Mitoquinol mesylate (MITOQ) attenuates diethyl nitrosamine-induced hepatocellular carcinoma through modulation of mitochondrial antioxidant defense systems

Abstract

Diethyl nitrosamine (DEN) induced cirrhosis-hepatocellular carcinoma (HCC) model associates cancer progression with oxidative stress and mitochondrial dysfunction. This study investigated the effects of mitoquinol mesylate (MitoQ), a mitochondrial-targeted antioxidant on DEN-induced oxidative damage in HCC Wistar rats. Fifty male Wistar rats were randomly divided into five groups. Healthy control, DEN, and MitoQ groups were orally administered exactly 10 mg/kg of distilled water, DEN, and MitoQ, respectively for 16 weeks. Animals in the MitoQ + DEN group were pre-treated with MitoQ for a week followed by co-administration of 10 mg/kg each of MitoQ and DEN. DEN + MitoQ group received DEN for 8 weeks, then co-administration of 10 mg/kg each of DEN and MitoQ till the end of 16th week. Survival index, tumour incidence, hematological profile, liver function indices, lipid profile, mitochondrial membrane composition, mitochondrial respiratory enzymes, and antioxidant defense status in both mitochondrial and post-mitochondrial fractions plus expression of antioxidant genes were assessed. In MitoQ + DEN and DEN + MitoQ groups, 80% survival occurred while tumour incidence decreased by 60% and 40% respectively, compared to the DEN-only treated group. Similarly, MitoQ-administered groups showed a significant (p < 0.05) decrease in the activities of liver function enzymes while hemoglobin concentration, red blood cell count, and packed cell volume were significantly elevated compared to the DEN-only treated group. Administration of MitoQ to the DEN-intoxicated groups successfully enhanced the activities of mitochondrial F₁F₀-ATPase and succinate dehydrogenase; and up-regulated the expression and activities of SOD2, CAT, and GPx1. Macroscopic and microscopic features indicated a reversal of DEN-induced hepatocellular degeneration in the MitoQ + DEN and DEN + MitoQ groups. These data revealed that MitoQ intervention attenuated DEN-induced oxidative stress through modulation of mitochondrial antioxidant defense systems and alleviated the burden of HCC as a chemotherapeutic agent.

Introduction

Hepatic cancer is also known as primary liver cancer and hepatocellular carcinoma (HCC). It is the sixth most common cancer and the 4th leading cause of cancer deaths in both sexes worldwide accounting for 8.2% of deaths from all cancers in 2018 [1, 2]. HCC has a high incidence in developing countries and most frequently occur in men of age group 45–60 years [3, 4]. In Nigeria, it was reported as the 4th most common cause of cancer deaths accounting for 6.9% of cancer deaths in males in 2018 [2]. Hepatitis B and C [5], alcohol consumption [6], oral contraceptives [7], hemochromatosis [8], aflatoxinB1, and diethyl nitrosamine (DEN) are the major risk factors causing hepatocellular carcinoma.

Diethyl nitrosamine (DEN) is a potent environmental cancer-causing agent. This compound is mainly present in tobacco products, agricultural chemicals, fried foods, cosmetics, and pharmaceutical substances and poses health dangers to humans [9]. It has been used several times to induce cancer in animals and humans [10]. The treatment for hepatic cancer is a challenging task for the medical profession because of the advanced stage at presentation, delay in diagnosis, ineffective conventional therapies and attendant side effects, and other limitations [11] but chemo-protective agents serve as protection against cancer. Chemo-protective and therapeutic agents are novel substances derived from natural, synthetic or biological sources to inhibit, oppose or stop the proliferation of cancerous cells with less toxicity [12].

Emerging research in cancer therapy is focused on exploiting the biochemical differences between cancer and normal cell metabolism. Cancer cell mitochondria are known to have higher mitochondrial transmembrane potential as compared to normal cells [13]. Currently, there is considerable interest in developing strategies to minimize mitochondrial damage, both as experimental tools to probe the role of mitochondrial oxidative damage in pathologies and as potential therapies [14]. One approach to decreasing mitochondrial oxidative damage in vivo is through the development of mitochondrial-targeted antioxidants [15].

Targeting antioxidants to mitochondria is a recent approach for the amelioration of diseases in which mitochondrial dysfunction is integral [14]. Of particular interest is the compound-mitoquinol mesylate (MitoQ), which has been shown to exert beneficial actions in multiple pathologies including ischemia–reperfusion injury [16, 17], liver cancer cell lines [18], liver cirrhosis [19], diabetes [20], breast cancer cell lines [21], and in clinical trials of Parkinson’s, liver and vascular diseases [22–24]. Structurally, it comprises of a triphenyl phosphonium cation linked to ubiquinone (coenzyme Q10) and accumulates in multiple folds in the hydrophobic core of the phospholipid bilayer on the matrix-facing surface of the inner mitochondrial membrane [25, 26]. Uptake into the organelle is driven by the mitochondrial membrane potential [27] and MitoQ is thought to be continually recycled to active antioxidant ubiquinol by complex II of the respiratory chain [28]. The conjugated antioxidant moiety makes it hundreds of times more potent than conventional untargeted antioxidants in preventing mitochondrial oxidative insult [29]. High localized antioxidant concentrations are achieved with MitoQ; however, there may also be consequences of the introduction of a charged acyl moiety into the mitochondrial membrane that is independent of antioxidant action [30, 31]. Among these beneficial roles, the antioxidative activity of MitoQ is remarkable in protecting against oxidative stress–related diseases. However, the role of MitoQ in HCC remains unexplored.

Mitochondria, being the major cellular source of reactive oxygen species (ROS), are particularly susceptible to oxidative injury. Mitochondrial impairment leads to ROS overproduction, that damages mitochondrial proteins, lipids, and DNA, which in turn triggers apoptosis and leads to metabolic disorders [32, 33]. The available research data indicate that decreased mitochondrial oxidative stress may suppress or delay the progression of HCC [15]. Accordingly, delivering mitochondrial-targeted antioxidants to mitochondria could protect mitochondria against oxidative stress and inhibit cell proliferation in a ROS–mediated rat model of HCC. Thus, the present study was designed to evaluate the possible ameliorative effects of pre- and post-DEN administered MitoQ on rat liver antioxidant status, mitochondrial respiratory enzymes, and membrane integrity.

Materials and methods

Ethical approval

The protocol for this study was approved by the National Health Research Ethics Committee of the College of Medicine, University of Lagos, Federal Ministry of Health, Nigeria with the approval number: CMUL/HREC/03/19/505.

Animals’ maintenance

Fifty male Wistar strain Albino rats weighing 120–150 g were obtained from the Animal House, College of Medicine of University of Lagos, Nigeria and kept in well-ventilated standard plastic cages with five animals per cage. The animal rooms were maintained at a constant temperature of 25 ± 2 °C and 84 ± 4% relative humidity with a 12 h (7:00–19:00) light/dark cycle. The rats were acclimatized for 2 weeks, maintained on oral standard rats’ pellets (Pfizer Livestock Feeds, Lagos, Nigeria), and watered ad libitum. All experiments were conducted without anesthesia, and the protocol conformed to the guidelines of the National Institute of Health [34] for laboratory animal care and use.

Experimental design and treatment

The treatment schedule is illustrated in Fig. 1. After acclimatization, the rats were randomly divided into five groups of ten animals per group. Healthy control, DEN, and MitoQ groups were orally administered exactly 10 mg/kg body weight each of distilled water, DEN, and MitoQ, respectively for 16 weeks. Animals in the MitoQ + DEN group were pre-treated with MitoQ (10 mg/kg body weight) for a week followed by co-administration of 10 mg/kg body weight each of MitoQ and DEN for 16 weeks while the DEN + MitoQ group received 10 mg/kg body weight DEN for 8 weeks, then co-administration of 10 mg/kg body weight each of DEN and MitoQ till the 16th week.

Fig. 1.

Experimental design

The body weight of each animal was measured weekly, and the oral administration of DEN (i.e. 10 mg/kg/day) and MitoQ (i.e. 10 mg/kg/day) was designed according to the method of [35] and [19] respectively. Also, the rats were fasted overnight and the body weight of each animal was recorded just before sacrifice at the end of the 16th week. They were sacrificed by cervical dislocation and dissected to excise the liver. The tissues were rinsed in 1.15% KCl, blotted, and weighed immediately after excision.

Blood collection and tissue preservation

Whole blood samples were obtained by retro-orbital puncture using capillary tubes before sacrifice. The samples were collected in labeled lithium heparinized bottles for hematological profile analysis and ethylene diamine tetra-acetic acid (EDTA) anti-coagulated bottles for blood chemistry assays. Plasma was obtained by spinning the whole blood sample for 10 mins at 4000 rpm in a Cencom bench centrifuge. A section of the weighed liver was preserved using 10% buffered-formaldehyde (formalin) solution for histopathological evaluation.

Hematological analysis

Hematological parameters including red blood cell count, white blood cell count, packed cell volume, and hemoglobin concentration were determined using the BC-3200 Auto Hematology analyzer, (Mindray Medical International Ltd, Shenzhen, China).

Biochemical assessments

Plasma ALP, ALT, AST, and GGT activities, as well as total protein and albumin levels, were determined using the Roche Hitachi 912 Chemistry Auto-Analyzer (GMI Inc., MN, USA) and their respective standard diagnostic kits.

Isolation of mitochondria from rat hepatocytes

The other portion of the excised rat liver was washed separately with 1.15% KCl several times to remove blood, blotted, weighed, and suspended in 0.25 M sucrose (ice-cold) to prepare a 5% liver homogenate with a Potter–Elvehjem glass homogenizer. The liver homogenate was centrifuged in a cold MSE centrifuge at 2300 rpm for 5 min to separate the nuclear fraction and cell debris. Mitochondria were pelleted from the supernatant obtained by centrifugation at 12,000 rpm for 15 min. The supernatant (post-mitochondrial fraction [PMF]) obtained was aliquoted and kept frozen while the mitochondrial pellet was washed twice with sucrose buffer at 10,000 rpm for 15 min each time. The washed mitochondria were immediately re-suspended in 0.25 M sucrose buffer, aliquoted, and kept frozen at − 80 ºC [36] until use.

Measurement of membrane macromolecular composition

Mitochondrial membrane phospholipid concentration was determined as described by Chen et al. [37]. Mitochondrial membrane suspension (0.5 mL) was added to 9.5 mL of ethanol-ether and heated to 80 ºC. One milliliter of sulfuric acid in perchloric acid was added to the mixture followed by gentle heating for 45 min. The reaction mixture was cooled and 1 mL of distilled water was added and boiled for 15 s. To 4 mL of the reaction mix was added 4 mL of a mixture of 6 N sulfuric acid, 2.5% of ammonium molybdate, and 10% ascorbic acid (v/v). The mixture was incubated for 2 min at 37 ºC and absorbance was read spectrophotometrically at 600 nm. Cholesterol level was determined using Randox Kits and protein concentration was determined as described by Lowry et al. [38] by using bovine serum albumin as a standard.

Complex II (succinate dehydrogenase) activity assay

Succinate dehydrogenase (SDH) activity in isolated mitochondria was assayed using the method described by King [39]. Briefly, the reaction mixture containing 0.2 M phosphate buffer, pH 7.8 (0.375 mL), 0.045 M KCN (0.05 mL), 0.6 M succinate (0.1 mL), 0.0015 M dichlorophenolindophenol (DCIP, 0.05 mL), 0.009 M phenazine methosulfate (PMS, 0.15 mL), and distilled water (2.95 mL) was added into a 4-mL spectrophotometer glass cuvette. The reaction was started by the addition of 0.05 mL of mitochondrial suspension. The change in absorbance at 600 nm (Δ600 nm) was recorded at 1 min intervals by using a Beckman DU-640 spectrophotometer. The Δ600 nm was converted to mmol of succinate oxidized by multiplying Δ600 nm by 0.0476. Enzyme activity and  specific activity were expressed as nmol succinate oxidized/min and units/mg of mitochondrial protein, respectively.

Determination of mitochondrial F₁F₀-ATPase Activity

Activity of F₁F₀-ATPase was determined by a modification of the method of Lardy and Wellman [40]. Each reaction vessel contained 65 mM Tris–HCl buffer (pH 7.4), 0.5 mM KCl, 1 mM ATP, and 25 mM sucrose in a total volume of 2 mL made up with distilled water. The reaction which was initiated by the addition of mitochondrial suspension (of known protein content) was allowed to proceed for 30 min with constant shaking at 37 ºC. The reaction was stopped by the addition of 8 mL of a 10% solution of trichloroacetic acid to the contents of each tube which was read at 680 nm using a Pye Unicam SP 600 spectrophotometer. Water blank was used to set the instrument to zero.

Determination of superoxide dismutase activity in both mitochondrial and post mitochondrial fractions (PMF)

Superoxide dismutase (SOD) activity was determined by its ability to inhibit the auto-oxidation of epinephrine at pH 10.2 and was monitored based on an increase in absorbance at 480 nm as described by Misra and Fridovich [41]. The activity of mitochondrial MnSOD was measured in the presence of 1 mM KCN, and the cytosolic (PMF) Cu, Zn, and SOD activities were determined in the absence of KCN [42]. One unit of SOD activity was defined as the amount of enzyme required for 50% inhibition of the oxidation of epinephrine to adrenochrome at 480 nm/min. The reaction mixture (3 mL) contained 2.5 mL of 0.05 M sodium carbonate buffer (pH 10.2); 0.2 mL of PMF, or mitochondria (1:10 v/v) (containing SOD); and 0.3 mL of 0.3 mM epinephrine used to initiate the reaction. The reference cuvette contained 2.5 mL of buffer, 0.3 mL of substrate (epinephrine), and 0.2 mL of water. The enzyme activity was determined by measuring the change in absorbance at 480 nm for 5 min.

Assessment of reduced glutathione level in both mitochondrial and post mitochondrial fractions

Reduced glutathione (GSH) level was determined using Ellman’s reagent, 5,5ʹ-dithiol-bis-2-nitrobenzoic acid (DTNB), as described by Sedlak and Lindsay [43] and Jollow et al. [44]. Briefly, 0.2 mL each of mitochondrial and post mitochondrial fractions was separately mixed with 1.8 mL of distilled water and 3 mL of precipitating reagent (4% sulfosalicylic acid), and the mixture was allowed to stand for 10 min before centrifugation at 2300 rpm for 5 min. The supernatant (0.5 mL) obtained was pipetted into 4 mL of 0.1 M phosphate buffer (pH 7.4) followed by 0.5 mL of Ellman’s reagent. The blank was prepared with 4 mL of 0.1 M phosphate buffer (pH 7.4), 0.5 mL of diluted precipitating solution, and 0.5 mL of Ellman’s reagent. The absorbance was read within 20 min of colour development at 412 nm against the blank by using a spectrophotometer. The reduced GSH concentration was proportional to the absorbance at 412 nm.

Assay for catalase activity in mitochondrial and post mitochondrial fractions

Catalase (CAT) activity was determined as described by Sinha [45]. The sample (0.1 mL) was mixed with 4.9 mL of distilled water. The assay mixture contained 4 mL of 0.2 M H₂O₂ and 5 mL of 0.01 M phosphate buffer in a 10-mL flat bottom flask. One millilitre (1 mL) of the earlier diluted mitochondria and PMF was rapidly mixed with the reaction mixture by gentle swirling motion at room temperature. The assay mixture (1 mL) was added to a test tube containing 2 mL of dichromate/acetic acid reagent at 60 s intervals for 3 min and heated for 10 min in boiling water. The mixture was allowed to cool and the absorbance was measured with a spectrophotometer at 570 nm.

Estimation of glutathione peroxidase activity in mitochondrial and post mitochondrial fractions

Glutathione (GSH) peroxidase (GPx) activity in each of mitochondrial and post mitochondrial fractions was measured by the method of Mohandas [46]. Briefly, the total volume of 2 mL was composed of 0.1 mL of EDTA (1 mM), 0.1 mL of sodium azide (1 mM), 1.44 mL of phosphate buffer (0.1 M, pH 7.4), 0.05 mL of glutathione reductase (1 IU/mL), 0.05 mL of GSH (1 mM), 0.1 mL of NADPH (0.2 mM), 0.01 mL of H₂O₂ (0.25 mM) and 0.1 mL of sample. The depletion of NADPH at 340 nm was recorded. The activity of the enzyme was calculated as nmol NADPH oxidized/min/mg protein.

Investigation of oxidative stress marker in mitochondrial and post mitochondrial fractions

The extent of lipid peroxidation in mitochondrial fractions and PMFs was determined using standard methods described by Buege and Aust [47] as follows; an aliquot of 0.4 mL of the mitochondria and PMF was each mixed separately with 1.6 mL of Tris-KCl buffer. Then 0.5 mL of 30% TCA was added followed by 0.5 mL of 0.75% TBA and the mixture was placed in a water bath for 1 h at a temperature of 90–95 °C. Then, the mixture was cooled using ice and centrifuged at 3000 rpm for 15 min. The clear pink supernatant was collected and absorbance was measured against a reference blank of distilled water at 532 nm by using a spectrophotometer.

Quantitative real time-PCR (qRT-PCR)

Total ribonucleic acid (RNA) was extracted from the liver tissue of both control and treated rats using Quick-RNA™ Mini Prep kit with Zymo-spin™ IIICG Columns (Nordic BioSite) according to the manufacturer’s protocol. On the column, DNase-I treatment was included in the protocol. The purity and concentration of RNA were determined using a nanodrop spectrophotometer. First-strand cDNA synthesis was carried out using One Taq RT-PCR kit (New England BioLabs). Specific primers for SOD2, CAT, and GPx1 were designed using National Centre for Biotechnology Information (NCBI) and the primer sequences are given in Table 1. The qRT-PCR analysis was performed using Luna Universal qPCR Master Mix (New England BioLabs) and the relative quantification was done using the comparative 2^–ΔΔCt method which analyzes the relative change in gene expression based on Ct values (fluorescence denoting cDNA copy numbers) of housekeeping gene and gene of interest.

Table 1.

Primer sequences used for qRT-PCR

Gene symbol	Gene description	Sequence (5ʹ → 3ʹ)	GenBank accession no.
SOD2	Mitochondrial	F: GCCTCAGCAATGTTGTGTCG	NM_017051.2
	Superoxide dismutase	R: TAACATCTCCCTTGGCCAGC
GPX1	Glutathione	F:AAGGTGCTGCTCATTGAGAATG	NM_030826.3
	Peroxidase 1	R: CGTCTGGACCTACCAGGAACT
CAT	Catalase	F: ACGAGATGGCACACTTTGACAG	NM_012520.2
		R: TCAAAGCTGAGGACCTTCAAT
GAPDH	Glyceraldehyde—3-	F:GGTGAAGTTCGGAGTCAACGGA	NM_017008.4
	Phosphatedehydrogenase	R:GAGGGATCTCGCTCCTGGAAGA

Histopathological examination

A portion of liver tissues from each group was collected and preserved in 10% neutral-buffered formalin for histopathological studies. The tissues were processed and embedded in paraffin wax and thin sections (thickness, 3–4 μm) of liver tissues were cut before staining with haematoxylin and eosin. The thin sections of the tissues were made into slides, examined under the light microscope, and photomicrographs of the observed pathologies were taken.

Statistical analysis

Data were statistically computed using Graph Pad Prism 6 Software (Graphpad Software Inc., CA, USA) and expressed as mean ± SEM values. Differences between mean values were determined by One Way Analysis of Variance (ANOVA) and further analyzed using Tukey Honest Significant Difference (Tukey’s HSD) test and values of p < 0.05 were considered significant.

Results

MitoQ suppressed hepatic pathological changes, nodular incidence, and mortality induced by DEN

The pathological changes, as well as mortality and nodular incidence in the liver of rats administered DEN, pre-and post-treated with MitoQ were as presented in Fig. 2 and Table 2, respectively. The morphometric analysis of the liver in the healthy control and MitoQ groups showed a smooth surface with normal morphology without any sub-capsular nodules observed at the end of the 16th week (Fig. 2). The macroscopic gross appearance of the livers of animals in the DEN only-administered groups, i.e. DEN only, MitoQ + DEN, and DEN + MitoQ, revealed progressive enlargement, development of several greyish white nodules and foci of necrosis on the surface of the liver. The spread of nodules on the liver surface is reduced in the MitoQ + DEN and DEN + MitoQ groups compared to the DEN-only administered group. However, the reduction is more pronounced in the MitoQ + DEN group. The nodular incidence of 0%, 100%, 0%, 40%, and 60% was recorded in the healthy control, DEN only, MitoQ only, MitoQ + DEN, and DEN + MitoQ groups, respectively. Whereas, the survival index of 100%, 70%, 100%, 80%, and 80% was observed in the healthy control, DEN only, MitoQ only, MitoQ + DEN, and DEN + MitoQ groups, respectively (Table 2).

Fig. 2.

Macroscopic features and photomicrographs of hepatoma rats treated with MitoQ. The black arrows in the MitoQ + DEN and DEN + MitoQ groups indicate cirrhotic cells; the black arrows in the DEN group show focus containing malignant cells, Magnification- × 250; Healthy control— × 100. Control—healthy control group; DEN—group received only DEN; MitoQ—animals administered only MitoQ; MitoQ + DEN—animals pre-treated with MitoQ for a week followed by co-administration of MitoQ and DEN for 16 weeks; DEN + MitoQ—group administered DEN for 8 weeks followed by co-administration of DEN and MitoQ for the remaining 8 weeks

Table 2 .

Effect of MitoQ on tumour incidence and survival of hepatoma rats

Groups	Survival index (%)	Rats with hepatic nodular size > 1 mm	Nodular incidence (%)
Control	10/10 (100)	0/10	0
DEN	7/10 (70)	10/10	100
MitoQ	10/10 (100)	0/10	0
MitoQ + DEN	8/10 (80)	4/10	40
DEN + MitoQ	8/10 (80)	6/10	60

Livers of healthy control and MitoQ rats showed normal histology with lobules of parallel radially arranged plates of hepatocytes and no signs of liver injury were seen at the end of the 16th week. Animals in the DEN-only treated group exhibited features of liver cirrhosis and a focus containing malignant hepatocytes was seen. However, distortion of normal architecture and formation of islands bounded by fibrous septae with no cytologic atypia were also found in the liver histology of MitoQ + DEN and DEN + MitoQ rats (Fig. 2).

MitoQ alleviated perturbation in hematological parameters induced by DEN

The hematological profile of DEN-induced rats pre- and post-treated with MitoQ for 16 weeks was presented in Table 3. Rats in the DEN-only administered group presented significant decreases (p < 0.05) in the red blood cell (RBC) counts, hemoglobin concentration, and packed cell volume (PCV), when compared with the corresponding values in the healthy control, respectively. Decreases were also observed in RBC counts, hemoglobin concentration, and packed cell volume (PCV) of the MitoQ-only administered group but were not significant (p > 0.05) compared to the healthy control; while these parameters in the MitoQ group were significantly (p < 0.05) higher than in the DEN-only group. The PCV and hemoglobin concentration of the MitoQ pre-treated group were significantly (p < 0.05) higher than the healthy control, MitoQ, DEN and DEN + MitoQ groups. On the contrary, WBC count was significantly (p < 0.05) elevated in the MitoQ + DEN and DEN + MitoQ groups as compared to the healthy control group. No significant (p > 0.05) changes were observed between the RBC count of animals in the DEN and DEN + MitoQ groups (Table 3).

Table 3.

Hematological indices in HCC rats administered MitoQ for 16 weeks

Groups	RBC (µ)	PCV (∞)	HGB (β)	WBC (∆)
Control	6.234 ± 0.380a	49.120 ± 1.461a	14.400 ± 0.570a	4.680 ± 0.462a
DEN	3.734 ± 0.194b	43.580 ± 1.786b	11.960 ± 0.529b	6.520 ± 0.208a,b
MitoQ	4.956 ± 0.219a	44.400 ± 2.441a	12.780 ± 0.537a	5.480 ± 0.872a,b
MitoQ + DEN	4.142 ± 0.256a,	53.200 ± 1.812c	15.620 ± 0.537c	8.100 ± 0.744b
DEN + MitoQ	3.472 ± 0.237b	49.240 ± 0.763a	14.960 ± 0.279a	8.400 ± 0.688b

Values are expressed as means ± SEM. Values not sharing the same superscript a, b, c differ significantly at p < 0.05 from control and one another per parameter

µ— × 10⁶ cells/L, ∞— %, β— g/dL, ∆— × 10¹² cells/L

RBC red blood cells, PCV packed cell volume, HGB hemoglobin, WBC white blood cells, DEN diethyl nitrosamine, MitoQ mitoquinol mesylate, HCC hepatocellular carcinoma

MitoQ improved liver damage induced by DEN

Table 4 shows the activities of liver function enzymes found in the plasma of DEN-induced liver damaged rats pre and post-administered MitoQ for 16 weeks. The administration of DEN significantly (p < 0.05) increased the activities of plasma aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, gamma glutamyl transferase and amount of total protein by 205.7, 215.8, 107.8, 57 and 16%, respectively with the level of albumin decreased by 25% when compared with the healthy control group. Furthermore, there was no significant difference (p > 0.05) in the activities of all these liver enzymes and levels of total protein and albumin in the MitoQ group compared to the healthy control. Similarly, the levels of all these enzymes, total protein and albumin were also not significantly different (p > 0.05) in the MitoQ + DEN group except GGT when compared to their corresponding values in the healthy control group. Similarly, they were not significantly different (p > 0.05) in the DEN + MitoQ groups except AST when compared to the DEN-only group (Table 4).

Table 4.

Effects of MitoQ on the markers of liver damage in the plasma of HCC rats

Groups	AST (γ)	ALT (γ)	ALP (γ)	GGT (γ)	TP (β)	ALB (β)
Control	136.3 ± 18.12a	51.36 ± 5.06a	191.8 ± 12.11a	84.43 13.02a	72.68 ± 0.66a	39.04 ± 1.77a
DEN	416.7 ± 62.00b	162.2 ± 16.77b	398.6 ± 14.42b	565.7 125.2b	84.42 ± 4.06a	30.78 ± 2.11b
MitoQ	124.3 ± 13.83a	50.04 ± 6.20a	221.5 ± 14.23a	25.8510.54a	78.10 ± 2.45a	40.54 ± 0.86a
MitoQ + DEN	142.9 ± 22.92a	43.70 ± 1.60a	171.7 ± 13.45a	214.461.35c	80.38 ± 2.05a	43.82 ± 1.99a
DEN + MitoQ	296.7 ± 20.48c	167.9 ± 19.91b	410.9 ± 13.60b	452.7141.3b	82.38 ± 2.45a	35.06 ± 2.12b

Values are expressed as means ± SEM. Values not sharing the same superscript differ significantly at p < 0.05 from control and one another per parameter,

γ— U/L, β— g/dL

AST aspartate aminotransferase, ALT alanine aminotransferase, ALP alkaline phosphatase, GGT gamma-glutamyl transferase, TP Total protein, ALB albumin, DEN diethyl nitrosamine, MitoQ mitoquinol mesylate, HCC hepatocellular carcinoma

MitoQ intervention ameliorated the changes in the lipid profile of hepatoma rats

Table 5 shows the changes in the lipid profile of DEN-induced hepatoma rats and the effects of pre-and post-treatment with MitoQ. DEN-administered group showed a significant increase (p < 0.05) in the levels of plasma triacylglycerol (TAG), total cholesterol (TC), low-density lipoprotein (LDL), and very-low-density lipoprotein (VLDL) with a significant (p < 0.05) decrease in the level of high-density lipoprotein (HDL) after 16 weeks when compared with the values in the healthy control and MitoQ groups. The levels of plasma TAG, TC, LDL, and VLDL were significantly (p < 0.05) reduced in MitoQ + DEN groups when compared with the levels obtained in the DEN-treated animals except HDL which was significantly increased. On the contrary, there were no significant (p > 0.05) changes in the levels of plasma TAG, TC, and VLDL of DEN + MitoQ and DEN treated animals. However, the level of plasma HDL was significantly (p < 0.05) elevated in the MitoQ, MitoQ + DEN and DEN + MitoQ groups when compared to the DEN group but not significantly different within these 3 groups, respectively at the end of 16 weeks (Table 5).

Table 5.

Lipid profile of HCC rats treated with MitoQ for 16 weeks

Groups	TAG (α)	TC (α)	LDL (α)	VLDL (α)	HDL (α)
Control	0.406 ± 0.028a	1.698 ± 0.044a	0.138 ± 0.014a	0.082 ± 0.006a	1.520 ± 0.039a
DEN	0.856 ± 0.029b	2.360 ± 0.075b	0.626 ± .025b	0.172 ± 0.007b	1.400 ± 0.096b
MitoQ	0.674 ± 0.043a	2.042 ± 0.054c	0.190 ± 0.027a	0.122 ± 0.012a	1.732 ± 0.027c
MitoQ + DEN	0.608 ± 0.060a	1.986 ± 0.055a	0.418 ± 0.007d	0.132 ± 0.009c	1.842 ± 0.097c
DEN + MitoQ	1.030 ± 0.039b	2.628 ± 0.110b	0.308 ± 0.019d	0.206 ± 0.007b	1.716 ± 0.080c

Values are expressed as means ± SEM. Values not sharing a common superscript differ significantly at p < 0.05from control and one another per parameter

α— mg/dL

TAG triacylglycerol, TC total cholesterol, LDL low-density lipoprotein, VLDL very low-density lipoprotein, HDL high-density lipoprotein, DEN diethyl nitrosamine, MitoQ mitoquinol mesylate, HCC hepatocellular carcinoma

Treatment with MitoQ enhanced the activity of mitochondrial respiratory enzymes

The activities of mitochondrial respiratory enzymes were as depicted in Fig. 3. The activities of mitochondrial succinate dehydrogenase and F₁F_0-ATPase enzymes were significantly (p < 0.05) reduced by (− 59%) and (− 55%), respectively in the DEN-administered group when compared to the healthy control group. Pre-treatment (MitoQ + DEN) and post-treatment (DEN + MitoQ) of hepatoma rats with MitoQ significantly (p < 0.05) enhanced the activities of succinate dehydrogenase by 113% and 109.8% while F₁F₀-ATPase activities were 129.8% and 131% increased, respectively compared to the DEN group. The percentage increases in the activities of F₁F₀-ATPase and SDH with MitoQ treatment alone were 139% and 130% when compared to the DEN group and were not significantly different (p > 0.05) from other MitoQ treatments.

Fig. 3.

Effects of MitoQ on the specific activities of mitochondrial respiratory enzymes in HCC rats. Succinate dehydrogenase (SDH) activity (a), F1F0-ATPase enzyme activity (b). Values are expressed as means ± SEM. Bars not sharing a common alphabet differ significantly at p < 0.05. DEN diethyl nitrosamine, MitoQ mitoquinol mesylate, HCC hepatocellular carcinoma

MitoQ restored mitochondrial membrane integrity in hepatoma rats

Table 6 shows the liver mitochondrial membrane total protein, cholesterol, and phospholipid levels in the experimental Wistar albino rats. There was a statistically significant increase (p < 0.05) in mitochondrial membrane total protein (49.32%), cholesterol (61.32%), and phospholipid levels (82.05%) of the rats induced with DEN compared to the healthy control. Pre (MitoQ + DEN) and post (DEN + MitoQ) treatments with MitoQ showed a significant (p < 0.05) decrease in total protein (50.51% and 56.63%) and phospholipid levels (45.61% and 12.63%), respectively when compared to the DEN-only treated rats. Total protein and cholesterol levels were not significantly (p > 0.05) different in the pre- and post-treated groups but the phospholipid levels increased significantly (p < 0.05) by 67% and 79.5%, respectively when compared to the healthy control. Similarly, there was no significant (p > 0.05) difference in the cholesterol and phospholipid levels between the MitoQ and healthy control groups.

Table 6.

Macromolecular composition of the liver mitochondrial membrane of HCC rats treated with MitoQ

Groups	Cholesterol (α)	Phospholipid (α)	Total protein (β)
Control	0.328 ± 0.2090a	4.092 ± 0.2996a	33.333 ± 3.960a
DEN	0.848 ± 0.2847b	22.80 ± 0.4187b	65.773 ± 3.125b
MitoQ	0.585 ± 0.1002a	4.470 ± 0.4485a	21.253 ± 5.619a
MitoQ + DEN	0.590 ± 0.1344a	12.40 ± 0.8942c	32.550 ± 6.770a
DEN + MitoQ	0.6275 ± 0.2720a	19.92 ± 0.5603b,c	28.5225 ± 6.178a

Values are expressed as means ± SEM. Values not sharing a common superscript differ significantly at p < 0.05 from control and one another per parameter

α— mg/dL, β— g/dL

DEN diethyl nitrosamine, MitoQ mitoquinol mesylate, HCC hepatocellular carcinoma

Treatment with MitoQ up-regulated the expression of antioxidant genes

The expression levels of antioxidant genes in DEN-induced hepatoma rats pre-and post-treated with MitoQ were as depicted in Fig. 4. Expression of SOD2, GPx1, and CAT genes was significantly up-regulated (p < 0.05) in the healthy control, MitoQ and MitoQ + DEN groups as compared to the DEN-only treated group at the end of the 16th week. There was no significant (p > 0.05) difference between SOD2 genes expressed in the DEN and DEN + MitoQ, respectively while CAT genes expressed in MitoQ + DEN, DEN + MitoQ and MitoQ-only treated groups were not also significantly (p > 0.05) different from the healthy control.

Fig. 4.

Effects of MitoQ on the expression of SOD2 (a), CAT (b), and GPX1 (c) GPx genes in HCC rats. Values are expressed as means ± SEM. Bars not sharing a common alphabet differ significantly at p < 0.05. DEN diethyl nitrosamine, MitoQ mitoquinol mesylate, HCC hepatocellular carcinoma, GPx glutathione peroxidase

Treatment with MitoQ modulated mitochondrial antioxidant defense status

Figures 5 and 6 show the antioxidant defense status of post mitochondrial and mitochondrial fractions of DEN-induced hepatoma rats pre-and post-administered MitoQ for 16 weeks, respectively. Administration of DEN caused significant (p < 0.05) decreases in the post mitochondrial fraction activities of SOD (− 58%), CAT (− 78.7%), GPx (− 65.6%), and GSH levels (38%), respectively with a concomitant increase of 14% in MDA levels when compared to the healthy control. On the contrary, in the MitoQ, MitoQ + DEN and DEN + MitoQ groups respectively, at the end of the 16th week, there were increases in activities of SOD (37.3, 32, 27.3%), CAT (258.6, 212.8, 176.1%), GPx (11.3, 82.9, 68.6%), and levels of GSH (43.9, 62.9 and 44.9%), respectively while MDA levels decreased by 48%, 21.6% and 17.9%, respectively compared to the DEN only group (Fig. 6). As depicted on Fig. 5, the DEN-administered group indicated a significant decrease (p < 0.05) in the activities of mitochondrial superoxide dismutase (SOD2) (− 58%), catalase (CAT) (− 78.7%), glutathione peroxidase (GPx) (− 65.6%) and level of reduced glutathione (GSH) (− 38%) in contrast to a significant increase (p < 0.05) in the level of malondialdehyde (MDA) (141%) when compared with their corresponding control values. In addition, the activities of mitochondrial SOD2 (37.3%, 32.4%, 27.3%), CAT (258.6%, 212.8%, 176.1%), GPx (65.9%, 71.4%, 55.7%) and level of GSH (19.4%, 48.8%, 17.4%) were significantly (p < 0.05) elevated in MitoQ, MitoQ + DEN and DEN + MitoQ groups, respectively when compared with their values in the DEN group. However, a significant (p < 0.05) reduction in the level of MDA was observed in MitoQ (− 19.5%), MitoQ + DEN (− 28.9%), and DEN + MitoQ (− 21.6%) groups compared to the model (DEN) group (Fig. 5).

Fig. 5.

Effects of MitoQ on the specific activities of SOD (a), CAT (b), GPx1 (c), and the levels of GSH (d) and MDA (e) in the liver mitochondria of HCC rats orally administered MitoQ for 16 weeks. Values are expressed as means ± SEM. Bars not sharing a common alphabet are significantly different at p < 0.05. DEN diethyl nitrosamine, MitoQ mitoquinol mesylate, HCC hepatocellular carcinoma

Fig 6 .

Effects of MitoQ on the specific activities of SOD (a), CAT (b), GPx1 (c),and the levels of GSH (d) and MDA (e) in the liver post mitochondrial fraction of HCC rats orally administered MitoQ for 16 weeks. Values are expressed as means ± SEM. Bars not sharing a common alphabet are significantly different at p < 0.05. DEN diethyl nitrosamine, MitoQ mitoquinol mesylate, HCC hepatocellular carcinoma, SOD superoxide dismutase, CAT catalase, GPx 1 glutathione peroxidase 1, GSH glutathione, MDA malondialdehyde

Discussion

MitoQ is a mitochondrial-targeted antioxidant that has been shown to be nontoxic and orally bioavailable in animal models and humans [48, 49]. Recent reports demonstrated that MitoQ mediated protection against ethanol-induced hepatosteatosis [50], liver fibrosis [51], diabetic nephropathy [52], adriamycin-induced cardio-toxicity [53], and hepatitis C-induced liver injury [54]. The mitochondrial-targeted antioxidant-MitoQ, which is unique and completely different from conventional antioxidants, can penetrate the mitochondria and exert an antioxidant effect by decreasing ROS production [55]. This interesting role encouraged us to consider the potential hepato-protective and therapeutic effects of MitoQ in DEN-induced early-stage HCC.

In the current study, DEN was utilized to develop the rat model of HCC which was used to investigate the hepato-protection afforded by MitoQ as well as its related molecular mechanisms. DEN is a strong hepato-carcinogenic substance that causes disturbances in nucleic acid repair mechanisms and also generates reactive oxygen species (ROS) leading to oxidative stress [56]. On metabolic biotransformation, DEN produces pro-mutagenic products, O⁶-ethyl deoxy guanosine, O⁴, and O⁶-ethyl deoxy thymidine, in the liver which is responsible for its carcinogenic effects [57]. DEN-induced HCC rat model stands out amongst the most acknowledged animal models for hepatic cancer because it permits the screening of anticancer agents on the developmental and the different stages of neoplastic change [58]. The nuclear aberration caused by the DEN toxicity compromised the coordination between the nuclear DNA (nDNA) and mitochondrial DNA (mtDNA) in maintaining mitochondrial structure and function [59]. Furthermore, mutations in the nDNA encoded genes that are responsible for mtDNA integrity and/or mitochondrial function could play a crucial role in tumorigenesis and cancer progression [60].

It has already been established in various studies that hepatocytes identified with salient hyperplasia, cell multiplication, and enzymatic markers are responsible for pre-neoplastic nodules in liver tissue [61]. In this study, the outcome suggested that the pre-and post-treatment with MitoQ declined the expanding hepatic nodules and reduced the rate of mortality in the test animals [62]. The outcome fulfilled the target of our research by diminishing the formation of hepatic nodules and reducing the mortality associated with HCC. The potency of MitoQ in preventing the multiplicity of neoplastic nodules in the present study gives substantial support to the effectiveness of MitoQ against the liver toxicity induced by DEN. Our present findings seem to contradict a recent report of MitoQ accelerating tumor progression in DEN-induced HCC mice [63]. A reasonable explanation is the dosage and structure of MitoQ in the two studies; administration of MitoQ in the present study was controlled by oral gavage of 10 mg/kg/day of MitoQ to Wistar rats whereas Wang et al. [63] dissolved 0.05–1 g of MitoQ in mice’ drinking water and administered ad libitum. Thus, the amount of MitoQ taken by each mouse in the previous work could not be quantified. The dosage i.e. 10 mg/kg/day in this study was based on the data from scientific literature [19, 64] and the preliminary pilot study that was conducted by us to standardize the dosage used. The pharmaceutically stable formulation of MitoQ into tablets has now been developed and has passed through conventional animal toxicity tests with no observable adverse effect at 10.6 mg/kg [64]. Also, the structure of a molecule impacts on its function; the introduction of charged mesylate moiety to mitoquinol (an active form of MitoQ), in the present study, could also be responsible for the discrepancy in the two studies; the previous work dissolved mitoquinone (an inactive form of MitoQ) in drinking water.

Evaluation of hematological parameters can be utilized to decide the degree of pernicious impact of harmful chemicals such as DEN on the blood profile of an individual. RBC contains hemoglobin (Hb), which performs an important function in respiration and transports oxygen to tissues. Reduction in the levels of RBC, PCV, and hemoglobin leads to anemia [65]. Rats administered only DEN experienced an enhancement of WBC levels which is indicative of pathological conditions and hepatic cancer [66]. Reduction in the level of WBC and increase in RBC, PCV, and Hb concentrations in rats pre-treated with MitoQ revealed the protective effect of MitoQ on the hematopoietic system.

Hepatic damage caused by DEN and CCl₄ generally reflects the instability of liver cell metabolism which leads to distinctive changes in the serum enzyme activities [67]. Serum transaminases (AST and ALT), ALP, and GGT are biomarkers of liver function and their increased levels are sensitive indicators of hepatic injury [68]. In the present investigation, animals treated with DEN showed hepatocellular damage which was evident from the significant increase in the plasma liver marker enzymes i.e. AST, ALT, ALP, and GGT (Table 4). These elevations were consistent with several research findings [69–71]. The significant reduction of these enzymes in rats pre-treated with MitoQ suggested that MitoQ aided in parenchyma cell regeneration in the liver and protected liver membrane integrity by decreasing leakage of these enzymes into circulation.

The elevated levels of lipids in the tumour-bearing animals may be due to decreased activities of lipid metabolizing enzymes. This predicts the defective catabolism rather than an elevated synthesis of lipoprotein which seems to be the cause [72]. The reduced activity of SDH in the DEN-only administered rats implies a decreased electron transfer and oxidation consequently resulting in reduced ATP synthesis. The increased SDH activity in groups treated with MitoQ to near basal level implies that MitoQ could exhibit the potential to induce the expression of SDH probably because SDH continually recycles MitoQ to its active form, mitoquinol (Fig. 3). Also, the elevated activity of F₁F₀-ATPase in the MitoQ + DEN and DEN + MitoQ groups speculates that MitoQ impaired coupling of the electron transport chain and oxidative phosphorylation in HCC rats. This is in agreement with the work of Cheng et al. [73] who reported a decreased level of ATP in breast cancer cell lines treated with mitochondrial-targeted antioxidant- mitochromanol.

This study showed unequivocally that MitoQ administration improved the hepatic pathological changes and suppressed the development of HCC, as it was histologically confirmed. The reversal of the toxic effects of DEN by MitoQ is probably due to reduction or complete inhibition of the oxidative stress and improvement in the antioxidant status. This is supported by the results observed in the present study in which, the activities of antioxidant enzymes SOD, GPx, and CAT were increased. The normalization of both mitochondrial and cytoplasmic (PMF) antioxidant defense status in MitoQ treated tumors (Figs. 5 and 6) showed that this agent not only improved mitochondrial antioxidant enzymes but also could maintain normal cellular cytoplasmic oxidative status. Also, the up-regulated expression of SOD2, CAT and GPx1 genes as well as their specific activities in MitoQ-administered groups suggest that MitoQ exerted hepato-protective effects against HCC through the modulation of mitochondrial antioxidant defense system. To the best of our knowledge, this is the first study exploring the in vivo protective effect of MitoQ on HCC through the regulation of oxidative damage in an animal model.

Oxidative stress induces mitochondrial damage and causes the generation of superfluous ROS [74, 75]. Excessive ROS obstructs mitochondrial function and upsets the normal balance of endogenous oxidant and antioxidant mechanisms. The level of MDA, which indicates lipid peroxidation, begins to elevate immediately following HCC [72].The restorative potential of pre- and post-treatments with MitoQ on the altered MDA and GSH levels by DEN indicate that oxidative stress was induced by HCC and MitoQ notably alleviated the oxidative insult induced by HCC. These findings are consistent with previous studies [71, 72, 76]. According to the present findings, it could be inferred that MitoQ exerted antioxidant effects to reduce oxidative damage in HCC. The insignificant difference in all parameters observed in the healthy control and MitoQ groups depicts that administration of MitoQ alone for 16 weeks is less toxic and safe for consumption. This corroborates the findings of Rodriguez-Cuenca et al. [77] and Fink et al. [78] who observed no pathological changes after long-term administration of MitoQ to mice.

Canuto et al. [79] reported increased membrane phospholipid-cholesterol ratio in mitochondria of primary hepatoma rats induced with DEN than in the normal liver. This corroborates findings from the present study in which a remarkable increase in the cholesterol and phospholipid concentrations of mitochondrial membranes of DEN–induced hepatoma rats were observed. A reduction in the liver mitochondrial membrane phospholipid level was observed in the tumour-bearing animals pre and post-treated with MitoQ compared to the DEN-only treated animals. The increased phospholipid concentration in DEN-only administered rats suggests extremely fluid and leaky membrane that might lead to compromised mitochondrial membrane integrity [80]. This finding is corroborated by Adisa and Sulaimon’s [80] earlier report on the induction of cholesterol and phospholipid synthesis in the liver mitochondrial membrane of Plasmodium berghei-infected mice treated with selected antimalarial drugs. Interestingly, a reduction in phospholipid concentration in MitoQ-administered groups compared to the DEN group showcased the effect of MitoQ in protecting mitochondrial membrane composition and function. It is known that the presence of MitoQ which may likely adsorbed to the matrix surface of the mitochondrial inner membrane modulated cellular and mitochondrial membrane phospholipids, in particular cardiolipin, and their fatty acid composition, and that this, in turn, may contribute to the modulation of overall mitochondrial function [81].

In conclusion, the most significant finding of our study was that the administration of MitoQ provided effective protection against DEN-induced hepatocellular carcinoma possibly by attenuating oxidative stress indices through modulation of mitochondrial antioxidant defense systems. In the current study, it became clear that MitoQ provided hepato-protection against carcinogenic effects of DEN and the use of mitochondria-targeted antioxidant MitoQ could alleviate the burden of HCC as a chemo-protective and therapeutic agent.

Abbreviations

ALP

Alkaline phosphatase (U/L)

ALT

Alanine aminotransferase (U/L)

AST

Aspartate aminotransferase (U/L)

CAT

Catalase (U/mg protein)

CHL

Cholesterol (mg/dL)

DEN

Diethyl nitrosamine

GGT

Gamma glutamyl transferase (U/L)

GPx

Glutathione peroxidase (U/mg protein)

GSH

Reduced glutathione (nmol/L)

Hb

Hemoglobin (g/dL)

HCC

Hepatocellular carcinoma

HDL

High density lipoprotein (mg/dL)

LDL

Low density lipoprotein (mg/dL)

MDA

Malondialdehyde (nmol/L)

MitoQ

Mitoquinol mesylate

NIH

National Institutes of Health

PCV

Packed cell volume (%)

PMF

Post mitochondrial fraction

RBC

Red blood cells (10⁶ cells/L)

SDH

Succinate dehydrogenase (U/mg protein)

SOD

Superoxide dismutase (U/mg protein)

TAG

Triacyl glycerol (mg/dL)

TP

Total protein (g/dL)

WBC

White blood cells (10¹² cells/L)

Author contributions

Conceptualization: RAA and LAS. Methodology: RAA and LAS. Investigation: LAS, EGO, and OCA. Formal analysis: FBA, LAS, EGO and OCA. Data curation: LAS. Visualization: FBA. Original draft: LAS. Review and editing: LAS, RAA and FBA. Supervision: RAA. Funding acquisition: LAS, OCA, and EGO.

Funding

Self-funding.

Data availability

Data and materials will be available from the authors upon request.

Declarations

Conflict of interest

The authors declare no potential conflicts of interest concerning the research, authorship, and/or publication of this article.

Ethical statement

The protocol for this study was approved by the National Health Research Ethics Committee of the College of Medicine, University of Lagos, Federal Ministry of Health, Nigeria with Approval number: CMUL/HREC/03/19/505.