Heterozygous LMNA mutation-carrying iPSC lines from three cardiac laminopathy patients

Abstract

LMNA-related dilated cardiomyopathy (LMNA-DCM) is caused by pathogenic variants in the LMNA gene and is characterized by left ventricular chamber enlargement, reduced systolic function, and arrhythmia. Here, we generated three human induced pluripotent stem cell (iPSC) lines from peripheral blood mononuclear cells (PBMCs) of three DCM patients carrying the same single heterozygous mutation, c.398 G > A, in LMNA. All lines exhibited normal iPSC morphology, expressed high levels of pluripotency markers, showed normal karyotypes, and could differentiate into the three germ layers. These patient-specific iPSC lines can serve as invaluable tools to model in vitro pathological mechanisms of LMNA-DCM.

1.

Resource table

Unique stem cell lines identifier	1) SCVIi039-A
	2) SCVIi040-A
	3) SCVIi041-A
Alternative name(s) of stem cell lines
Institution	Stanford Cardiovascular Institute, Stanford, CA, USA
Contact information of distributor	Joseph C. Wu
	joewu@stanford.edu
Type of cell lines	iPSC
Origin	Human
Additional origin info required	SCVIi039-A: 74 y/o male, Caucasian SCVIi040-A: 76 y/o male, Caucasian SCVIi041-A: 48 y/o female, Caucasian
Cell Source	Blood-isolated peripheral blood mononuclear cells (PBMCs)
Clonality	Clonal
Method of reprogramming	Sendai virus vector
Evidence of the reprogramming transgene loss (including genomic copy if applicable)	RT-qPCR
Type of Genetic Modification	N/A
Cell culture system used	Feeder-free cell culture
Associated disease	Dilated cardiomyopathy (DCM)
Gene/locus	LMNA mutation p.Arg133Gln (c.398 G > A)
Date archived/stock date	November 12th, 2021
Cell line repository/bank
Ethical approval	https://hpscreg.eu/cell-line/SCVIi039-A https://hpscreg.eu/cell-line/SCVIi040-A https://hpscreg.eu/cell-line/SCVIi041-A The generation of the lines was approved by the Administrative Panel of Human Subjects Research under IRB #29904 “Derivation of Human Induced Pluripotent Stem Cells (Biorepository)”.

2. Resource utility

iPSC lines carrying LMNA heterozygous mutations (c.398 G > A) can be differentiated into cardiac cell types (e.g., cardiomyocytes) to investigate patient disorders such as dilated cardiomyopathy (DCM). The iPSC lines and their derivatives can serve as valuable in vitro model systems to study DCM disease mechanisms, test candidate drugs, and advance precision medicine (Table 1).

Table 1.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography bright field	Normal	Fig. 1A
Phenotype	Qualitative analysis: Immunofluorescence staining	Positive expression of pluripotency markers: Oct3/4, Nanog, and Sox2	Fig. 1B
	Quantitative analysis: RT-qPCR	Positive expression of NANOG and SOX2 in iPSCs; negative in differentiated CMs	Fig. 1D
Genotype	Whole genome array (Karyostat™ Assay) Resolution 1–2 Mb	Normal karyotype: 46, XY for SCVIi-039 and SCVIi-040, XX for SCVIi-041	Supplementary Fig. 1A
Identity	Microsatellite PCR (mPCR) or STR analysis	mPCR not performed	N/A
		16 loci tested with matching identity	Supplementary Fig. 2A,B; Also submitted in archive with journal
Mutation analysis (IF APPLICABLE)	Sequencing	Heterozygous for all three lines	Fig. 1F
	Southern blot or WGS	N/A	N/A
Microbiology and virology	Mycoplasma	Luminescence: negative	Supplementary Fig. 1B
Differentiation potential	Trilineage in vitro differentiation	Positive IF staining of the three germ layers	Fig. 1C
List of recommended germ layer markers	Expression of these markers has to be demonstrated at mRNA (RT-qPCR) or protein (IF) levels, at least 2 markers need to be shown per germ layer	Ectoderm: Otx2, Pax6; Mesoderm: Brachyury, Tbx6; Endoderm: Sox17, Foxa2	Fig. 1C
Donor screening (OPTIONAL)	HIV 1 + 2, Hepatitis B, Hepatitis C	Not performed	N/A
Genotype additional info (OPTIONAL)	Blood group genotyping	Not performed	N/A
	HLA tissue typing	Not performed	N/A

3. Resource details

Dilated cardiomyopathy (DCM) affects ~ 1 in 2,500 people worldwide and is characterized by systolic dysfunction and ventricular chamber enlargement caused by progressive thinning of the myocardium. Over 75% of known DCM cases are caused by mutations residing in 5 genes, and LMNA ranks second among them, with over 60 variants implicated in DCM (Tesson et al., 2014). Importantly, patients with variants in the LMNA gene generally experience higher rates of sudden cardiac death, ventricular tachycardia, and ventricular fibrillation compared to those carrying variants in other DCM-associated genes (e. g., TTN, TNNT2) (Gigli et al., 2019). While LMNA is known to play critical roles in a variety of cellular processes including chromatin organization, proliferation, differentiation, and mechanotransduction (Cho et al., 2019; Lee et al., 2019; Sayed et al., 2020), the precise mechanisms underlying LMNA-DCM pathogenesis remain largely obscure. Cardiovascular cell types derived from patient-specific iPSCs offer unique opportunities to model disease phenotypes in vitro and investigate underlying disease mechanisms.

Here we derived human iPSC lines from three patients with DCM that all carry the same LMNA variant, c.398 G > A, encoding for p.Arg133Gln (likely pathogenic), including a 74 year-old male (SCVIi039-A), a 76 year-old male (SCVIi040-A), and a 48 year-old female (SCVIi041-A). Reprogramming of the patient peripheral blood mononuclear cells (PBMCs) into iPSCs was performed using the Sendai virus vector containing the four Yamanaka factors. The iPSC clones displayed typical morphology (Fig. 1A). Pluripotency markers OCT3/4, NANOG, and SOX2 were expressed abundantly in the nuclei of all three lines as shown by immunofluorescence staining (Fig. 1B) and all iPSC lines exhibited the capacity to readily differentiate into the three germ layers (Fig. 1C). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) confirmed the high expression of NANOG and SOX2 mRNA in all three lines comparable to the positive control iPSC line SCVIi23-A (Fig. 1D), as well as loss of Sendai virus vector for all three lines at high passage compared to low passage control iPSC line SCVIi24-A (Fig. 1E). The heterozygous mutation in LMNA (c.398 G > A) was confirmed by Sanger sequencing and was absent in control line SCVI-273 (Fig. 1F). Normal karyotype was assessed by the KaryoStat assay (Fig. S1A) and all lines were mycoplasma-negative (Fig. S1B). Short tandem repeat (STR) analysis proved the iPSC lines had the same genetic origin with respect to their donor’s PBMCs (Fig. S2A,B).

Fig. 1.

Characterization of three iPSC lines derived from DCM patients carrying the LMNA mutation c.398 G > A. (A) Brightfield images of three LMNA-DCM iPSC lines. Scale bar = 1 mm. (B) Immunofluorescence images for DNA (DAPI; blue) and pluripotency markers NANOG (red), SOX2 (green), and OCT3/4 (magenta). Scale bar = 500 μm. (C) Immunofluorescence images of the three germ layer markers (ectoderm, mesoderm, ectoderm). Scale bar = 150 μm. (D) Quantification of NANOG and SOX2 expression (normalized to GAPDH) by qRT-PCR in the three iPSC lines (green), relative to fully differentiated cardiomyocytes (CMs) (red). iPSC line SCVIi23-A was included as positive control (blue). (E) Quantification of Sendai virus (SEV) expression by qRT-PCR at high passage (P25–27). A low passage iPSC line SCVIi24-A (passage 4; red) was included as a positive control. (F) Sanger sequencing of LMNA mutation in each iPSC line. SCVI-273 was included as a normal control.

4. Materials and methods

4.1. Reprogramming

PBMCs were isolated from patient blood using Percoll density gradient medium (GE Healthcare) and purified with several DPBS washes (Thermo Fisher Scientific #14190144). PBMCs were cultured in StemPro®−34 SFM medium (Thermo Fisher Scientific) supplemented with 100 ng/mL SCF (Peprotech), 100 ng/mL FLT3 (Thermo Fisher Scientific #PHC9414), 20 ng/mL IL-3 (Peprotech), 20 ng/mL IL-6 (Thermo Fisher), and 20 ng/mL EPO (Thermo Fisher Scientific #PHC9631). iPSC reprogramming was performed using the CytoTune^™-iPSC 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) according to manufacturer’s instructions. The transduced cells were resuspended and plated onto a Matrigel-coated plate where they were cultured in StemPro^™−34 medium. On day 7, the medium was switched to StemMACS^™ iPS-Brew XF medium (Miltenyi Biotec) until day 10–15 post-transduction when colonies appeared ready for clone picking. Selected colonies were expanded over multiple passages and frozen down until experimental usage.

4.2. Cell culture

iPSCs were cultured in StemMACS iPS-Brew XF medium on Matrigel-coated plates and changed every other day until they reached desired confluency for passaging. 10 μM of ROCK inhibitor (Y27632, Selleck Chemicals) was added during iPSC passage and then removed after 24 hrs. iPSCs were maintained in a humidified incubator at 37°C with 5% CO₂.

4.3. Immunofluorescent staining

For qualitative analysis, cells (passages 20–23) were fixed in 4% paraformaldehyde solution (Sigma-Aldrich) for 15 min, then permeabilized with 50 μg/mL digitonin (Sigma-Aldrich) for 10 min at room temperature (RT), and blocked for 30 min at RT in blocking solution (DPBS with 1% Bovine Serum Albumin and 5% goat – iPSCs; 5% serum (Donkey Serum, Sigma-Aldrich)). Cells were incubated overnight at 4°C with primary antibodies (1:200) diluted in 1% BSA. Cells were incubated for 30 min at RT with secondary antibodies diluted in 1% BSA. Cells were counter-stained with the Molecular Probes NucBlue Fixed Cell ReadyProbes Reagent (Thermo Fisher Scientific).

4.4. Tri-lineage differentiation

To validate pluripotency into the three germ layers, iPSCs (passages 21–23) were induced towards endoderm lineage with the Stem Diff^™ Definitive Endoderm Differentiation Kit (STEMCELL^™ Technologies). Mesoderm and ectoderm lineage were induced with the Human Pluripotent Stem Cell Functional Identification Kit (R&D Systems).

4.5. RT-qPCR

Total RNA was extracted (passages 25–27) and isolated using the DirectZol^™ Miniprep Kit (Zymo Research) according to manufacturer’s instructions. RT-PCR was performed using iScript^™ cDNA Synthesis Kit (BioRad) using the following protocol: 5 min at 25°C, 40 min at 46°C, and 5 min at 95°C. GAPDH, SOX2, and NANOG were amplified using commercial primers (Table 2) and Taqman^™ Gene expression Assay (Applied Biosystems^™).

Table 2.

Reagents details.

	Antibodies used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat #	RRID
Pluripotency marker	Rabbit Anti-Nanog	1:200	Protein tech Cat# 142951-1-AP	AB_1607719
Pluripotency marker	Mouse IgG2bκ Anti-Oct-3/4	1:200	Santa Cruz Biotechnology Cat# sc-5279	AB_628051
Pluripotency marker	Mouse IgG1κ Anti-Sox2	1:200	Santa Cruz Biotechnology Cat# sc-365823	AB_10842165
Ectoderm marker	Goat Anti-Otx2	1:200	R&D Systems Cat# 963273	AB_2157172
Ectoderm marker	Rabbit Anti-Pax6	1:100	Thermo Fisher Scientific Cat # 42-6600	AB_2533534
Mesoderm marker	Goat Anti-Brachyury	1:200	R&D Systems Cat# 963427	AB_2200235
Mesoderm marker	Rabbit Anti-Tbx6	1:200	Thermo Fisher Scientific Cat# PA5-35102	AB_2552412
Endoderm marker	Goat Anti-Sox17	1:200	R&D Systems Cat# 963121	AB_355060
Endoderm marker	Rabbit Anti-Foxa2	1:250	Thermo Fisher Scientific Cat# 701698	AB_2576439
Secondary antibody	Alexa Flour 488 Goat Anti-Mouse IgG1	1:1000	Thermo Fisher Scientific Cat#A-21121	AB_2535764
Secondary antibody	Alexa Flour 488 Donkey Anti-Goat IgG (H + L)	1:1000	Thermo Fisher Scientific Cat#A-11055	AB_2534102
Secondary antibody	Alexa Fluor 555 Goat Anti-Rabbit IgG (H + L)	1:500	Thermo Fisher Scientific Cat#A-21428	AB_141784
Secondary antibody	Alexa Fluor 647 Goat Anti-Mouse IgG2B	1:250	Thermo Fisher Scientific Cat#A-21242	AB_2535811
Secondary antibody	Alexa Fluor 555 Donkey Anti-Rabbit IgG (H + L)	1:500	Thermo Fisher Scientific Cat#A-31572	AB_2180682
	Primers Target	Size of band	Forward/Reverse primer (5′−3′)
Sendai virus plasmid (qPCR)	Sendai virus genome	181 bp	Mr04269880_mr
Genotyping	LMNA: c.398 G > A	280 bp	F: CTGACCTCCTGGGAGCCT R: CATGTGTTAGGTGGGGCCAT
House-keeping gene (qPCR)	GAPDH	471 bp	HS02786624_g1
Pluripotency genes (qPCR)	SOX2	258 bp	HS04234836_s1
	NANOG	327 bp	HS02387400_g1

4.6. DNA sequencing

iPSC genomic DNA (passages 11–13) was isolated using DNeasy Blood & Tissue Kit (Qiagen) according to manufacturer’s instructions and amplified by the Phusion High-Fidelity PCR Kit (Thermo Fisher). PCR primers were designed based on the region of DNA which contains the LMNA variant based on ClinVar information. DNA fragments (280 bp) spanned by primers were amplified by the Phusion High-Fidelity PCR kit (NEB). PCR reaction ran under the following conditions: 95°C at 5 min, 95°C at 15 s, 60°C at 10 s, 72°C at 1 min for 40 cycles, and 72°C at 10 min. Sanger sequencing was performed by MCLAB and sequencing data was aligned with SnapGene software.

4.7. Karyotyping

To detect chromosomal abnormalities using whole genome array, 2 × 10⁶ iPSCs (passages 9–10) were collected and analyzed using the KaryoStat^™ assay (Thermo Fisher).

4.8. Mycoplasma detection

Mycoplasma contamination (passages 23–25) was evaluated using the MycoAlert^™ Detection Kit (Lonza) according to manufacturer’s instructions.

4.9. Short tandem repeat (STR) analysis

To verify that iPSC lines matched their respective patient’s PBMCs, genomic DNA from iPSCs (passages 11–13) and PBMCs were isolated and purified using the DNeasy Blood & Tissue Kit (Qiagen). STR analysis was performed with the CLA IdentiFiler^™ Direct PCR Amplification Kit (Thermo Fisher Scientific) according to manufacturer’s instructions. Capillary electrophoresis was performed on ABI3130xl by the Stanford Protein Nucleic (PAN) facility.