Low-Dose Cadmium Potentiates Metabolic Reprogramming Following Early-Life Respiratory Syncytial Virus Infection

Abstract

Respiratory syncytial virus (RSV) infection causes serious pulmonary disease and death in high-risk infants and elderly. Cadmium (Cd) is a toxic environmental metal contaminant and constantly exposed to humans. Limited information is available on Cd toxicity after early-life respiratory virus infection. In this study, we examined the effects of low-dose Cd exposure following early-life RSV infection on lung metabolism and inflammation using mouse and fibroblast culture models. C57BL/6J mice at 8 days old were exposed to RSV 2 times with a 4-week interval. A subset of RSV-infected mice was subsequently treated with Cd at a low dose in drinking water (RSV infection at infant age [RSV^inf]+Cd) for 16 weeks. The results of inflammatory marker analysis showed that the levels of cytokines and chemokines were substantially higher in RSV^inf+Cd group than other groups, implying that low-dose Cd following early-life RSV infection enhanced lung inflammation. Moreover, histopathology data showed that inflammatory cells and thickening of the alveolar walls as a profibrotic signature were evident in RSV^inf+Cd. The metabolomics data revealed that RSV^inf+Cd-caused metabolic disruption in histamine and histidine, vitamin D and urea cycle, and pyrimidine pathway accompanying with mechanistic target of rapamycin complex-1 activation. Taken together, our study demonstrates for the first time that cumulative Cd exposure following early-life RSV infection has a significant impact on subsequent inflammation and lung metabolism. Thus, early-life respiratory infection may reprogram metabolism and potentiate Cd toxicity, enhance inflammation, and cause fibrosis later in life.

Respiratory syncytial virus (RSV) infection is a major cause of bronchiolitis in infants and the elderly, and in infants, leads to subsequent development of asthma later in life (Falsey et al., 2005; John et al., 2003; Piedimonte, 2013; Westerly and Peebles, 2010). RSV is a significant global health care burden, causing 3–4 million yearly hospitalizations worldwide. Epidemiologic evidence shows chronic respiratory dysfunction following acute infection by RSV and increased severity of RSV bronchiolitis by environmental cadmium (Cd) exposure such as passive smoking (Bradley et al., 2005; Semple et al., 2011). However, epidemiologic studies are unclear on the mechanistic relationship between RSV infection and Cd exposure on lung dysfunction in later life. Our previous research showed that lung airway reactivity was potentiated by lung Cd burden (Hu et al., 2019b), and RSV potentiated adverse reactions with increased lung Cd burden (Hu et al., 2019b), suggesting an interaction may exist between RSV infection and Cd exposure on increased risk of lung dysfunctions in later life.

Cd is a naturally occurring toxic element. A rich body of research has established that high dose Cd exposure from cigarette smoking and occupational sources causes acute and chronic lung toxicities (ATSDR, 2012). However, less is known about the health impacts of low-level chronic Cd exposure in nonsmokers, mostly obtained from dietary intake. The accumulation of Cd in the general population is usually assessed by urinary concentration, which reflects a global change of Cd content in the body rather than the local change in specific tissues, such as the lung. Humans have no effective mechanisms for Cd removal or elimination (Satarug and Moore, 2004; Suwazono et al., 2009), and Cd concentrations in human organs progressively increase with age (Ruiz et al., 2010). Consistently, previous studies showed that advanced age is an important sensitizing factor in the toxicity of heavy metals, including Cd (Rosa et al., 2008; Wormser and Nir, 1988).

Our previous studies in human cells (0.5–2 µM CdCl₂) and mouse models (0.3–10 mg/l CdCl₂) showed a low-level, dose-dependent Cd stimulation of proinflammatory signaling responses, including oxidation of thiol/disulfide redox systems, disruption of the actin-cytoskeleton regulation, nuclear translocation of thioredoxin-1, increased Nuclear factor kappa b (NF-κB) activity, and production of proinflammatory cytokines (Chandler et al., 2019; Go et al., 2013a,b; Hu et al., 2019b). More recently, we demonstrated that low-level Cd stimulated fibrosis signaling and upregulated the mechanistic target of rapamycin complex-1 (mTORC1) pathway-related gene expression (Hu et al., 2018a). In this and other studies, we found that mice with lung Cd burden comparable to nonsmoking humans had exacerbated lung inflammation upon influenza virus (Chandler et al., 2019) and RSV infection (Hu et al., 2019b). Based on these and other studies of virus and bacterial infection, smoking, and Cd burden, we recognized that high-resolution metabolomics (HRM) provided an useful metabolic phenotyping to complement inflammatory markers (Alvarez et al., 2017; Chandler et al., 2019; Cribbs et al., 2014; Hu et al., 2019b).

To examine the mechanistic relationship between RSV infection at a young age and its risk for impaired lung function later in life under environmental Cd exposure, this study was designed to use mice that were exposed to RSV as infants, mimicking early ages in humans, and evaluated for the effects of subsequent low level Cd exposure on lung inflammation and injury as mature adults. We measured metabolites and identified metabolic pathways using advanced HRM and gene expression, and conventional histopathology and inflammation markers of lung tissues and extract. This study elucidates underlying mechanisms of interaction of Cd with early-life RSV infection, to cause or potentiate lung inflammation and possibly contribute to fibrosis.

MATERIALS AND METHODS

 

 

Animals, RSV infection, and Cd exposure

Experimental protocols for animal studies were approved by Emory University and Georgia State University Institutional Animal Care and Use Committees, and experiments were performed in accordance with the guidelines and regulations. C57BL/6J mice purchased from Jackson Laboratory (Bar Harbor, Maine) were housed and bred in clean facilities and fed standard mouse diet (Laboratory Rodent Diet 5001, LabDiet, St Louis, Missouri) for breeding colonies. Male mice were selected in this study because a recent study showed exacerbation of allergic reaction in male mice relative to female mice post RSV infection (Malinczak et al., 2019). This also allows us to compare the results with our previous findings and to align with the baseline conditions with our previous studies (Chandler et al., 2019; Hu et al., 2018a, 2019a,b). Experimental treatments for 4 groups are illustrated schematically (Supplementary Figure 1) and details are as follows: infant mice (8 days old) were intranasally exposed to saline (vehicle control) or RSV (RSV line 19 [19F]) at a low dose (5 × 10³ plaque forming units [PFU] in 10 µl phosphate buffered saline [PBS]) as previously described (Cormier et al., 2010; Han et al., 2011; Matsuse et al., 2000). RSV 19F strain was previously described (Moore et al., 2009; Stokes et al., 2011) and kindly provided by Dr Martin Moore (Emory University). At 4 weeks after first RSV exposure, mice were second exposed to RSV at a dose of 1 × 10⁶ PFU in 50 µl (RSV infection at infant age [RSV^Inf] only). Considering nonlethal mild RSV infections in animal models, repeated exposures would be expected to sustain the RSV effects late in life (Matsuse et al., 2000; Yamaji et al., 2016). After 14 days of the second RSV exposure, a subset of mice at age of 7 weeks old were treated with Cd in drinking water for 16 weeks (3.3 mg CdCl₂/l, RSV^Inf +Cd), whereas the remaining RSV exposed mice were given drinking water without Cd for 16 weeks (RSV^Inf). Mice treated with saline at infant age were divided into 2 groups at age of 7 weeks old followed by treating with Cd in drinking water (3.3 mg CdCl₂/l, Cd only) or without Cd (control). Sample size (n = 8 per group) was determined statistically prior to experimentation and also considering total amount of tissues required for all assays performed in this study. Mice were given sterile-filtered drinking water without or with 3.3 mg/l CdCl₂ (Sigma-Aldrich, St Louis, Missouri) throughout the experimental period. Cd content in standard mouse diet was negligible (65.5–68.8 ng/g food), at the same levels as we reported previously (Chandler et al., 2016b) compared with 3.3 mg/l Cd in drinking water.

Cell culture

In order to study the mechanism behind observed interactions of RSV infection and Cd exposure, human lung fibroblast (HLF) cells, a normal fetal cell line, were obtained from American Tissue Culture Collection (HFL1, ATCC, Rockville, Maryland). HLF cells were cultured in growth media, F-12K media supplemented with 10% fetal bovine serum (FBS), and 100 U/ml penicillin/streptomycin (P/S). All treatments and treatment controls were performed with low serum media (0.5% FBS, 100 U/ml P/S F12-K). Low serum media was used for treatments to limit binding of low-dose Cd to cysteine thiols of serum albumin. Cells were maintained in a humidified incubator at 37°C and at 5% CO₂. HLF cells were used to examine expression levels of mRNA and protein for the genes and proteins of interest. Cells cultured in 6-well plates were treated with or without RSV in low serum media (0.2 multiplicity of infection [MOI]) overnight. The following day, cell media including virus was replaced with fresh growth media and incubated for 12 h. A subset of both RSV-infected and noninfected groups were subsequently treated with Cd in low serum media (1.0 µM CdCl₂) overnight. Dose and length of Cd treatment were chosen to align with previous in vitro work with Cd exposures (Go et al., 2013a; Hu et al., 2017). A minimum of 4 biological replicates were generated per treatment. Cells were lysed for quantitative real-time polymerase chain reaction (qRT-PCR) and Western blotting.

Quantification of Cd in lung by inductively coupled plasma mass spectrometry

Lung tissue ¹¹⁴Cd was quantified and normalized to tissue mass as previously described (Chandler et al., 2016b). Briefly, 50 mg of the lung tissue was subjected to wet acid digestion using nitric acid and hydrogen peroxide. Each sample was diluted to 10 ml and run in triplicate using inductively coupled plasma mass spectrometry (ICP-MS; Thermo Scientific iCAP Q ICP-MS, Bremen, Germany), in collision cell mode using kinetic energy discrimination. Linear standard curve was established on a range of 0.25–64 ppb in the same run as samples.

Histopathology

Intact lungs were harvested at the time of completing Cd exposure for 16 weeks. For histology, left lung tissues were fixed with 10% formalin buffered in PBS as described previously (Hwang et al., 2014, 2016). At least 8 sections of lung tissues from each control and RSV^Inf+Cd were stained with hematoxylin and eosin (H&E) to evaluate lung inflammation and profibrotic indication, Periodic acid-Schiff (PAS) stain for mucus production, and hematoxylin and congo red (H&CR) for eosinophilic infiltration. Individual lung tissues were scored by blind examination for histopathology analysis. Inflammation and focal aggregates of infiltrating epithelial alveolar cells in the airways, blood vessel (BV) and interstitial pneumonitis were measured using a severity score system defined as 0 (no lesion; normal), 1 (mild inflammation; hypertrophy of bronchiolar cells, <20% of lung affected), 2 (moderate inflammation; normal thickness of a single cuboidal cell, 20–40% of lung affected), 3 (marked inflammation; slight expansion and distension of the airway, 40–60% lung affected), and 4 (severe inflammation, thickening that occludes the airway lumen resulting in a very narrow lumen, >60% lung affected with tissue necrosis or damage; Derscheid et al., 2013; Klopfleisch, 2013). Images were acquired using an Axiovert 100 (Zeiss, Oberkochen, Germany) at 100× magnification.

Immunofluorescence and Western blotting analyses

The paraffin tissue sections were deparaffinized and rehydrated in xylene solution, followed by 100%, 95%, and 70% Ethanol solution. The antigen retrieval was achieved by boiling the slides in EDTA buffer (1 mM EDTA, 0.05% Tween, pH 8.0). Immunostaining was performed as described previously with modifications (Go et al., 2020). Briefly, the tissues were blocked in 10% (v/v) FBS/0.1% (v/v) Triton X-100/1× PBS, incubated with primary antibodies including phosphorylation of S6 (p-S6, Cell Signaling Technology, Massachusetts) and α-smooth muscle actin (α-SMA, Abcam, 1:50 in the blocking buffer), followed by Alexa Fluor-conjugated secondary antibodies (Thermo Fisher Scientific, Waltham, Massachusetts). Nuclei were counterstained with 4,6-diamidino-2-phenylindole (DAPI). Images were obtained with a Carl Zeiss AxioVision microscope equipped with ApoTome (Zeiss, Jena, Germany). To examine protein expression level of S6 by Western blotting, cells after treatment, cells were lysed, proteins were prepared, and protein expression levels from Western blots probed with antibody against S6 (Cell Signaling Technology) were quantified as previously described (Go et al., 2013b).

Cytokine and chemokine measurements

To measure cytokines and chemokines in lung and respiratory tracts, we used lung tissue lysates. The levels of cytokine in lung were determined in lung tissue extracts without perfusion that were homogenized and passed through a cell strainer. Cytokines including tumor necrosis factor (TNF)-α, interleukin (IL)-4, IL-6, IL-13, and interferon (IFN)-γ and chemokines including RANTES (regulated upon activation, normal T-cells expressed and secreted) and KC (kerotinocyte cytokine) were measured in lung lysates by corresponding cytokine (eBioscience, San Diego, California) or chemokine (R&D Systems, Minneapolis, Minnesota) ELISA using Ready-Set-Go kits following the manufacturer’s procedures.

High-resolution metabolomics

Lung tissues (20–30 mg) were used to extract metabolites in acetonitrile: water (2:1) containing internal standards (Go et al., 2015a) following the procedures as described previously (Chandler et al., 2016a,b; Hu et al., 2018b). Each sample was analyzed with LTQ-Velos Orbitrap mass spectrometer (85–2000 m/z) (Thermo Fisher Scientific); each analysis was performed with 3 technical replicates. Chromatographic separation was achieved with Accucore hydrophilic interaction liquid chromatography (HILIC) (100 × 2.1 mm, 2.6 µm, 80Å) chromatography (Thermo Fisher Scientific) under positive ion mode. Mass spectral data were extracted with apLCMS (Yu et al., 2009) and xMSanalyzer (Uppal et al., 2013) recovering metabolic features with high-resolution mass to charge (m/z) paired with retention time (RT). Data were prefiltered to retain only features with nonzero values in >70% in all samples and >80% in each group, and data from triplicate analyses were averaged prior to statistical and bioinformatic analyses.

Metabolomics data analysis

One-way ANOVA test using limma was performed to select features that differed between groups. Hierarchical clustering analysis (HCA) was used for untargeted comparison of the significant features differentiating treatment groups (raw p < .05 by limma). Selected features (raw p < .05) were further studied by pathway enrichment analyses using mummichog (Li et al., 2013) and annotated with xMSannotator (Uppal et al., 2017) with the use of Human Metabolome Database (HMDB; http://www.hmdb.ca/) which provides level 3 determination of tentative identity according to Metabolomics Standards Initiative (Wang et al., 2018). This approach protects against type 2 statistical error by including all features at p < .05 and protects against type 1 statistical error by permutation testing in pathway enrichment analysis (Uppal et al., 2016).

mRNA measurement by qRT-PCR

After treatment as described above in “Cell culture”, cells were washed in PBS, and total mRNA was collected in 350 µl collection buffer and purified by using an RNeasy Mini Kit (QIAGEN Sciences, Germantown, Maryland). Total RNA was quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific), and 1 µg of total RNA was used for cDNA generation. cDNA was generated by reverse transcription using an iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, California). Quantification by qRT-PCR was performed on a CFX96 Real-Time System (Bio-Rad Laboratories) for 40 cycles (95°C for 10 s, 60°C for 10 s, and 72°C for 10 s) using Bio-Rad CFX Maestro software. Expression levels were normalized using each sample’s 9S mRNA level as a reference gene. Primers were purchased from Integrated DNA Technologies (Coralville, Iowa). The sequences of primers were as follows (5′–3′): 9S, forward: CTGACGCTTGATGAGAAGGAC, reverse: CAGCTTCATCTTGCCCTCAT; carbamoyl phosphate synthase-I (CPSI), forward: CAACCTGGCAGTTCCTCTATAC, reverse: ACAGCGTCCATTTCTACTTCTC; OTC, forward: CATGGGACAAGAAGAGGAGAAG, reverse: TCTGGAGCTGAGGTGAGTAA.

Statistics

Quantification data were analyzed using Prism software (GraphPad Software, Inc., La Jolla, California) and results are presented as mean ± standard error (SE). Comparisons of all 4 experimental conditions were performed using 1-way ANOVA with post hoc testing using Tukey’s honest significant difference (HSD). p Values < .05 were considered to be statistically significant, significantly different subsets of treatments are denoted using letters^a–c. Comparisons between only the control and RSV^inf+Cd conditions were performed using unpaired 2-tailed Student’s t test. p Values < .05 were considered to be statistically significant and indicated by asterisk.

RESULTS

 

RSV^Inf and Subsequent Cd Exposure Did Not Have Impacts on Body Weights of Mice

Mice after infection were weighed daily for 5 days during RSV infection and then every 7 days during Cd intake throughout the study. During 5 days after RSV infection, infant mice showed 30% increase in body weight, whereas the control mice with no infection showed 40% increased body weight. Subsequent RSV infection and Cd treatment for 16 weeks did not show any significant effect on body weight changes (Supplementary Figure 2A). Lung Cd contents were substantially higher in mice given Cd in both groups following saline (Cd only: 3.1 ± 0.1 ng/g tissue, n = 8) or RSV infection (RSV^inf+Cd: 3.7 ± 0.2 ng/g tissue, n = 8) compared with no Cd treatment groups, control (0.2 ng/g tissue, n = 8) or RSV alone (0.1 ng/g tissue, n = 8; Supplementary Figure 2B). The RSV^inf+Cd group lung Cd was 15–20% more than the Cd only group (p < .05), and both Cd-treated groups were within a range found in lungs of nonsmoking humans (Garcia et al., 2001; Kollmeier et al., 1990; Morton et al., 2017).

Low-Level Cd Exposure following Early-Life RSV Infection Leads to Significantly Enhanced Levels of Lung Proinflammatory Cytokines and Chemokines

Our previous study showed preexposure of mice to Cd potentiated inflammation by RSV infection (Hu et al., 2019b). However, no information is available on Cd toxicity after early-life RSV infection; therefore, we examined the effects of early-life RSV infection and subsequent low-dose Cd exposure on lung inflammation 16 weeks after the last RSV infection. Analyses of proinflammatory cytokines, TNF-α, IL-4, IL-6 and IL-13, IFN-γ, and chemokines RANTES and KC were analyzed by ELISA (Figure 1). RSV^inf alone induced expression of IL-13, RANTES, and KC, supporting inflammation occurs in the lung (Figure 1). Although Cd exposure alone only increased production KC but not other inflammatory markers tested in lung (Figure 1), exposure of low-dose Cd following early-life RSV infection (RSV^inf+Cd) caused substantially higher production of all the proinflammatory markers. The level of all these cytokines and chemokines in the lung of mice in RSV^inf+Cd treatment group were significantly higher compared with controls (p < .05, n = 4–5) and increased relative to RSV or Cd alone, indicating that Cd exposure in later life could further aggravate the proinflammatory response from early RSV-exposure.

Figure 1.

Cd exposure following RSV RSV^inf+Cd stimulates lung inflammation. Lung cytokines (A–E) and chemokines (F and G) were quantified by ELISA as measures of proinflammatory markers. Levels of lung cytokines and chemokines in 4 groups, control (Cont), RSV only (RSV^inf), Cd only, and RSV infection followed by Cd treatment (RSV^inf+Cd) are presented by bar graphs (mean ± SE, n = 4–5).^a–cAbove error bars designates assigned significance groups resulting from 1-way ANOVA and post hoc Tukey’s HSD, with p < .05 considered significant. Experimental groups with no letter in common have significantly different means. Abbreviations: Cd, cadmium; RSV, respiratory syncytial virus; RSV^inf, RSV infection at infant age; HSD, honest significant difference.

HRM-Identified Inflammatory Metabolic Pathway Responses to Cd Exposure After Early-Life RSV Infection

Our previous studies of low-dose Cd exposure showed that global metabolic disruption in mouse lung occurred due to Cd exposure, and Cd pre-exposure potentiated H1N1 influenza or RSV infection (Hu et al., 2019a,b). To examine a potential link between metabolic response and potentiation of inflammation by RSV^inf+Cd exposure that mimicked RSV infection early in infant ages in humans, we applied HRM of lung tissues to examine global metabolic response for all 4 groups (Figure 2, cont, RSV^inf, Cd, and RSV^inf+Cd, n = 5–8). Mass spectral data pre-processing yielded total 8553 metabolic features in lung from 4 conditions (Cont, RSV^inf, Cd, and RSV^inf+Cd). ANOVA showed 2043 of 8553 lung metabolites were changed by RSV^inf, Cd, and RSV^inf+Cd exposure at p < .05 (without adjustment for multiple comparisons). Results of HCA-heatmap using these raw data show that metabolites in lung extracts clearly separate RSV^inf+Cd from other groups (Figure 2A). Pathway enrichment analysis on the 2043 lung metabolites using mummichog software (Li et al., 2013) showed that metabolic pathways of histidine (p = .012), urea cycle (p = .019), pyrimidine (p = .025), aspartate and asparagine (p = .027), and vitamin D (p = 0.048) were altered by Cd, RSV^inf infection, and RSV^inf+Cd (Figure 2B). In addition, among these pathways, the histidine pathway was also identified as a disrupted metabolic pathway by Cd or RSV^inf alone although it had lesser effect than RSV^Inf+Cd exposure (p = .024 for Cd vs Cont; p = .046 for RSV^Inf vs Cont). Figure 2C shows a network module with the interaction of several key metabolic pathways mentioned above along with associated metabolites. Histidine biosynthesis and degradation pathway was the most significantly affected metabolic pathway (overlap size: 9/15 compounds, p = .012) and play a central role in inflammation signaling.

Figure 2.

Alterations in metabolites and metabolic pathways by RSV infection in early life with or without subsequent Cd exposure. Metabolites extracted from lungs in mice of 4 treatment groups (Cont, RSV^inf, Cd, and RSV^inf+Cd) were processed and analyzed by HRM flatform. A, Group separation by lung metabolic features that differed among 4 treatment groups was shown by unsupervised 2-way HCA (n = 4–8 mice per group, limma test, raw p < .05). Relative abundance of 2043 metabolic features (metabolites) between groups is shown by heatmap. Positve z-score and red indicatess high abundance while negative z-score and blue indicates low abundance. The 2043 metabolites are analyzed for metabolic pathway enrichment analysis using mummichog (version 2) and the pathways significantly altered by 4 treatments are identified (B). C, A network of the major activity modules is shown with several metabolites associated with above significantly altered pathways. Abbreviations: RSV, respiratory syncytial virus; Cd, cadmium; RSV^inf, RSV infection at infant age; HRM, high-resolution metabolomics; HCA, hierarchical clustering analysis.

Metabolites Associated With Inflammation Were Significantly Altered by Early-Life RSV Infection and Subsequent Cd Exposure

For in-depth analysis of Cd potentiation of metabolic responses to RSV^inf, we measured abundance of representative metabolites of above significantly disturbed metabolic pathways comparing the 4 groups, and the results were presented by whisker plots (Figure 3). Metabolites of the histidine pathway including histamine, methylhistamine, methylhistidine, and dihydrourocanate were substantially higher in RSV^inf+Cd group than other groups (Figs. 3A–D, n = 4–8 per group). On the other hand, several metabolites of aspartate and asparagine, vitamin D, and redox metabolism that are closely linked to inflammation and immunity were significantly less in RSV^inf+Cd group than other groups (Figs. 3E–H, n = 4–8 per group). These metabolites included lysine, 25-hydroxyvitamin D3-lactone, trihydroxyvitamin D₃, and homovanillin (Figs. 3E–H). Together, the results of elevated histamine and histidine metabolites and decreased vitamin D metabolites in RSV^inf+Cd group are consistent with the finding above showing Cd-enhanced proinflammatory cytokines and chemokines to prior RSV^inf (Figure 1).

Figure 3.

Dysregulation of metabolites associated with histidine, aspartate, and vitamin D pathway by RSV^inf+Cd. Representative metabolites including histamine, methylhistamine, methylhistidine and urocanate (A–D) for histidine biosynthesis and degradation, lysine (E), 25-hydroxyvitamin D metabolites (F and G) for vitamin D pathway, and homovanillin were measured in lung metabolic extracts and abundance in 4 groups are presented by Whisker plot. Note that only the most abundant adduct (M + H or M+Na for positive ESI) was presented for each metabolite. ^a,bAbove error bars designates assigned significance groups resulting from 1-way ANOVA and post hoc Tukey’s HSD, with p < .05 considered significant. Experimental groups with no letter in common have significantly different means. Mean ± SE, n = 4–8. Abbreviations: Cd, cadmium; RSV, respiratory syncytial virus; RSV^inf, RSV infection at infant age; HSD, honest significant difference.

Cd-Treated Mice With Prior RSV^inf Display Impaired Urea Cycle

Our previous study and others showed virus infection caused dysregulation of metabolic pathway of urea cycle (Hu et al., 2019a; McGuire et al., 2014). The urea cycle functions to incorporate ammonia, generated by normal metabolism, into urea. Urea cycle disorders are caused by alteration in any of the enzymes, eg, ornithine transcarbamylase (OTC), carbamoylphospate synthetase (CPS), responsible for ureagenesis (Figure 4A) and can result in life-threatening acute metabolic decompensation with hyperammonia. The urea cycle was shown as a dysregulated pathway by RSV^inf+Cd group above (Figure 2B), so we examined critical metabolites and mRNA levels of OTC and CPS (Figs. 4B–F). The amount of carbamoyl phosphate was significantly less (p < .01; Figure 4B) and mRNA expression of mitochondrial CPS (CPS1) was 90% lower (p = .03; Figure 4C) in lungs of RSV^inf+Cd group compared with controls. Dysregulation of citrulline as well as the mRNA levels of the enzyme OTC were also observed in RSV^inf+Cd group (p < .01, Figs. 4D and 4E); additionally, creatine, which is synthesized from the urea cycle metabolite arginine, was also found to be increased in the RSV^inf+Cd group (Figure 4F). These results therefore suggest that impaired urea cycle is evident by RSV^inf infection of mice followed by low-dose Cd treatment.

Figure 4.

RSV^inf+Cd significantly altered urea cycle pathway and its critical metabolites and genes. A, A simple schema of central steps associated with urea cycle is shown including carbamoyl phosphate generation with elimination of ammonia by 1 of central enzymes CPSI in the mitochondria, and removal of nitrogen by OTC. Metabolites and mRNA levels by HRM and qRT-PCR, respectively, of carbamoyl phosphate (B), CPSI (C), citrulline (D), OTC (E), and creatine (F) were measured and shown by box plot and bar graphs. ^a–cAbove error bars designates assigned significance groups resulting from 1-way ANOVA and post-hoc Tukey’s HSD, with p < .05 considered significant. Experimental groups with no letter in common have significantly different means. Mean ± SE, n = 4–8. Abbreviations: Cd, cadmium; RSV, respiratory syncytial virus; RSV^inf, RSV infection at infant age; HSD, honest significant difference; CPSI, carbamoyl phosphate synthase-I; OTC, ornithine transcarbamoylase; HRM, high-resolution metabolomics; qRT-PCR, quantitative real-time polymerase chain reaction.

Dysregulation of mTORC1 and Pyrimidine Pathway by Cd Exposure Following Early Age RSV Infection

Previous studies showed that RSV infection elevated immune response and activated mTOR signaling (de Souza et al., 2016; Lin et al., 2021). In addition, we previously demonstrated that low-level Cd increased genes associated with mTOR pathway (Hu et al., 2018a). Additionally, the multiprotein complex mTORC1-mediated signaling can regulate a variety of substrates such as ribosomal S6 kinase and CPS (Ben-Sahra et al., 2013), and downstream pathways, including pyrimidine synthesis (Ben-Sahra et al., 2013). Thus, we analyzed metabolites further with a focus on those participating in the regulation of pyrimidine pathways (Figs. 5A–C). The results show that asparagine was significantly lower while uridine diphosphate (UDP) and cytosine were greater in lungs of RSV^inf+Cd group than other groups (p < .05), consistent with the involvement of mTORC1 pathway. To directly examine mTORC1 activation, we assessed the phosphorylation of ribosome protein S6 as the readout of mTORC1 activity, in lung tissues with immunostaining (Figure 5D) and in lung fibroblasts by Western blotting (Figure 5E). As shown in the Figure 5D, p-S6 is minimal in lung tissues of control and Cd-treated groups, with positive staining mainly distributed at bronchioles and alveolar ducts. The positive staining was more remarkable in RSV^inf+Cd groups (indicated by yellow arrowheads), indicating increased mTORC1 activity upon RSV^inf+Cd exposure. The findings were further validated with Western blotting analyses (Figure 5E). There was significant higher level of S6 phosphorylation in cells stimulated by RSV infection followed by Cd treatment, supporting that RSV^inf+Cd-enhanced mTORC1 activation.

Figure 5.

Nucleotide pyrimidine metabolic pathway alteration and mTORC1 activation by RSV^inf+Cd. Representative metabolites associated with pyridine pathway including asparagine, UDP, and cytosine are measured and their abundance of 4 groups are shown by box plots (A–C). Mean ± SE, n = 4–8. To examine mTORC1 activation, phosphorylation of ribosomal protein S6 as a downstream effector of mTORC1 activation was examined in lung tissues of 4 groups, control (Cont), RSV^inf, Cd, and RSV^inf+Cd groups by immunofluorescence. Representative image of green fluorescence indicated by yellow arrow shows p-S6 protein (D). E, p-S6 and S6 protein expression level as a protein loading control were examined by Western blotting. Representative blots are shown on top and quantified intensity of phosphorylated S6 normalized by S6 intenstiy is shown in a bar graph (mean ± SE, n = 6). ^a,bAbove error bars designates assigned significance groups resulting from 1-way ANOVA and post hoc Tukey’s HSD, with p < .05 considered significant. Experimental groups with no letter in common have significantly different means. Abbreviations: Cd, cadmium; RSV, respiratory syncytial virus; RSV^inf, RSV infection at infant age; HSD, honest significant difference; mTORC1, mechanistic target of rapamycin complex-1; UDP, uridine diphosphate; p-S6, phosphorylation of S6.

Impaired Central Amino Acids and Nucleotide Metabolism, and Dysregulation of mTOR Pathway-Enhanced Inflammation and Stimulated Profibrotic Markers

Our findings above suggested that early-age RSV infection with subsequent Cd exposure greatly impacted central metabolism. Given the pronounced changes in metabolism observed in the RSV^Inf+Cd group relative to control, we further examined lung tissues for inflammation and fibrosis markers specifically on the RSV^inf+Cd group comparing with control (Figure 6). The representative images of increased α-SMA expression by immunofluorescence (red fluorescence, Figure 6A, top) and alveolar and vessel thickening (indicated by black arrows, Figure 6A, bottom) by H&E staining are shown and the data clearly revealed signs of profibrotic lung tissues in RSV^inf+Cd group compared with control. The results from additional histology examination stained with PAS as a marker for mucus production, and H&CR for eosinophilic infiltration (data not shown) indicated significantly elevated deposition of inflammatory cells and mucus production in RSV^inf+Cd. Quantitation of inflammatory cells in different regions of lung tissue including airway bronchioles (AW), BV, and interstitial space (IS) are presented by inflammation score in a range of 0 (no inflammation to 4 [severe inflammation]; Figure 6B). Consistent with elevated inflammatory cells in lungs and due to the potential adaptive response following inflammation, we observed significant increase in prostaglandin E2 amount (3.5-fold increase, p = .03; Figure 6C). Additionally, because Cd treatment alone increased KC chemokine while a subtle increased trend was observed in the other cytokines (Figure 1), we quantified inflammation levels on the lung histology sections comparing with control. The result of inflammation score showed that Cd treatment alone caused mild inflammation in AW and BV (AW: 1.16 ± 0.08, BV: 1.22 ± 0.13) while no significant inflammation was observed in IS (0.74 ± 0.07; Supplementary Figure 3).

Figure 6.

Lung inflammation and fibrosis caused by RSV infection in early life followed Cd exposure. A (top), Immunofluorescence were performed on lung tissue section and the representative images are shown to examine α-SMA expression in RSV^inf+Cd group to compare with control (red fluorescence: α-SMA, blue: Hoechst, 600× magnification). A (bottom), Histopathology was conducted on the lung tissues fixed with formalin and embedded in paraffin. Representative images are shown (n = 8 mice tissues per group). Black arrow indicates perivascular fibrosis. Red arrows indicate inflammatory cells in alveolar spaces and thickening of the alveolar walls suggesting early fibrosis/inflammation. Statistical significances were performed by 1-way Student’s t test; *p < .05 in comparison indicated in graph. Abbreviations: Cd, cadmium; RSV, respiratory syncytial virus; RSV^inf, RSV infection at infant age; α-SMA, α-smooth muscle actin.

Collectively, these results indicate a synergistic impact between an initial RSV infection and subsequent low-dose Cd exposure (Figure 7), increasing lung inflammation and perturbing nitrogen utilization and Vitamin D pathway within the lung. Chronic pertrubations of these pathways, in conjunction with changes to mTORC signaling also suggest a shift in the cellular environment to promote fibrosis markers, eg, α-SMA expression and collagen accumulation, ultimately leading to lung fibrosis.

Figure 7.

Proposed schematic diagram: Low-dose Cd-stimulated lung inflammation by RSV infection in early life and may result in lung fibrosis in later life. Cd deposition at low levels in lung potentiates RSV infection-caused lung inflammation and injury by dysregulation of central metabolism and mTOR pathway for cell growth and proliferation, and promotes fibrosis. Abbreviations: Cd, cadmium; RSV, respiratory syncytial virus; mTOR, mechanistic target of rapamycin.

DISCUSSION

Cd is a toxic environmental metal contaminant and ranked seventh on Agency for Toxic Substances and Disease Registry. Lower levels of Cd, principally from food, are difficult to evaluate in humans because of confounding factors. Humans have no effective mechanisms for Cd elimination and have increased Cd accumulation with age. Increased Cd burden exacerbates the severity of responses to viral infection (Chandler et al., 2019; Hu et al., 2019b). However, viral infections frequently occur early in life, at a time before lifelong Cd accumulation, and little information is available on the consequences of a sequence of exposures in which viral infections precede Cd accumulation. Thus, this research focused on the critical need to understand reprogramming of lung cells that can occur as a consequence of early RSV infection and subsequent cumulative Cd exposure that could increase susceptibility to inflammation and subsequent lung fibrosis.

Previous animal studies show that Cd at levels similar to those found in nonsmokers caused changes in the mouse lung metabolome, transcriptome, and redox proteome (Chandler et al., 2016b, 2019; Go et al., 2014, 2015b, 2018; Hu et al., 2017, 2018a, 2019a,b) with effects on airway reactivity (Chandler et al., 2016b; Hu et al., 2019b) and potentiation of adverse reaction to RSV (Hu et al., 2019b). Although our previous studies using a mouse model showed increase in some cytokines and chemokines at 3.3 mg/l, little detectable increase in these proinflammatory markers was observed at 1.0 mg/l. Similarly in this study using 3.3 mg/l, we observed relatively subtle inflammatory response to Cd treatment alone, with a trend of increased inflammatory cytokines. However, this study shows that weeks after resolution of RSV infection and subsequent Cd exposure, increased cytokine and chemokine levels were apparent. This fills a gap in missing knowledge because there is no prior information is available concerning the effects of RSV infection early in life on subsequent Cd accumulation and inflammation. In addition, future study is warranted to examine sex-dependent responses by RSV^Inf+Cd because RSV may have sex-dependent differential effects in inflammatory responses.

The result with more lung Cd accumulation by RSV^Inf+Cd compared with Cd alone is interesting. This result appeared to be associated with alterations in metal transporters, eg, ZIP family of metal ion transporters (ZIP8 [SLC39A8], ZIP14 [SLC39A14]). In other research, we observed mRNA expression levels of both slc38a8 and slc39a14 were substantially higher in cells treated with RSV^Inf+Cd than Cd, supporting that the finding of increased Cd accumulation in mouse lung by RSV^Inf+Cd is possibly mediated by increased metal ion transporters (Jarrell et al., unpublished). Thus, this research is the first to show that infant mice exposed early to RSV had increased lung Cd accumulation and sustained metabolic and inflammatory consequences exacerbated by low-dose Cd exposure.

The most prominent metabolic disruption in lung was evident specifically in the RSV^inf+Cd group and occurred in histidine biosynthesis and degradation pathway, with increased histamine and histidine metabolites likely reflecting the elevation of inflammation. In addition, given the well-accepted recognition that vitamin D improves the immune system (Asgharpour et al., 2020; Tangpricha et al., 2017), our finding of decreased levels of a major form of vitamin D (25-hydroxyvitamin D3) appear to be associated with decreased immune system accompanying enhanced inflammation in response to RSV^inf+Cd. Decreased immunity was reported to be associated with dysregulation of vitamin D metabolism (Asgharpour et al., 2020; Tangpricha et al., 2017). Other metabolic disorders including urea cycle, pyrimidine, and the aspartate and asparagine pathway are identified as consequence of RSV^inf+Cd exposure and discussed below.

Carbamoyl phosphate synthase-1 (CPS1) present exclusively in the mitochondria is a critical enzyme for urea cycle and measured as a marker of mitochondrial damage and dysfunction (Crouser et al., 2006; Struck et al., 2005). CPS1 catalyzes the first step in the ammonia-detoxifying urea cycle by adding the ammonia to bicarbonate along with a phosphate group to form carbamoyl phosphate in the mitochondria. Disorders of urea cycle pathway are commonly associated with liver disease and also high blood pressure, sepsis, and inflammation (Fu et al., 2020; Lerzynski et al., 2006; Nagamani et al., 2021; Teufel et al., 2019). Similarly, in our previous mouse study, we found that Cd exposure disrupted urea cycle pathway, and selenium supplementation prevented such Cd toxicity (Hu et al., 2018a). In another study, we found that mitochondrial energy metabolism was altered with increased Cd dose (Hu et al., 2019a). Therefore, the current finding of RSV^inf+Cd-caused disruption of urea cycle in association with decreased mitochondrial CPS1 message level and subsequent decrease in carbamoyl phosphate abundance in lung confirmed previous findings of mitochondrial dysregulation by Cd.

Pyrimidine pathway and mTORC1 activation are confounding factors regulating cell growth and proliferation. The current data of activation of mTORC1 and altered pyrimidine pathway by RSV^inf+Cd support previous findings. A previous study showed that activation of mTORC1 caused the acute stimulation of metabolic flux via the de novo pyrimidine synthesis pathway (Ben-Sahra et al., 2013). mTORC1 signaling regulated pyrimidine pathway via ribosomal protein S6 kinase 1 as downstream target, which stimulates phosphorylation of the CAD (carbamoyl phosphate synthetase 2, aspartate transcarbamoylase, dihydroorotase). Phosphorylation of CAD stimulates de novo pyrimidine synthesis, thus mTORC1 activation stimulates a pyrimidine pathway by generating new nucleotides and promote cell growth. Because mTORC1 is a central regulator of multiple cellular events, aberrant mTORC1 activity is implicated in many diseases including lung fibrosis (Lawrence and Nho, 2018). mTORC1 functions to manage stress by toxicants including environmental metals and viral infection through removal and recycling of damaged proteins and organelles. Studies show that RSV-elevated immune response stimulated mTOR signaling (Lawrence and Nho, 2018). In addition, our previous mouse and cell studies showed that low-level Cd stimulated fibrosis signaling and upregulated mTOR pathway-related gene expression (Hu et al., 2018a).

Limitations of the study include the use of a mouse model for study of human RSV infection, the lack of comparing the effects of single versus repeated RSV infections, and the limited period of Cd exposure. Thus, additional translational research using other animal models such as cotton rats or ferrets will be useful to obtain supportive information in humans. We also noted that inflammatory outcomes could be different by RSV strains, eg, RSV line 19 or RSV A2. Although in vitro infectivity in Hep-2 cells and RSV F RNA levels in mouse lung tissues postinfection were shown to be similar between the RSV line 19 and A2 strains (Moore et al., 2009), the RSV line 19 strain is known to cause more IL-13 associated mucus production and airway hyperresponsiveness, compared with RSV A2 strain (Moore et al., 2009). Despite the limitations of this model system, the finding that RSV infection in young mice potentiated adverse inflammation and fibrotic signaling caused by environmental Cd has considerable public health implications. RSV infection is common early in life and Cd is a common environmental metal found in food that accumulates and causes long-term toxicity. Humans have no effective mechanisms for Cd elimination and increased Cd accumulation with age. Increased Cd burden exacerbates the severity of responses to viral infection (Chandler et al., 2019; Hu et al., 2019b). Thus, there is a critical need to understand the reprogramming of lung cells that occurs as a consequence of earlier RSV infection and later cumulative Cd exposure that increases susceptibility to inflammation and subsequent lung fibrosis.

In summary, this study provides the first evidence that early-life RSV infection interacts with subsequent Cd exposure to increase Cd accumulation, impair metabolism and disrupt signaling for cell growth. This interaction promotes inflammation from long-term Cd exposure with the potential to cause lung damage and fibrosis later in life. Because RSV is a widespread highly contagious infectious agent causing significant morbidity in infants and elderly and Cd is a common environmental metal causing long-term cumulative toxicity, this finding warrants additional mechanistic and human translational research.

SUPPLEMENTARY DATA

Supplementary data are available at Toxicological Sciences online.

FUNDING

The NIEHS Grants R01 ES031980 (to Y.M.G.), R01 ES023485 (to D.P.J. and Y.M.G.), R21 ES031814 (to D.P.J. and Y.M.G.), P30 ES019776 (to D.P.J.), and T32 ES012870 (to Z.J.), NEI grant R01 EY026999 (to Y.C.), and NIAID grants R01 AI54656 (to S.K.), and R21 AI147042 (to S.K.). The Oklahoma University Health Science Center Cellular Imaging Core is supported by the National Institutes of Health /NEI grant (P30EY027125 to Dr Michelle C. Callegan) and an unrestricted grant from Research to Prevent Blindness to the Dean McGee Eye Institute.