Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Jul 1.
Published in final edited form as: Methods Enzymol. 2019 Nov 22;633:169–184. doi: 10.1016/bs.mie.2019.11.002

A suite of bioassays to evaluate CREB inhibitors

Bingbing X Li 1,*, Xiangshu Xiao 1,*
PMCID: PMC9249121  NIHMSID: NIHMS1819077  PMID: 32046844

Abstract

The cyclic-AMP response element binding protein (CREB) is an important nuclear transcription factor and has been shown to be overexpressed and/or over-activated in many different cancer types, suggesting that targeting CREB is a novel approach for developing cancer therapies. Our lab discovered the first cell-permeable small molecule inhibitor of CREB, from which we further developed a potent CREB inhibitor with in vivo anti-cancer activity. In this article, we detailed our biochemical and cell-based bioassays to assess different small molecule CREB inhibitors.

1. Introduction

The cyclic-AMP response element (CRE) binding protein (CREB) is a critical nuclear transcriptional factor participating in a wide range of cellular processes including cellular proliferation and differentiation (Shaywitz & Greenberg, 1999). In unstimulated cells, CREB resides in the nucleus to bind CRE sequences in the genome. Upon receiving extracellular stimuli (e.g., growth factors, hormones), CREB becomes phosphorylated at Ser133 by several kinases such as protein kinase A (PKA), protein kinase B (PKB/Akt), mitogen-activated protein kinases (MAPKs) and p90 ribosomal S6 kinase (p90RSK) (Xiao, Li, Mitton, Ikeda, & Sakamoto, 2010). Phosphorylated CREB (pCREB) at Ser133 (Mayr & Montminy, 2001) can bind CREB-binding protein (CBP) and its paralog p300 through the interaction between kinase-inducible domain (KID) in CREB and the KID-interacting domain (KIX) in CBP/p300 (Radhakrishnan et al., 1997). The resulting CREB/CBP complex will further recruit other transcriptional machinery to turn on CREB-dependent gene transcription (Cardinaux et al., 2000). On the other hand, protein phosphatases including protein phosphatase 1 (PP1) (Hagiwara et al., 1992), protein phosphatase 2A (PP2A) (Wadzinski et al., 1993) and phosphatase and tensin homolog (PTEN) (Gu et al., 2011) can dephosphorylate CREB to inactivate CREB-mediated gene transcription. In cancer cells, the kinases phosphorylating CREB are often over-activated and/or overexpressed while the phosphatases dephosphorylating CREB are frequently inactivated or deleted (McConnell & Wadzinski, 2009; Song, Salmena, & Pandolfi, 2012). So it comes to no surprise that CREB over-expression and/or over-activation was found in many cancer types. Thus, targeting CREB may represent a unique strategy for developing novel cancer therapies (Xiao et al., 2010).

For the reasons mentioned above, we have been interested in developing small molecule CREB inhibitors since 2009 ( Jiang, Li, Xie, Delaney, & Xiao, 2012; Li & Xiao, 2009; Li et al., 2014; Li, Yamanaka, & Xiao, 2012; Xiao et al., 2010; Xie, Li, Broussard, & Xiao, 2013; Xie et al., 2015; Xie, Li, & Xiao, 2013, 2017). We discovered the first cell-permeable small molecule inhibitors of CREB (Li & Xiao, 2009) and the most potent CREB inhibitor with in vivo anti-cancer efficacy (Xie et al., 2015, 2017). The chemical structures of two representative CREB inhibitors, naphthol AS-E (or alternatively called XXK06) and 666–15, are shown in Fig. 1. Critical to the discovery and development of these inhibitors is the availability of a suite of bioassays to guide the optimization of small molecule inhibitors. For this purpose, we developed two orthogonal assays to assess small molecule inhibitors of CREB. The first one is to assess the biochemical CREB-CBP interaction using a split Renilla luciferase assay and the second one is cell-based transcription reporter assay using Renilla luciferase as the reporter (Li & Xiao, 2009).

Fig. 1.

Fig. 1

Chemical structures of XXK06 and 666–15. XXK06 was used to evaluate inhibition of KIX-KID interaction while 666–15 was used to inhibit CREB-mediated gene transcription in living cells.

The native Renilla luciferase (rluc) gene was cloned from marine organism Renilla reniformis (Sea pansy) (Lorenz, McCann, Longiaru, & Cormier, 1991; Matthews, Hori, & Cormier, 1977). Subsequent optimization efforts by Promega scientists developed a synthetic rluc gene for enhanced expression in mammalian cells to be used as a genetic reporter enzyme. The bioluminescence signal produced by Renilla luciferase enzyme is derived from decarboxylative oxidation reaction of coelenterazine substrate to coelenteramide (Matthews et al., 1977). Unlike firefly luciferase, this bioluminescence reaction is ATP- and Mg2+-independent (Matthews et al., 1977). It has been shown that firefly luciferase is more prone to be directly inhibited by compounds from the chemical libraries than Renilla luciferase (Auld et al., 2008), which is at least partially due to the requirements of ATP and Mg2+ for the former. In this case, chemical molecules that can bind to the ATP-binding pocket or chelate divalent metal ions will inhibit firefly luciferase activity directly. This vulnerability creates potential artifact in assessing chemical inhibitors of certain biological pathways when firefly luciferase is used as a reporter (Bakhtiarova et al., 2006). Alternatively, distinct chemical entities can be deliberately developed to inhibit firefly luciferase (Liu et al., 2012).

Bimolecular complementation is a unique method to assess protein-protein interactions (Kerppola, 2008). In this approach, a protein (e.g., a fluorescent protein or luciferase) is split into two halves. Then the N-terminal half is fused with one protein of interest (bait) and the C-terminal half is fused with the binding partner of the protein of interest (prey). On their own, these fusions lose the activity of the protein to be split. When the bait and prey bind together, this will reconstitute the activity of the original protein to be split (e.g., fluorescent activity or luciferase activity) (Kerppola, 2008; Ozawa, Kaihara, Sato, Tachihara, & Umezawa, 2001). In this article, we describe our split Renilla luciferase assay to monitor CREB-CBP interaction both in living cells and in biochemical assays. To assess the functional effect of small molecules in inhibiting CREB-mediated gene transcription, we also describe our cell-based transcription reporter assay using Renilla luciferase as a transcription reporter. Expression of Renilla luciferase is under the control of three tandem copies of CRE in the promoter region.

2. Protocols

2.1. Split Renilla luciferase assay

2.1.1. Optimization of split Renilla luciferase assay to monitor KIX-KID interaction

Renilla luciferase can be split into N-terminal portion (RLucN, aa2–229) and C-terminal portion (RLucC, aa230–314) to monitor protein-protein interactions (Paulmurugan & Gambhir, 2003). RLucN and RLucC themselves do not have any luciferase activity. One portion of Renilla luciferase was fused with the KID from CREB (100–161) while the other portion was fused with the KIX domain from CBP (553–679). Upon stimulation, phosphorylated KID binds KIX to bring the Renilla luciferase fragments together to restore an active Renilla luciferase. If a compound inhibits KID-KIX binding interaction, the amount of active Renilla luciferase activity should be diminished. It is expected that the relative orientation between Renilla luciferase fragments and KIX/KID is critical to have a functional Renilla luciferase complementation assay. Based on the three-dimensional NMR protein structure of the KID bound to KIX (Radhakrishnan et al., 1997), it would be desirable to have a pair of constructs where the two halves of RLuc are fused to the N-terminus of KIX and the C-terminus of KID or N-terminus of KID and C-terminus of KIX. Therefore, a total of four possible pairs (A-D, B-C, E-F, G-H) were designed (Fig. 2). In each of the constructs, a nuclear localization sequence (NLS) was added at the C-terminal end to facilitate nuclear localization because endogenous CREB and CBP are both localized inside the nucleus.

Fig. 2.

Fig. 2

Schematic diagrams of four possible pairs of the split Renilla luciferase assay constructs to monitor KIX-KID interaction. In each of the construct, a nuclear localization sequence (NLS) was added at the C-terminus to facilitate nuclear localization of the expressed proteins in mammalian cells. (SG)4 was inserted as a flexible linker in each of the construct.

2.1.1.1. Procedures
  1. The mammalian expression constructs A-H were prepared according to the standard molecular cloning approach. The sequence of each construct was verified by Sanger sequencing. Note, whereas we prepared these constructs by molecular cloning, these and other similar constructs can also be prepared by gene synthesis with a reasonable cost.

  2. 1 million HEK 293T cells were plated into one well of a 6-well plate with Dulbecco’s Modified Eagle’s Medium (DMEM) media containing 10% fetal bovine serum (FBS) and non-essential amino acids. The cells were allowed to attach to the bottom of the plate for overnight in a humidified incubator at 37°C with 5% CO2.

  3. The cells were transfected with each combination of the plasmids (A-D, B-C, E-F, G-H) by Lipofectamine™ 2000 (Life Technologies) according to manufacturer’s protocol. We used 1 μg of each plasmid for each well of the cells. One well of untransfected cells were also prepared.

  4. Three hours later, the transfected cells were collected and resuspended in phenol red-free DMEM media with 10% FBS. The cells were then replated into a 96-well plate at a density of 3 × 104 cells/well in 100 μL of media. The cells were then allowed to attach to the bottom of the wells for overnight. The untransfected cells were also plated into the 96-well plate for background measurements in step 6.

  5. The cells were then treated with different concentrations of forskolin (Fsk) for 1–2 h in a humidified incubator at 37°C with 5% CO2.

  6. Freshly prepared coelenterazine (Nanolight technology) solution in PBS (pH 7.4, 20 μg/mL, 100 μL) was then added to each well. The luciferase activity was then measured in a plate reader (Packard Fusion, Perkin Elmer). Note, the aqueous coelenterazine solution is unstable and should be prepared immediately before use. However, an ethanol solution of coelenterazine at 1 mg/mL can be prepared and stored at −80°C in the dark for at least 6 months.

  7. The raw luciferase measurement data were converted into relative fold of induction, which is derived from (Fsk-treated sample reading-background reading)/(DMSO-treated sample reading-background reading). The background reading was from untransfected cells treated with DMSO only. Representative results are shown in Fig. 3.

  8. Based on the results in Fig. 3, we concluded that the pair A-D was the best among the four pairs because this pair gave the maximal fold of induction by Fsk under the identical conditions. This A-D pair was used for the rest of the split Renilla luciferase assay to monitor KIX-KID interaction.

Fig. 3.

Fig. 3

Optimization of split Renilla luciferase assay in HEK 293T cells to monitor KIX-KID interaction. HEK 293T cells were transfected with different pairs of plasmids. The cells were then treated with different concentrations of Fsk (10, 5, 1, 0.5, 0.1, and 0.01 μM) for 1–2 h. The resulting Renilla luciferase activity was measured in situ after the addition of coelenterazine to a final concentration of 10 μg/mL with a plate reader. The fold of RLuc induction=(Fsk-treated sample reading-background reading)/(DMSO-treated sample reading-background reading), where the background reading was from untransfected cells treated with DMSO only.

2.1.2. Inhibition of KIX-KID interaction by XXK06 to be monitored by split Renilla luciferase assay in living cells

With the optimized A-D pair to monitor KIX-KID interaction in living HEK 293T cells, this assay can be adapted to assess and screen small molecule A suite of bioassays to evaluate CREB inhibitors inhibitors of KIX-KID interaction (Li & Xiao, 2009; Xie, Li, Broussard, & Xiao, 2013). To illustrate this capability, we used cell-permeable small molecule XXK06 (Fig. 1) as an example (Li & Xiao, 2009). For this assay, the steps 1–4 in Section 2.1.1.1 were followed. Then XXK06 was added at different concentrations and incubated with the cells for 1 h at 37°C followed by addition of a fixed concentration of Fsk at 2.5 μM. The cells were further incubated for 2 h before the measurement of Renilla luciferase activity as in step 6 in Section 2.1.1.1. Representative results are shown in Fig. 4.

Fig. 4.

Fig. 4

XXK06 inhibits KIX-KID interaction in living HEK 293T cells. The cells were transfected with the A-D pair of plasmids. Then the cells were treated with increasing concentrations of XXK06 for 1 h followed by addition of Fsk (2.5 μM) for 2 h. The measured Renilla luciferase activity was processed as in Fig. 3 and further normalized to 1.0 for the cells treated with Fsk only. Modified from reference Li, B. X., & Xiao, X. (2009). Discovery of a small-molecule inhibitor of the KIX-KID interaction. Chembiochem: A European Journal of Chemical Biology, 10, 2721–2724. Copyright (2009) of Wiley-VCH.

2.1.3. Inhibition of KIX-KID interaction by XXK06 to be monitored by split Renilla luciferase assay in vitro

The cell-based split Renilla luciferase assay described above is very useful in assessing if the inhibitors to be investigated are cell-permeable and can inhibit KIX-KID interaction in living cells. However, a biochemical in vitro assay would be desirable to investigate if the inhibitors are indeed directly inhibiting the KIX-KID interaction instead of other cellular events that might also lead to inhibition of KIX-KID interaction in the cells (e.g., phosphorylation of KID). In this respect, we also developed a biochemical version of the split Renilla luciferase assay to monitor KIX-KID interaction using the A-D pair (Li & Xiao, 2009).

2.1.3.1. Procedures
  1. Preparation of recombinant His6-tagged A protein from E. coli. An E. coli expression plasmid for His6-tagged A was prepared by sub-cloning A into pET-15b vector using standard molecular cloning approach. The sequence of the resulting plasmid was verified by Sanger sequencing. The plasmid was then transformed into BL21(DE3)pLysS competent cells (Promega) for protein expression. In this strain of E. coli, the expression of protein of interest can be induced by isopropyl β-d-1-thiogalactopyranoside (IPTG). The purification of His6-A was carried out using standard affinity fast protein liquid chromatography with a Ni2+ column. After purification, the protein was dialyzed into the storage buffer [50 mM Tris (pH 8.0), 100 mM KCl, 12.5 mM MgCl2, 1 mM EDTA, 0.05% Tween-20] (Xiao, Yu, Lim, Sikder, & Kodadek, 2007) and stored at −80°C.

  2. Preparation of D from HEK 293T cells. Five million HEK 293T cells were plated into a 10-cm plate with DMEM media containing 10% FBS and non-essential amino acids. The cells were allowed to attach to the bottom of the plate for overnight in a humidified incubator at 37°C with 5% CO2. The cells were then transfected with 6 μg plasmid D by Lipofectamine™ 2000 and OptiMEM (Life Technologies) for 3 h according to the manufacturer’s protocol. Then the cells were incubated in DMEM media containing 10% FBS and non-essential amino acids for 20 h, when Fsk (5 μM) was added for 2 h. The cells were then collected by scraping and washed with cold PBS (5 mL) twice. The cell pellets were lysed in 600 μL 1 × Renilla luciferase lysis buffer (Promega) supplemented with protease inhibitor cocktail (Roche Applied Science), phosphatase inhibitor cocktail (Pierce) and 1 mM phenylmethylsulfonyl fluoride (PMSF) on ice for 20 min. Then the lysates were cleared by centrifuging at 14,000 rpm for 15 min at 4°C. The concentration of the cleared lysates was determined by Protein assay Dye Reagent Concentrate (Bio-Rad). The concentration was usually about 1 mg/mL.

  3. To assess the formation of KIX-KID complex using the split Renilla luciferase assay, His6-A (15 ng) from step 1 and D-containing HEK 293T cell lysates from step 2 (0.75 μg) were mixed together in 1 x Renilla luciferase lysis buffer (30 μL, Promega) and incubated on ice for overnight. Then 5 μL of the incubation mixture was mixed with 30 μL of coelenterazine solution in PBS (pH 7.4, 10 μg/mL) and the luciferase activity was measured immediately using FB12 single tube luminometer (Berthold). Representative results are shown in Fig. 5A. As expected, neither A nor D alone showed appreciable luciferase activity. However, when A and D were mixed together, robust reconstitution of luciferase activity was achieved. As a control, when A was mixed with a non-binding pair inhibitor of DNA binding Id-RLucN (Paulmurugan & Gambhir, 2003), only minimal luciferase activity was observed, demonstrating the specificity of the assay (Fig. 5A). We have observed that the 1 × Renilla luciferase lysis buffer is a preferred buffer for this assay because this buffer contains proprietary components that can suppress the auto-bioluminescent activity of coelenterazine. In addition, the presence of mild detergent in this buffer can decrease the chance of artifact from pan-assay interference compounds (PAINS) when assessing small molecule inhibitors (Baell & Nissink, 2018).

  4. To evaluate inhibition of KIX-KID interaction by XXK06 using the in vitro split Renilla luciferase assay, the assay mixture in step 3 was prepared in the presence of different concentrations of XXK06. And the mixture was incubated on ice for overnight. Then the remaining luciferase activity was measured by adding 5 μL of the incubation mixture to 30 μL of coelenterazine solution in PBS (pH 7.4, 10 μg/mL). The measurement was performed with FB12 single tube luminometer (Berthold). Representative results are shown in Fig. 5B. When setting up these assays, we typically set up the assays in 96-well PCR plates.

Fig. 5.

Fig. 5

XXK06 inhibits KIX-KID interaction in vitro. (A) KIX-KID interaction effectively reconstitutes active Renilla luciferase in the split Renilla luciferase assay. The recombinant fusion protein A was mixed with different RLucN-containing HEK 293T cell lysates on ice for overnight. Then the luciferase activity was measured in a tube luminometer upon addition of coelenterazine. (B) XXK06 inhibits KIX-KID interaction in vitro. The recombinant fusion protein A was mixed with D-containing HEK 293T cell lysates in the presence of different concentrations of XXK06 on ice for overnight. Then the remaining luciferase activity was measured in a tube luminometer upon addition of coelenterazine. Modified from reference Li, B. X., & Xiao, X. (2009). Discovery of a small molecule inhibitor of the KIX-KID interaction. Chembiochem: A European Journal of Chemical Biology, 10, 2721–2724. Copyright (2009) of Wiley-VCH.

2.2. CREB transcription reporter assay

The oncogenic and other function of CREB is mainly through its transcription activity to transcribe its target genes in the cells. To further assess if a small molecule can inhibit CREB’s transcription activity inside the cells, we developed a cell-based transcription reporter assay (Li & Xiao, 2009). For this assay, the key reagent needed is a CREB reporter construct. While firefly luciferase is a commonly used transcription reporter, we adopted Renilla luciferase as the reporter because it is less prone to be inhibited by general small molecules for the reasons mentioned above (Auld et al., 2008). To make this construct responsive to CREB activation, the promoter for this construct contains three tandem copies of consensus CRE sequences (GCACCAGACAGTGACGTCAGCTGCCAGATCCCATGGCCGTCATACTGTGACGTCTTTCAGATGGGAGAAC) (Alluri, Liu, Yu, Xiao, & Kodadek, 2006). In this section, we describe protocols to ensure that the reporter construct is responsive to CREB activation and illustrate the inhibition of CREB’s transcription activity using 666–15 (Li et al., 2016; Xie et al., 2015) as a small molecule inhibitor.

2.2.1. Procedures

  1. The reporter construct named as CRE-RLuc was created by swapping the firefly luciferase gene in CRE-FLuc (gift of Tom Kodadek, Scripps Florida) with a synthetic Renilla luciferase gene from pRL-SV40 (Promega) using standard molecular cloning approach. The sequence of the construct was verified by Sanger sequencing. Alternatively, this construct can also be prepared using standard gene synthesis approach.

  2. HEK 293T cells were plated into a 6-well plate at 1 million cells/well in DMEM media containing 10% FBS and non-essential amino acids. The cells were allowed to attach to the bottom of the plate for overnight in a humidified incubator at 37°C with 5% CO2.

  3. The cells were transfected with 1 μg CRE-RLuc plasmid by Lipofectamine™ 2000 following manufacturer’s protocol.

  4. Three–five hours later, the transfected cells were collected and replated into a whole 96-well plate at ~10,000 cells/well. The cells were then allowed to attach to the bottom of the wells for overnight.

  5. The cells were treated with different concentrations of 666–15 (5, 1, 0.5, 0.1, 0.05, 0.01, 0.001, and 0 μM) for 30 min, when Fsk (10 μM) was added to stimulate CREB’s transcription activity.

  6. The cells were then further incubated for 5–6 h. Then the media were removed and 30 μL1× Renilla luciferase lysis buffer (Promega) was added. The plate was shaken at room temperature for 20 min to lyse the cells. Alternatively, the plate can be frozen at −80°C for later measurements.

  7. The Renilla luciferase activity in each well was measured using the Renllia Luciferase Assay System (Promega) with 5 μL of the cell lysates from each well in the FB12 single tube luminometer (Berthold). While a plate reader capable of measuring bioluminescence can also be technically used to measure the Renilla luciferase activity, we found that the single tube luminometer typically generate more consistent results.

  8. To normalize the Renilla luciferase activity from each well, the protein concentration of the lysates was determined with Protein Assay Dye Reagent Concentrate (Bio-Rad) following manufacturer’s protocol. The Renilla luciferase activity from each well was normalized by dividing the raw Renilla luciferase activity by the amount of proteins used to give relative light units per microgram protein (RLU/μg).

  9. Representative results are shown in Fig. 6. In Fig. 6A, we showed that the construct was very responsive to CREB stimulation by Fsk. Upon Fsk stimulation, more than 20-fold stimulation was observed. We have observed that the fold of stimulation was variable across different experiments, which is at least partially due to the variable transfection efficiency for each experiment. However, Fsk should be able to robustly stimulate CREB’s transcription activity. If this stimulation is not observed, additional trouble-shooting efforts are needed. When 666–15 was preincubated with the cells prior to the addition of Fsk, dose-dependent inhibition of CREB-mediated gene transcription was observed as shown in Fig. 6B. Importantly, if Fsk was not added to stimulate CREB’s transcription activity, no obvious inhibition of the basal activity could be observed by 666–15 (Fig. 6C). Perhaps, the residual activity in the absence of Fsk was due to the preexisting Renilla luciferase synthesized prior to the addition of 666–15. In fact, during the ~5.5 h drug treatment incubation, no significant increase of Renilla luciferase was typically observed if Fsk was not added. This is again to demonstrate the importance of Fsk stimulation effect before assessing different chemical inhibitors.

Fig. 6.

Fig. 6

666–15 potently inhibited CREB-mediated gene transcription in HEK 293T cells. (A) Fsk stimulated CREB-dependent gene transcription. HEK 293T cells were transfected with CRE-RLuc reporter construct. Then the cells were treated with or without Fsk (10 μM) for 6 h. Then resulting luciferase activity was measured and analyzed as described in Section 2.2.1. (B) 666–15 inhibited CREB-dependent gene transcription. The experiments were the same as in (A) except that the cells were pretreated with increasing concentrations of 666–15 for 30 min followed by treatment with Fsk (10 μM) for 6 h before luciferase measurement. (C) 666–15 did not appreciably inhibit basal CREB activity. The experiments were performed in the same way as in (B) except that Fsk treatment was omitted. The luciferase activity was all normalized to the protein content and expressed as relative luciferase unit (RLU)/μg protein. Modified from reference Li, B. X., Gardner, R., Xue, C., Qian, D. Z., Xie, F., Thomas, G., et al. (2016). Systemic inhibition of CREB is well-tolerated in vivo. Scientific Reports, 6, 34513.

3. Conclusions

CREB is perhaps one of the best studied transcription factors. It is involved in multiple cellular functions. A large number of studies have been focusing on the understanding of how CREB regulates these cellular functions (Shaywitz & Greenberg, 1999). Numerous studies have shown that CREB is critically important in the pathogenesis of multiple types of cancers (Conkright & Montminy, 2005; Xiao et al., 2010). Interestingly, a group of different rare cancer types harbors a fusion between Ewing sarcoma gene (EWS) and CREB or its closely related transcription factor activating transcription factor 1 (ATF1) (Tsukamoto et al., 2013; Wang et al., 2009; Zucman et al., 1993). The resulting fusion EWS-CREB or EWS-ATF1 encodes a constitutively active transcription factor independent of phosphorylation (Fujimura et al., 1996) to drive the development of these rare cancers (Straessler et al., 2013; Yamada et al., 2013). Therefore, targeting CREB represents an appealing direction for developing novel anti-cancer therapies (Xiao et al., 2010). Without properly designed robust assays, it will be very difficult to evaluate the putative small molecule inhibitors. The biochemical and cell-based Renilla luciferase assays described here will provide effective and reliable methods to assess different small molecule inhibitors of CREB to derive potential candidates for further preclinical and clinical development. The inhibitors to be developed will also help further our understanding of CREB’s functions in different biological pathways (Kang et al., 2015).

Acknowledgments

This work was supported by NIH R01GM122820, R21CA220061, Oregon Health & Science University School of Medicine, Office of the Technology Transfer and Business Development, Oregon Clinical and Translational Research Institute, Medical Research Foundation of Oregon and Susan G. Komen for the Cure (KG100458). We thank Prof. Tom Kodadek (Scripps Florida) for sharing CRE-FLuc plasmid and Prof. Sanjiv Gambhir (Stanford University) for sharing Id-RLucN plasmid.

References

  1. Alluri P, Liu B, Yu P, Xiao XS, & Kodadek T (2006). Isolation and characterization of coactivator-binding peptoids from a combinatorial library. Molecular BioSystems, 2(11), 568–579. [DOI] [PubMed] [Google Scholar]
  2. Auld DS, Southall NT, Jadhav A, Johnson RL, Diller DJ, Simeonov A, et al. (2008). Characterization of chemical libraries for luciferase inhibitory activity. Journal of Medicinal Chemistry, 51(8), 2372–2386. [DOI] [PubMed] [Google Scholar]
  3. Baell JB, & Nissink JWM (2018). Seven year itch: Pan-assay interference compounds (PAINS) in 2017-utility and limitations. ACS Chemical Biology, 13(1), 36–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bakhtiarova A, Taslimi P, Elliman SJ, Kosinski PA, Hubbard B, Kavana M, et al. (2006). Resveratrol inhibits firefly luciferase. Biochemical and Biophysical Research Communications, 351(2), 481–484. [DOI] [PubMed] [Google Scholar]
  5. Cardinaux JR, Notis JC, Zhang Q, Vo N, Craig JC, Fass DM, et al. (2000). Recruitment of CREB binding protein is sufficient for CREB-mediated gene activation. Molecular and Cellular Biology, 20(5), 1546–1552. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Conkright MD, & Montminy M (2005). CREB: The unindicted cancer co-conspirator. Trends in Cell Biology, 15(9), 457–459. [DOI] [PubMed] [Google Scholar]
  7. Fujimura Y, Ohno T, Siddique H, Lee L, Rao VN, & Reddy ESP (1996). The EWS-ATF-1 gene involved inmalignant melanoma of soft parts with t(12;22) chromosome translocation, encodes a constitutive transcriptional activator. Oncogene, 12(1), 159–167. [PubMed] [Google Scholar]
  8. Gu T, Zhang Z, Wang J, Guo J, Shen WH, & Yin Y (2011). CREB is a novel nuclear target of PTEN phosphatase. Cancer Research, 71(8), 2821–2825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hagiwara M, Alberts A, Brindle P, Meinkoth J, Feramisco J, Deng T, et al. (1992). Transcriptional attenuation following cAMP induction requires PP-1-mediated dephosphorylation of CREB. Cell, 70(1), 105–113. [DOI] [PubMed] [Google Scholar]
  10. Jiang M, Li BX, Xie F, Delaney F, & Xiao X (2012). Design, synthesis, and biological evaluation of conformationally constrained analogues of naphthol AS-E as inhibitors of CREB-mediated gene transcription. Journal of Medicinal Chemistry, 55(8), 4020–4024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kang X, Lu Z, Cui C, Deng M, Fan Y, Dong B, et al. (2015). The ITIM-containing receptor LAIR1 is essential for acute myeloid leukaemia development. Nature Cell Biology, 17(5), 665–677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kerppola TK (2008). Bimolecular fluorescence complementation (BiFC) analysis as a probe of protein interactions in living cells. Annual Review of Biophysics, 37, 465–487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Li BX, Gardner R, Xue C, Qian DZ, Xie F, Thomas G, et al. (2016). Systemic inhibition of CREB is well-tolerated in vivo. Scientific Reports, 6, 34513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Li BX, & Xiao X (2009). Discovery of a small-molecule inhibitor of the KIX-KID interaction. Chembiochem: A European Journal of Chemical Biology, 10, 2721–2724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Li BX, Xie F, Fan Q, Barnhart KM, Moore CE, Rheingold AL, et al. (2014). Novel type of prodrug activation through a long-range O,N-acyl transfer: A case of water-soluble CREB inhibitor. ACS Medicinal Chemistry Letters, 5(10), 1104–1109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Li BX, Yamanaka K, & Xiao X (2012). Structure-activity relationship studies of naphthol AS-E and its derivatives as anticancer agents by inhibiting CREB-mediated gene transcription. Bioorganic and Medicinal Chemistry, 20(23), 6811–6820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Liu Y, Fang J, Cai H, Xiao F, Ding K, & Hu Y (2012). Identification and synthesis of substituted pyrrolo[2,3-d]pyrimidines as novel firefly luciferase inhibitors. Bioorganic and Medicinal Chemistry, 20(18), 5473–5482. [DOI] [PubMed] [Google Scholar]
  18. Lorenz WW, McCann RO, Longiaru M, & Cormier MJ (1991). Isolation and expression of a cDNA encoding Renilla reniformis luciferase. Proceedings of the National Academy of Sciences of the United States of America, 88(10), 4438–4442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Matthews JC, Hori K, & Cormier MJ (1977). Purification and properties of Renilla reniformis luciferase. Biochemistry, 16(1), 85–91. [DOI] [PubMed] [Google Scholar]
  20. Mayr B, & Montminy M (2001). Transcriptional regulation by the phosphorylation-dependent factor CREB. Nature Reviews: Molecular Cell Biology, 2(8), 599–609. [DOI] [PubMed] [Google Scholar]
  21. McConnell JL, & Wadzinski BE (2009). Targeting protein serine/threonine phosphatases for drug development. Molecular Pharmacology, 75(6), 1249–1261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ozawa T, Kaihara A, Sato M, Tachihara K, & Umezawa Y (2001). Split luciferase as an optical probe for detecting protein-protein interactions in mammalian cells based on protein splicing. Analytical Chemistry, 73(11), 2516–2521. [DOI] [PubMed] [Google Scholar]
  23. Paulmurugan R, & Gambhir SS (2003). Monitoring protein – protein interactions using split synthetic Renilla luciferase protein-fragment-assisted complementation. Analytical Chemistry, 75, 1584–1589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Radhakrishnan I, Perez-Alvarado GC, Parker D, Dyson HJ, Montminy MR, & Wright PE (1997). Solution structure of the KIX domain of CBP bound to the trans-activation domain of CREB: A model for activator: Coactivator interactions. Cell, 91(6), 741–752. [DOI] [PubMed] [Google Scholar]
  25. Shaywitz AJ, & Greenberg ME (1999). CREB: A stimulus-induced transcription factor activated by a diverse array of extracellular signals. Annual Review of Biochemistry, 68, 821–861. [DOI] [PubMed] [Google Scholar]
  26. Song MS, Salmena L, & Pandolfi PP (2012). The functions and regulation of the PTEN tumour suppressor. Nature Reviews: Molecular Cell Biology, 13(5), 283–296. [DOI] [PubMed] [Google Scholar]
  27. Straessler KM, Jones KB, Hu H, Jin H, van de Rijn M, & Capecchi MR (2013). Modeling clear cell sarcomagenesis in the mouse: Cell of origin differentiation state impacts tumor characteristics. Cancer Cell, 23(2), 215–227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Tsukamoto Y, Nakata Y, Futani H, Fukunaga S, Kajimoto K, & Hirota S (2013). A rare case of clear cell sarcoma with 4 types of EWSR1-ATF1 fusions detected not in primary site but in metastatic site. Pathology, Research and Practice, 209(12), 803–807. [DOI] [PubMed] [Google Scholar]
  29. Wadzinski BE, Wheat WH, Jaspers S, Peruski LF, Lickteig RL, Johnson GL, et al. (1993). Nuclear-protein phosphatase-2A dephosphorylates protein kinase a phosphorylated CREB and regulates CREB transcriptional stimulation. Molecular and Cellular Biology, 13(5), 2822–2834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Wang WL, Mayordomo E, Zhang W, Hernandez VS, Tuvin D, Garcia L, et al. (2009). Detection and characterization of EWSR1/ATF1 and EWSR1/CREB1 chimeric transcripts in clear cell sarcoma (melanoma of soft parts). Modern Pathology, 22(9), 1201–1209. [DOI] [PubMed] [Google Scholar]
  31. Xiao X, Li BX, Mitton B, Ikeda A, & Sakamoto KM (2010). Targeting CREB for cancer therapy: Friend or foe. Current Cancer Drug Targets, 10, 384–391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Xiao X, Yu P, Lim HS, Sikder D, & Kodadek T (2007). Design and synthesis of a cell-permeable synthetic transcription factor mimic. Journal of Combinatorial Chemistry, 9(4), 592–600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Xie F, Li BX, Broussard C, & Xiao X (2013). Identification, synthesis and evaluation of substituted benzofurazans as inhibitors of CREB-mediated gene transcription. Bioorganic and Medicinal Chemistry Letters, 23(19), 5371–5375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Xie F, Li BX, Kassenbrock A, Xue C, Wang X, Qian DZ, et al. (2015). Identification of a potent inhibitor of CREB-mediated gene transcription with efficacious in vivo anticancer activity. Journal of Medicinal Chemistry, 58(12), 5075–5087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Xie F, Li BX, & Xiao X (2013). Synthesis and evaluation of an O-aminated naphthol AS-E as a prodrug of CREB-mediated gene transcription inhibition. Letters in Organic Chemistry, 10, 380–384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Xie F, Li BX, & Xiao X (2017). Design, synthesis and biological evaluation of regioisomers of 666–15 as inhibitors of CREB-mediated gene transcription. Bioorganic and Medicinal Chemistry Letters, 27, 994–998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Yamada K, Ohno T, Aoki H, Semi K, Watanabe A, Moritake H, et al. (2013). EWS/ATF1 expression induces sarcomas from neural crest-derived cells in mice. Journal of Clinical Investigation, 123(2), 600–610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zucman J, Delattre O, Desmaze C, Epstein AL, Stenman G, Speleman F, et al. (1993). EWS and ATF-1 gene fusion induced by t(12,22) translocation in malignant melanoma of soft parts. Nature Genetics, 4(4), 341–345. [DOI] [PubMed] [Google Scholar]

RESOURCES