (iv) analysis of sugars and fermentation products.

Enumeration and isolation of microorganisms.

The total microflora and specific groups of organisms were enumerated by using six different culture media (Fig. 1). The total microflora concentration was high (approximately 109 to 1010 CFU · g−1 on PCA) and increased during fermentation, and the counts were consistently five times higher at the periphery than in the center of the pozol balls. The counts on MRS-glucose and MRS-starch were close to those on PCA. The number of exopolysaccharide producers increased during the first day of fermentation from 107 to 108 CFU · g−1. This increase continued at the periphery and a concentration of 109 CFU · g−1 was reached while the numbers decreased to undetectable levels in the centers of the balls after 3 days of fermentation. A similar trend was observed for counts on VRBG medium representing the enterobacteria: up to 108 CFU · g−1 was present after 4 days of fermentation at the periphery of a ball, but in the center the number of cells decreased to 104 CFU · g−1 after 4 days of fermentation. The number of yeasts and fungi increased with fermentation time. Yeasts reached their maximum concentration (108 CFU · g−1) at the periphery at 24 h but the concentration continued to increase in the center after 4 days of incubation. Fungi reached their maximum concentration (108 CFU · g−1) at 48 h at the periphery but were not detected before 72 h in the center. These changes in microbial counts were accompanied by a decrease in pH. This decrease was more rapid in the center than at the periphery. The final pH at the center of the ball was around 3.8; at the periphery the pH remained above 4 and a slight increase in pH was observed between 72 and 96 h.

FIG. 1.

FIG. 1

Evolution of microorganisms in a pozol ball as estimated by plate counting using culture media. Results are the means of three repetitions (triplicate plating). Error bars are not shown to facilitate reading of the results. Symbols: ○, periphery; ●, center. EPS, exopolysaccharide.

Community fingerprinting by DGGE.

In addition to enumeration on culture media, the microbial population dynamics was monitored by DGGE. Two independent extractions of total DNA from each pozol sample were performed. One-microliter portions of 10−2 and 10−1 dilutions and undiluted total DNA were subjected to amplification, and the equal-size 16S rDNA PCR products were analyzed by DGGE. Repeated extractions as well as dilutions of a given sample gave identical fingerprints (data not shown).

(i) Bacterial community.

The fingerprints of the bacterial community obtained contained up to 18 visible bands (Fig. 2). The number of visible bands increased with fermentation time and there was a major shift between 24 and 72 h, but only minor differences were observed between samples taken at the same time at the periphery or in the center of the ball.

FIG. 2.

FIG. 2

DGGE analysis of PCR-amplified 16S rDNA fragments from pozol bacterial communities. DNA was derived from two concentric fractions from the same balls of pozol. The positions and numbers of bands discussed in the text are indicated.

The bands of the DGGE profiles of pozol total DNA were excised from the acrylamide gel and reamplified with primers gc338f and 518r (Fig. 2 shows the original gel from which the bands were excised together with band numbers). Before being sequenced, each PCR-reamplified DGGE band was run on a denaturing gradient gel to confirm its position relative to that in the original pozol sample. All of the sequences retrieved corresponded to portions of 16S rDNA genes (Table 2). The majority of the DGGE bands corresponded to LAB, and the most intense band (band 12) corresponded to a Streptococcus species (Streptococcus bovis was the closest relative found by sequence comparison) present throughout the fermentation and throughout the pozol ball. Other LAB partial rDNA sequences corresponded to close relatives of Lactobacillus casei, Lactobacillus delbrueckii, L. fermentum, L. plantarum, Enterococcus saccharolyticus, and B. minimum (bands 5, 13, 16, 17, 15, and 6, respectively). Other non-LAB microorganisms identified were relatives of the aerobic bacterial genera Exiguobacterium (Exiguobacterium aurantiacum and Exiguobacterium acetylicum; bands 3 and 10) and Oxalophagus (band 8). Also, two bands corresponding to DNA from maize (mitochondria and chloroplasts; bands 1 and 11) were identified. These two bands were not included in the profile analysis described below. None of the sequences determined was found to have a chimeric nature. We were not able to purify very faint bands 2, 4, 9, 14, and 18. Bands corresponding to S. bovis and E. saccharolyticus were found at all fermentation times and both in the centers and at the peripheries of the pozol balls. Other bands, present at the onset of fermentation, disappeared after 24 or 48 h; these included bands 3, 8, and 10 corresponding to gram-positive strict aerobes. Finally, some bands that were not detected at the onset of fermentation were found after 24 h (band 16 corresponding to L. fermentum) or 48 to 72 h (bands 5, 13, and 17 corresponding to L. casei, L. delbrueckii, and L. plantarum, respectively).

The partial 16S rDNA sequences from DGGE bands or strains isolated from pozol in two independent studies (8; this work) were compared with those of reference organisms (Fig. 3). The results show that the vast majority of the sequences (20 out of 24 sequences) were sequences of low-G+C-content gram-positive bacteria, including LAB and strict aerobes, and that three sequences belonged to high-G+C-content gram-positive bacteria.

FIG. 3.

FIG. 3

Relationships of partial 16S rDNA sequences derived from pozol DGGE bands or organisms isolated from pozol to those of reference organisms obtained from GenBank. Sequences from this study (bands B1 to B17) and from a previous study (bands A1 to A6, strains LEU and MRS) (8) are included. A neighbor-joining analysis with bootstrap (1,000 samples) was performed by using the ClustalX and NJPlot programs. Zea mays chloroplast and related sequences were chosen as an outgroup. Bootstrap values are given at nodes when they exceed 50%. The scale bar represents an estimated 5% difference in nucleotide sequence.

(ii) Eukaryotic community.

The fingerprints of the eukaryotic community were radically different from those obtained with bacterial primers. Only two intense bands were observed in samples taken at 0, 4, and 24 h (Fig. 4). After this, up to 20 faint bands appeared progressively for the periphery, but the number of bands obtained for the center remained very low. The most intense bands observed (arrows, Fig. 4) in all samples corresponded to nuclear DNA from maize, as shown by comigration with maize DNA standards (data not shown), and were not included in the analyses described below.

FIG. 4.

FIG. 4

DGGE analysis of PCR-amplified 16S rDNA fragments from pozol eukaryotic communities. DNA was derived from two concentric fractions from the same balls of pozol. The position of maize nuclear DNA is indicated.

(iii) Analysis of similarity.

The similarity between the DGGE patterns of the bacterial community was then evaluated by using the clustering algorithm of Ward (Fig. 5). From 0 to 24 h, all of the DGGE patterns (centers and peripheries of the balls) belonged to a single cluster. A major shift occurred after 24 h: the DGGE patterns for 48 to 96 h belonged to a second cluster clearly separated from profiles obtained during the earlier stages of fermentation. In this second cluster, a subcluster consisting of the patterns from the centers of the balls could also be identified.

FIG. 5.

FIG. 5

Dendrogram derived from DGGE analysis of the bacterial community (Fig. 4) on the basis of the Dice's coefficient of similarity with the clustering algorithm of Ward.

(iv) Biodiversity and dominance indices.

The analysis of DGGE patterns was completed by estimation of the biodiversity and dominance indices derived from the work of Shannon and Weaver (43) and the work of Simpson (44), respectively. The bacterial biodiversity indices (H′) were similar for the samples taken at the peripheries and in the centers of the pozol balls (Fig. 6). Interestingly, these indices increased after 24 h of fermentation. Conversely, the dominance indices for bacteria remained constant and low throughout the process. The indices obtained from the analysis of the eukaryotic community were radically different. The Shannon-Weaver index of biodiversity was initially very low, and it constantly increased at the periphery of a ball and reached its maximum value after 72 h of fermentation. Inside the ball, this index remained very low and started to increase only after 72 h of fermentation. A similar situation was observed for the concentration dominance index: this index was very high at the onset of the fermentation, but it rapidly decreased at the periphery and reached a minimum value close to that obtained for the bacterial community at 48 h. In the center, high dominance index values were measured throughout the process, although the values decreased slightly during the last 2 days of fermentation.

FIG. 6.

FIG. 6

Shannon-Weaver index of diversity (H′) and Simpson index of dominance (D) calculated from two independent DGGE analyses of the bacterial community and two independent DGGE analyses of the eukaryotic community (examples of denaturing gels are given in Fig. 2 and 4). Symbols: ○, periphery; ●, center.

Quantification of 16S rRNA with phylogenetic probes.

To quantify the apparently dominant taxa, total RNA was extracted directly from the same pozol samples and hybridized with previously described 16S rRNA-targeted oligonucleotide probes (Table 1; Fig. 7). rRNA indices obtained with the Lacb0722 probe targeting all LAB show that this taxon accounted for the majority of the active microorganisms in pozol. At the onset of the fermentation, LAB accounted for around 75% of the total active flora. In the center of a ball, this proportion rapidly reached values over 90%; at the periphery, the relative importance of LAB was somewhat less, although this taxon always accounted for more than 70% of the total active flora. Group-specific probes (Lab158 and Strc493), genus-specific probes (LU2, 212R1a, and lm3), and species-specific probes (Lbpe and Lbfe) were then used to study the LAB microbial assemblage. Probe Lab158 targets the genera Lactobacillus, Enterococcus, Pediococcus, Leuconostoc, and Weissella (7; G. W. Welling, personal communication), and probe Strc493 targets the genera Streptococcus and Lactococcus plus some members of the genera Leuconostoc and Weissella (16). rRNA indices obtained with probe Lab158 were low at the onset of fermentation (5 to 10% of the total active flora) but increased during fermentation and reached 25% of the total active flora in the center of a ball. It seems that this increase was more rapid at the center than at the periphery, where the highest counts were measured at the end of the process.

FIG. 7.

FIG. 7

Quantification of rRNA with phylogenetic oligonucleotide probes. Results are given as percentages of the total rRNA quantified with universal probe Univ1390. Results are the means of three to five repetitions. Error bars are not shown to facilitate reading of the results. Symbols: ○, periphery; ●, center. Lb+Ln+Pc+W+Ec, Lactobacillus plus Leuconostoc plus Pediococcus plus Weissella plus Enterococcus.

The proportion of the genera targeted by probe Strc493 increased throughout the fermentation process, and these organisms accounted for around 75% of the active flora at the end of the process. Two other probes targeting subgroups of LAB were also used. Quantification with probe LU2 showed that the genus Leuconostoc accounted for less than 2% of the active flora at the onset of fermentation; this proportion then increased to 4 to 7% at 24 to 48 h before decreasing during the last 2 days. The genus Lactococcus (probe 212R1a) accounted for less than 5% of the active microflora in all of the samples tested. As the index values obtained with probes targeting the genera Lactococcus and Leuconostoc were low, the high values obtained with probe Strc493 were mainly due to the presence of members of the genus Streptococcus. In addition, this probe targets the region amplified for DGGE analysis, and the sequences retrieved after the DGGE analysis (Table 2) can be compared with that of probe Strc493. The sequence from band B12 (whose closest relative is S. bovis) showed a complete match with the probe, whereas all other sequences exhibited at least two mismatches with Strc493. Therefore, it can be assumed that the signal obtained with this probe represents the proportion of the Streptococcus species corresponding to band B12, and indeed the high signal value obtained with rRNA hybridization is in good agreement with the very intense bands obtained during the DGGE analysis, which makes this the dominant species throughout fermentation of pozol.

The species L. fermentum and L. plantarum were quantified with two phylogenetic probes reported by Schleifer et al. (40). The specificity of the oligonucleotide probes designated for quantification of these two species was first evaluated with both the CHECK_PROBE command of the RDP program (27) and slot blot hybridization experiments. Cross-reactions were not observed with members of other species of LAB (data not shown). The signal value obtained with probe Lbfe targeting L. fermentum was below the detection level (<0.2%) at the onset of fermentation. It then increased to a maximum of 10% (center) to 15% (periphery) of the total flora after 48 h of fermentation before decreasing again to 5 to 7% at the end of the process. L. plantarum rRNA was not detected in the first 48 h of fermentation. At 48 h, this species accounted for 4 to 6% of the total microflora, and this proportion steadily increased to 8 to 15% of the active population at the end of the process. Other LAB species could not be quantified by the same strategy because specific probes are not available (in particular, there is no probe for E. saccharolyticus, which may be an important species in the fermentation according to the DGGE analysis).

The presence of a Bifidobacterium species revealed by sequencing band B6 (Table 2) was confirmed by quantitative hybridization of rRNAs by using probe lm3. This genus was not detected at the onset of fermentation (rRNA index, <0.05%); rRNA from bifidobacteria was detected at 48 h and the final proportion was 6.5% at the periphery of a ball. In the center, bifidobacteria could be detected from 48 h to the end of fermentation, but their relative importance remained very low (0.08 to 0.14%).

Finally, quantification of enterobacterial rRNAs revealed that this group could account for a significant percentage of the total flora of pozol, although the number of enterobacteria decreased by the end of the fermentation.

Sugars and fermentation products.

To assess the overall metabolic activity in pozol, free sugars, soluble starch, and fermentation products were assayed. The only free sugars identified were maltose and glucose (in particular, no fructose or sucrose was found), but the concentrations were very low (always less than 1 μmol · g−1 [Fig. 8]) Conversely, large amounts of soluble starch were found throughout the process. Lactate, ethanol, and formate were the only fermentation products identified. The concentration of lactate increased throughout fermentation and reached high final values (150 to 200 μmol · g−1) close to those previously reported for lactic acid fermentations of maize and cassava (8, 10). High concentrations were reached more rapidly in the center, although a higher final concentration was observed at the periphery. Large amounts of ethanol were also produced between 24 and 48 h in the center of a pozol ball. At the periphery, ethanol was produced only after 48 h. Finally, significant amounts of formate were found throughout the fermentation, although no obvious pattern for its production could be identified.

FIG. 8.

FIG. 8

Sugar and fermentation product concentrations. The results are given in micromoles per gram (wet weight) except for soluble starch (milligrams per gram [wet weight]). Symbols: ○, periphery; ●, center.

DISCUSSION

A polyphasic approach was used to monitor the dynamics of the microbial community during fermentation of maize dough to produce pozol. Together, the results obtained indicate a three-stage process. The first stage started with a large initial flora, most probably a consequence of natural inoculation of maize dough during grinding (50). This initial flora contained at least two streptococci, members of the genera Streptococcus and Enterococcus, which accounted for a high proportion of the microflora throughout the process, and strict aerobes, including Exiguobacterium species. The latter organisms were present in pozol during the first days of fermentation, most probably consuming the available oxygen, but then declined to undetected levels. During the second stage (24 to 48 h), heterofermentative LAB, including Leuconostoc species and L. fermentum, developed and reached a maximum level at 48 h. The importance of these heterofermentative organisms was shown by the production of high levels of ethanol, the concentration of which was close to that of lactate. The importance of L. fermentum in fermentation of pozol and more generally in maize has been confirmed by previous observations of different products. A very high number of L. fermentum strains were isolated from maize dough in Ghana (21) and also from mawè and ogi in Bénin (2) and pozol in México (8). The strains from Bénin and México were found to have high amylolytic capabilities, strongly suggesting that L. fermentum may be a key organism for fermentation of maize, making the large amounts of starch available to the overall community. This suggestion is supported by the high number of amylolytic LAB found during pozol fermentation (this work). Interestingly, the development of L. fermentum in pozol (as shown both by DGGE analysis and by rRNA quantification) coincided with the shift in the microbial community structure observed between 24 and 48 h as revealed by the clustering analysis with the DGGE profiles. In addition, the production of lactic acid by the heterofermentative LAB resulted in a decrease in the pH (to around 4.2, corresponding to final pH obtained for pure cultures of amylolytic L. fermentum strains [2]), which was most probably responsible for the development of yeast and fungi at the periphery of a ball. Finally, according to enumeration on VRBG medium, the number of enterobacteria present at the onset of fermentation decreased within a ball, whereas the number increased at the periphery. The final stage (48 to 96 h) of fermentation was characterized by a decrease in the concentration of heterofermentative LAB and the development of homofermentative LAB (close relatives of L. plantarum, L. casei, and L. delbrueckii) and a Bifidobacterium species, none of which were detected at the earlier stages of the process. This development coincided with a further decrease in pH, particularly in the center of a ball. The acid-resistant homofermentative LAB were able to develop while the concentration of lactic acid was high and the pH was close to or below 4, and they continued the acidification process, as previously found for fermentation of cassava (10) and other nondairy lactic acid fermentations, such as cucumber (36) and sauerkraut (11) fermentations. Finally, the development of Bifidobacterium, together with the production of ethanol (and not acetate) by heterolactic LAB (1), strongly suggests that anaerobic conditions prevail in pozol.

As previously shown, the composition of the microbial community within a pozol ball varies. Thus, the populations of yeasts, and fungi, exopolysaccharide producers, bifidobacteria, and enterobacteria tended to develop more at the periphery than in the center. Surprisingly, strict anaerobes (bifidobacteria) and strict aerobes (fungi) coexisted at the periphery of a ball, where oxygen from the air should have been available; the very dense microorganisms most probably rapidly used this oxygen in such a way that the apparent concentration of oxygen was zero. Such a phenomenon has been observed in anaerobic digesters in which strict aerobes have been found (H. Macarie, personal communication). Conversely, the very low number of bifidobacteria in a pozol ball suggests that nutrients required for growth of these organisms are not available in the ball, whereas they may be produced by organisms present only at the periphery, such as fungi. The presence of several unidentified peaks in the HPLC analysis (data not shown) and the nutritional requirements of well-studied bifidobacteria (9) are in agreement with this hypothesis. Also, the yeasts developing mainly at the peripheries of pozol balls tend to limit the decrease in pH through the consumption of lactic acid (8, 33), another phenomenon that would help the development of bifidobacteria otherwise affected by low pH. Other organisms, such as L. plantarum and L. fermentum, were distributed equally in the pozol balls.

One of the advantages of DGGE fingerprinting is that it allows comparison of total bacterial communities of different samples through pattern analysis. The clustering analysis performed here demonstrated that the major shift during fermentation of maize took place between 24 and 48 h: from 0 to 24 h, all patterns belonged to a single cluster. After 48 h (i.e., from 48 to 96 h), the patterns were significantly different, and samples from the center of the periphery of a ball could be clearly identified, implying that the position in the pozol ball clearly influenced the development of bacterial groups. In addition, our results demonstrate that the number of dominating microorganism species is not limited to two or three: at least six to eight bacterial species plus some yeasts and fungi dominate the process. If a dominating flora had been present, the Simpson dominance index would have increased, which was not the case. Unlike the generally accepted idea that a few species are selected and rapidly dominate traditional fermentations (see, for example, references 20 and 22), the analysis of biodiversity in ecological terms with the Shannon-Weaver index showed that there was an increase in biodiversity. One of the hypotheses to explain this increase in biodiversity involves the availability of the carbon and/or energy source. Free sugars were found only in trace amounts in pozol due to the repeated washes of maize grains and dough prior to fermentation (8, 51; this work). Therefore, starch appears to be an important carbon and energy source. In the first stages of fermentation, only a few organisms were capable of using this starch. However, while developing, the amylolytic LAB released amylases that degraded starch into dextrins and maltose, thus making it available for a larger number of strains, including nonamylolytic strains. In addition, the fermentation products (lactate, formate, and ethanol) may also serve as carbon sources for some organisms, such as yeasts, that were previously shown to grow with lactate (8, 33). Such an increase in biodiversity has been observed previously in other ecological systems. For example, Roger et al. (37) found that the diversity of arthropods during crop cycles in rice fields increased with time after transplanting and that there was not drastic selection. We believe that this observation is crucial if one is to develop a microbial starter that mimics the traditional fermentation in order to standardize the process, as is often claimed (39). One to three species are definitively not the only dominating species of a fermented food, at least in the case of pozol, and complex starters such as that proposed for the fermentation of cocoa (41) should be designed in order to produce a final product with all the desired organoleptic qualities.

Interestingly, at least two sequences could not be associated with a known genus, and several sequences differed significantly from the closest reference 16S rDNA sequence. Although not based on complete 16S rDNA sequences, this observation strongly suggests that pozol may be an unexplored reservoir of unknown bacterial species.

Moreover, the sequences obtained in two independent studies exhibit a very high number of similarities: quasi-identical sequences were found, for example, for bands A6 and B12, bands A3 and B5, or bands A3 and B2. The DGGE profiles obtained in the two studies were also very similar (data not shown), and close relatives of L. plantarum, L. fermentum, L. casei, S. bovis, B. minimum, or E. aurantiacum were repeatedly found. This observation strongly suggests that these particular species all play a specific role and that a typical microflora responsible for fermentation of pozol may exist, although the variability should be investigated on a larger scale.

The limitation of cultivation methods for studying the ecology of microorganisms has been widely discussed already (5), including in the case of fermented foods (8). Culture-independent methods that rely on analysis of rRNA (or the corresponding rDNA) have been shown to improve significantly knowledge concerning the ecology of microorganisms both through the study of biodiversity and identification of microbial species and through the quantification of the dominant phylogenetic groups. Despite the advantages provided by the alternative cultivation-independent methods, these methods also have their inherent biases (3, 46, 49), as discussed previously (8). In this work, we combined two molecular methods, DGGE and rRNA quantification, to fulfill two requirements: getting an overview of species diversity, at least as far as dominant organisms are concerned, was the objective of DGGE community fingerprinting, while quantification of rRNAs with phylogenetic probes provided numerical data on community structure. A recent study proposed to group both objectives in a single experiment: Felske et al. (14) quantified microbial taxa using multiple quantitative reverse transcription-PCR temperature gradient gel electrophoresis and found that visible bands in gradient electrophoresis fingerprints of soil samples may account for 50% of the total microflora, with the other half composed of minor species that account for less than 1% each. To check the validity of such a combined approach, we used the data obtained in this work and compared quantification with four rRNA probes with the relative intensities of the four corresponding DGGE bands. Because no internal standard was added in our PCR experiments, only relative intensities—and not absolute amounts of DNA—could be compared with RNA indices. The relative intensities of bands B6, B12, B16, and B17 were compared with the RNA indices obtained with probes lm3 (Bifidobacterium), Strc493 (Streptococcus), Lbfe (L. fermentum), and Lbpe (L. plantarum), respectively (Fig. 9). Quite a good correlation was obtained for quantification of L. plantarum and Bifidobacterium, suggesting that the PCR step prior to DGGE analysis was not selective, at least in the case of these two organisms. However, the detection limit with DGGE was around 1 to 3%, whereas the detection limit decreased to around 0.1% when rRNA hybridizations were used. This detection limit can be compared with those of ideally unbiased culture techniques: to quantify a microbial taxon accounting for 0.1% of total flora with a precision of ±25% (with α = 0.05), one should isolate and identify 61,404 strains, clearly demonstrating the advantage of using rRNA quantification. Besides, DGGE analysis tended to overestimate the proportion of L. fermentum by 2 to 5 orders of magnitude compared with rRNA quantification, and no real coherence was found for quantification of Streptococcus. This discrepancy could be due to comigration of different bands to the same DGGE position, as previously observed in a study of bacterioplankton (29). Therefore, although band intensities in DGGE patterns may sometimes lead to correct estimation of the relative importance of a species, the use of phylogenetic probes (through rRNA quantification or in situ whole-cell hybridization [5, 45]) remains indispensable for quantifying the dominating taxa in an environmental sample. However, there is a clear need for development and extended validation of phylogenetic probes to describe in more detail the structure of microbial communities, especially LAB communities.

FIG. 9.

FIG. 9

Comparison of quantification of four organisms during fermentation of pozol as determined by using either the relative intensities of DGGE bands (○) or the relative amounts of 16S rRNAs determined with phylogenetic oligonucleotide probes (●).

The presence of large amounts of enterobacteria was shown both by enumeration on VRBG medium and by quantification of rRNA with the Entero probe. Their presence, despite the high lactic acid concentrations, may have been due to the existence of microenvironments or to the resistance of some strains to acid pH, as demonstrated by Wacher et al. (50). In addition, two of the sequences identified may correspond to typical human fecal microorganisms (Bifidobacterium and Enterococcus), highlighting the need to improve the sanitary conditions of pozol making (15).

ACKNOWLEDGMENTS

N. ben Omar was supported by a Grant del Plan Proprio from the University of Granada.

We thank Carmen Wacher for the pozol samples and Joël Doré for probe lm3.

REFERENCES

  • 1.Adler-Nissen J, Demain A L. Aeration-controlled formation of acetic acid in heterolactic fermentations. J Ind Microbiol. 1994;13:335–343. [Google Scholar]
  • 2.Agati V, Guyot J-P, Morlon-Guyot J, Talamond P, Hounhouigan J. Isolation and characterization of new amylolytic strains of Lactobacillus fermentum from fermented maize doughs (mawè and ogi) from Bénin. J Appl Microbiol. 1998;85:512–520. [Google Scholar]
  • 3.Akkermans A D L, Mirza M S, Harmsen H J M, Blok H J, Herron P R, Sessitsch A, Akkermans W M. Molecular ecology of microbes: a review of promises, pitfalls, and true progress. FEMS Microbiol Rev. 1994;15:185–194. [Google Scholar]
  • 4.Alm E W, Oerther D B, Larsen N, Stahl D A, Raskin L. The oligonucleotide probe database. Appl Environ Microbiol. 1996;62:299–306. doi: 10.1128/aem.62.10.3557-3559.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Amann R I, Ludwig W, Schleifer K-H. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev. 1995;59:143–169. doi: 10.1128/mr.59.1.143-169.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ampe F, ben Omar N, Guyot J-P. Recovery of total microbial RNA from lactic acid fermented foods with a high starch content. Lett Appl Microbiol. 1998;27:270–274. doi: 10.1046/j.1472-765x.1998.t01-7-00449.x. [DOI] [PubMed] [Google Scholar]
  • 7.Ampe F, ben Omar N, Guyot J-P. Culture-independent quantification of physiologically active microbial groups in mexican pozol, a lactic acid fermented dough, using rRNA-targeted oligonucleotide probes. J Appl Microbiol. 1999;87:131–140. doi: 10.1046/j.1365-2672.1999.00803.x. [DOI] [PubMed] [Google Scholar]
  • 8.Ampe F, ben Omar N, Moizan C, Wacher C, Guyot J-P. Polyphasic study of the spatial distribution of microorganisms in Mexican pozol, a fermented maize dough, demonstrates the need for cultivation-independent methods to investigate traditional fermentations. Appl Environ Microbiol. 1999;65:5464–5473. doi: 10.1128/aem.65.12.5464-5473.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Biavati B, Sgorbati B, Scardovi V. The genus Bifidobacterium. In: Balows A, et al., editors. The prokaryotes. 2nd ed. New York, N.Y: Springer-Verlag; 1992. pp. 816–833. [Google Scholar]
  • 10.Brauman A, Kéléké S, Malonga M, Miambi E, Ampe F. Microbiological characterization of cassava retting, a traditional lactic acid fermentation for foo-foo (cassava flour) production. Appl Environ Microbiol. 1996;62:2854–2858. doi: 10.1128/aem.62.8.2854-2858.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Daeschel M A, Anderson R E, Fleming H P. Microbial ecology of fermenting plant materials. FEMS Microbiol Rev. 1987;46:357–367. [Google Scholar]
  • 12.de Man J, Rogosa M, Sharpe M E. A medium for the cultivation of lactobacilli. J Appl Bacteriol. 1960;23:130–135. [Google Scholar]
  • 13.Eichner C A, Erb R W, Timmis K N, Wagner-Dobler I. Thermal gradient gel electrophoresis analysis of bioprotection from pollutant shocks in the activated sludge microbial community. Appl Environ Microbiol. 1999;65:102–109. doi: 10.1128/aem.65.1.102-109.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Felske A, Akkermans A D L, de Vos W M. Quantification of 16S rRNAs in complex bacterial communities by multiple competitive reverse transcription-PCR in temperature gradient gel electrophoresis fingerprints. Appl Environ Microbiol. 1998;64:4581–4587. doi: 10.1128/aem.64.11.4581-4587.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Food and Agriculture Organization. Workshop on fermentation as a household technology to improve food safety. FAO/WHO report. Pretoria, South Africa: Food and Agriculture Organization, World Health Organization; 1995. [Google Scholar]
  • 16.Franks A H, Harmsen H J M, Raangs G C, Jansen G J, Schut F, Welling G W. Variations of bacterial populations in human feces measured by fluorescent in situ hybridization with group-specific 16S rRNA-targeted oligonucleotide probes. Appl Environ Microbiol. 1998;64:3336–3345. doi: 10.1128/aem.64.9.3336-3345.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Garvie E I. The genus Leuconostoc and its nomenclature. J Dairy Res. 1960;27:283–292. [Google Scholar]
  • 18.Giraud E, Brauman A, Kéléké S, Lelong B, Raimbault M. Isolation and physiological study of an amylolytic strain of Lactobacillus plantarum. Appl Microbiol Biotechnol. 1991;36:379–383. [Google Scholar]
  • 19.Godon J-J, Zumstein E, Dabert P, Habouzit F, Moletta R. Molecular microbial diversity of an anaerobic digestor as determined by small-subunit rDNA sequence analysis. Appl Environ Microbiol. 1997;63:2802–2813. doi: 10.1128/aem.63.7.2802-2813.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Halm M, Osei-Yaw A, Hayford A, Kpodo K A, Amoa-Awua W K A. Experiences with the use of a starter culture in the fermentation of maize for 'kenkey' production in Ghana. World J Microbiol Biotechnol. 1996;12:531–536. doi: 10.1007/BF00419468. [DOI] [PubMed] [Google Scholar]
  • 21.Hayford A E, Petersen A, Vogensen F K, Jakobsen M. Use of conserved randomly amplified polymorphic DNA (RAPD) fragments and RAPD pattern for characterization of Lactobacillus fermentum in Ghanaian fermented maize dough. Appl Environ Microbiol. 1999;65:3213–3221. doi: 10.1128/aem.65.7.3213-3221.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hounhouigan D J, Nout M J R, Nago C M, Houben J H, Rombouts F M. Characterization and frequency distribution of species of lactic acid bacteria involved in the processing of mawè, a fermented maize dough from Bénin. Int J Food Microbiol. 1993;18:279–287. doi: 10.1016/0168-1605(93)90151-6. [DOI] [PubMed] [Google Scholar]
  • 23.Hugenholtz P, Goebbel B M, Pace N R. Impact of culture-independent studies on the emerging phylogenetic view of bacterial diversity. J Bacteriol. 1998;180:4765–4774. doi: 10.1128/jb.180.18.4765-4774.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kaufmann P, Pfefferkorn A, Teuber M, Meile L. Identification and quantification of Bifidobacterium species isolated from food with genus-specific rRNA-targeted probes by colony hybridization and PCR. Appl Environ Microbiol. 1997;63:1268–1273. doi: 10.1128/aem.63.4.1268-1273.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lane D J. 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M D, editors. Nucleic acid techniques in bacterial systematics. Chichester, England: Wiley; 1991. pp. 115–175. [Google Scholar]
  • 26.Lin C, Stahl D A. Taxon-specific probes for the cellulolytic genus Fibrobacter reveal abundant and novel equine-associated populations. Appl Environ Microbiol. 1995;61:1348–1351. doi: 10.1128/aem.61.4.1348-1351.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Maidak B L, Cole J R, Parker C T, Jr, Garrity G M, Larsen N, Li B, Lilburn T G, McCaughey M J, Olsen G J, Overbeek R, Pramanik S, Schmidt T M, Tiedje J M, Woese C R. A new version of the RDP (Ribosomal Database Project) Nucleic Acids Res. 1999;27:171–173. doi: 10.1093/nar/27.1.171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Mossel D A A, Mengerink W H J, Scholts H H A. Use of a modified MacConkey agar medium for selective growth and enumeration of all Enterobacteriaceae. J Bacteriol. 1962;84:381. doi: 10.1128/jb.84.2.381-381.1962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Murray A E, Hollibaugh J T, Orrego C. Phylogenetic compositions of bacterioplankton from two California estuaries compared by denaturing gradient gel electrophoresis. Appl Environ Microbiol. 1996;62:2676–2680. doi: 10.1128/aem.62.7.2676-2680.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Muyzer G, De Wall E C, Uitterlinden A G. Profiling of complex microbial populations by denaturing gradient gel electrophoresis of 16S ribosomal DNA fragments. Appl Environ Microbiol. 1993;59:695–700. doi: 10.1128/aem.59.3.695-700.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Nierzwicki-Bauer S A. In situ hybridization workshop—microbial diversity summer course. Woods Hole, Mass: Woods Hole Oceanographic Institution; 1994. [Google Scholar]
  • 32.Nissen H, Holck A, Dainty R H. Identification of Carnobacterium spp. and Leuconostoc spp. in meat by genus-specific 16S rRNA probes. Lett Appl Microbiol. 1994;19:165–168. doi: 10.1111/j.1472-765x.1994.tb00933.x. [DOI] [PubMed] [Google Scholar]
  • 33.Nuraida L, Wacher M C, Owens J D. Microbiology of pozol, a mexican fermented maize dough. World J Microbiol Biotechnol. 1995;11:567–571. doi: 10.1007/BF00286375. [DOI] [PubMed] [Google Scholar]
  • 34.Øvreas L, Forney L, Daae F L, Torsvik V. Distribution of bacterioplankton in meromictic Lake Sœlenvannet, as determined by denaturing gradient electrophoresis of PCR-amplified gene fragments coding for 16S rRNA. Appl Environ Microbiol. 1997;63:3367–3373. doi: 10.1128/aem.63.9.3367-3373.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Pace N R. A molecular view of microbial diversity and the biosphere. Science. 1997;276:734–740. doi: 10.1126/science.276.5313.734. [DOI] [PubMed] [Google Scholar]
  • 36.Pederson C S, Albury M N. The effect of pure culture inoculation on fermentation of cucumber. Food Technol. 1961;15:351–354. [Google Scholar]
  • 37.Roger P A, Heong K L, Teng P S. Biodiversity and sustainability of wetland rice production: role and potential of microorganisms and invertebrates. In: Hawsworth D L, editor. The biodiversity of microorganisms and invertebrates: its role in sustainable agriculture. London, United Kingdom: CAB International; 1991. pp. 117–136. [Google Scholar]
  • 38.Salama M, Sandine W, Giovannoni S. Development and application of oligonucleotide probes for identification of Lactococcus lactis subsp. cremoris. Appl Environ Microbiol. 1991;57:1313–1318. doi: 10.1128/aem.57.5.1313-1318.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Sanni A I. The need for process optimization of African fermented foods and beverages. Int J Food Microbiol. 1993;18:85–95. doi: 10.1016/0168-1605(93)90213-z. [DOI] [PubMed] [Google Scholar]
  • 40.Schleifer K-H, Ehrmann M, Beimfohr C, Brockmann E, Ludwig W, Amann R. Application of molecular methods for the classification and identification of lactic acid bacteria. Int Dairy J. 1995;5:1081–1094. [Google Scholar]
  • 41.Schwan R F. Cocoa fermentation conducted with a defined microbial cocktail inoculum. Appl Environ Microbiol. 1998;64:1477–1483. doi: 10.1128/aem.64.4.1477-1483.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Sghir A, Antonopoulos D, Mackie R I. Design and evaluation of a Lactobacillus group-specific ribosomal RNA-targeted hybridization probe and its application to the study of intestinal microecology in pigs. Syst Appl Microbiol. 1998;21:291–296. doi: 10.1016/S0723-2020(98)80036-2. [DOI] [PubMed] [Google Scholar]
  • 43.Shannon C, Weaver W. The mathematical theory of communication. 5th ed. Chicago, Ill: Urbana University of Illinois Press; 1963. [Google Scholar]
  • 44.Simpson E H. Measurement of diversity. Nature. 1949;163:688. [Google Scholar]
  • 45.Stahl D A, Flescher B, Mansfield H R, Montgomery L. Use of phylogenetically based hybridization probes for studies of ruminal microbial ecology. Appl Environ Microbiol. 1988;54:1079–1084. doi: 10.1128/aem.54.5.1079-1084.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Tanner M A, Goebbel B M, Dojka M A, Pace N. Specific ribosomal DNA sequences from diverse environmental settings correlate with experimental contaminants. Appl Environ Microbiol. 1998;64:3110–3113. doi: 10.1128/aem.64.8.3110-3113.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Ulloa M. Mycofloral succession in pozol from Tabasco, México. Bol Soc Mex Microbiol. 1974;8:17–48. [Google Scholar]
  • 48.van Hannen E J, Zwart G, van Agterveld P, Gons H J, Ebert J, Laanbroek H J. Changes in bacterial and eukaryotic community structure after mass lysis of filamentous cyanobacteria associated with viruses. Appl Environ Microbiol. 1999;65:795–801. doi: 10.1128/aem.65.2.795-801.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.von Wintzingerode F, Göbel U B, Stackebrandt E. Determination of microbial diversity in environmental samples: pitfalls of PCR-based rRNA analysis. FEMS Microbiol Rev. 1997;21:213–229. doi: 10.1111/j.1574-6976.1997.tb00351.x. [DOI] [PubMed] [Google Scholar]
  • 50.Wacher C, Canas A, Cook P E, Barzana E, Owens J D. Sources of microorganisms in pozol, a traditional mexican fermented maize dough. World J Microbiol Biotechnol. 1993;9:269–274. doi: 10.1007/BF00327853. [DOI] [PubMed] [Google Scholar]
  • 51.Wacher-Rodarte M C. Estudios sobre la microbiologia del pozol. Ph.D. thesis. México D. F., México: Universidad Nacional Autonoma de México; 1995. [Google Scholar]
  • 52.Ward D M, Ferris M J, Nold S C, Bateson M M. A natural view of microbial biodiversity within hot spring cyanobacterial mat communities. Microbiol Mol Biol Rev. 1998;62:1353–1367. doi: 10.1128/mmbr.62.4.1353-1370.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Ward J H. Hierarchical grouping to optimize an objective function. J Am Stat Assoc. 1963;58:236–244. [Google Scholar]
  • 54.Woese C R. Bacterial evolution. Microbiol Rev. 1987;51:221–271. doi: 10.1128/mr.51.2.221-271.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Zheng D, Alm E W, Stahl D A, Raskin L. Characterization of universal small-subunit rRNA hybridization probes for quantitative molecular microbial ecology studies. Appl Environ Microbiol. 1996;62:4504–4513. doi: 10.1128/aem.62.12.4504-4513.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES