Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2022 Jul 4;12:11296. doi: 10.1038/s41598-022-15411-3

Sesamin protects against neurotoxicity via inhibition of microglial activation under high glucose circumstances through modulating p38 and JNK signaling pathways

Prachya Kongtawelert 1,✉, Chayanut Kaewmool 1, Thanyaluck Phitak 1, Mattabhorn Phimphilai 2, Peraphan Pothacharoen 1, Thuzar Hla Shwe 1
PMCID: PMC9253356  PMID: 35788665

Abstract

Diabetes mellitus (DM), one of the principal causes of morbidity and mortality worldwide, is implicated in the progression of age-related neurodegenerative diseases (NDDs), in which microglial activation is a crucial mediator. Sesamin, a kind of phytochemical, shows inhibitory effects on microglial activation. The present study studied whether sesamin protects against neurotoxicity triggered by high glucose-induced microglial activation. We firstly demonstrated that high doses of glucose, which mimics hyperglycemia in DM, did induce the activation of murine BV2 microglial cells, increasing inflammatory responses such as the production of ROS or inflammatory mediators like IL-1β, TNF-⍺, and nitric oxide, through activation of p38 and JNK signaling pathways. Next, conditioned medium (CM) collected from high glucose-activated BV2 cell culture was used to show aggravated neurotoxicity in differentiated PC12 cells, indicating that high glucose-activated microglia could induce neurotoxicity. Interestingly, pretreatment of BV2 cells with sesamin diminished high glucose-induced microglia activation and inflammatory responses. Moreover, neurotoxicity in PC12 cells was found to be decreased in the group treated with CM from the sesamin-pretreated BV2 cell culture, suggesting sesamin inhibited microglial activation, thereby protecting neurons from activated microglia-mediated neurotoxicity. Thus, sesamin might be a potential compound to use in the prevention of diabetic-induced NDDs.

Subject terms: Biochemistry, Neuroscience

Introduction

Diabetes mellitus (DM) is a persistent metabolic disease characterized by chronic hyperglycemia with tissue damage-associated complications, which are leading causes of mortality globally1,2. Neuropathies including neurodegenerative diseases (NDDs) are serious complications commonly found in diabetic patients3 and accumulated verifications demonstrated that diabetes was significantly involved in developing NDDs4,5. NDDs are normally characterized by progressive destruction of neurons in the central nervous system (CNS), resulting in dysfunctions of specific brain areas, which lead to the loss of memory, cognitive decline, and movement problem; and Alzheimer's disease (AD) and Parkinson's disease (PD) are most commonly found members in the group of NDDs6,7.

Type 2 DM (T2DM), insulin-resistant diabetes, is the most prevalent type of diabetes connected with NDDs8,9. Patients with T2DM can heighten the risk of Alzheimer’s disease (AD) and Parkinson’s disease by about 1.5 and 2.2-fold, respectively, compared with patients without T2DM10,11. Recently, an abundance of research has investigated the relationship between DM and NDDs; and neuroinflammation is found to be a critical link between them. Persistent hyperglycemia of diabetic state can initiate oxidative stress and inflammation in the brain, consequently resulting in neurodegeneration12–15.

The overactivation of microglia, the CNS macrophages, is known to be a major mediator of inflammation-induced neurodegeneration. Resting microglia can be activated by various pathological stimuli in neurological environment as a physiological response to maintain brain homeostasis. Nevertheless, inordinate microglial activation generates inflammatory mediators and ROS excessively resulting in neuroinflammation and oxidative stress, two prerequisites for development of neuronal injuries which can ultimately lead to neurodegenerative disorders16–18. Previous in vivo studies showed that hyperglycemia in diabetic model can trigger microglial activation-mediated neuroinflammation and this process implicates in neurodegenerative conditions such as dementia, AD, and PD15,19,20.

Previous research demonstrated that brain glucose level is increased in diabetic hyperglycemic rats20,21. Accordingly, the treatment with high glucose concentration has been widely used to mimic diabetes-associated hyperglycemic environment in several in vitro studies that determine mechanisms of hyperglycemia-induced neuropathies. High glucose can trigger the activation of microglia, resulting in the production of reactive oxygen species (ROS) and inflammatory mediators such as nitric oxide (NO), tumor necrosis factor (TNF)-⍺, and interleukin (IL)-1β. The mitogen‑activated protein kinase (MAPK) signaling pathways, such as p38, JNK and ERK, were reported to be responsible for the glucose induced activation of microglial cells22–24. Taken together, inhibition of microglial activation and inflammation triggered by hyperglycemia might be a therapeutic approach for the prevention of neurological complications, especially NDDs, in DM.

Because of lower side effects, various phytochemicals are increasingly investigated for their advantageous effects on health25. Sesamin, a bioactive lignan compound found in sesame seed oil (Sesamum indicum), is one of the popular phytochemicals that have been determined for its biological abilities. Sesamin was reported to have potent antioxidant and anti-inflammatory activities, correlating with its various beneficial effects on multiple diseases. Prior studies revealed that sesamin exhibits therapeutic benefits on DM, complications of DM, and NDDs26–31 while it was shown to inhibit microglial activation and consequent neuroinflammation in addition32,33. Yaghoob Farbood and colleagues found that sesamin can protect against diabetes-associated cognitive decline in rats through the reduction of oxidative stress and neuronal death34. However, the effect of sesamin on neurotoxicity, particularly the microglial activation-mediated neurotoxicity initiated by hyperglycemia, is still not completely comprehended. Hence, in our study, we examined whether sesamin restrains high glucose-induced microglial activation and thereby defends PC12 cells from microglial activation-induced neurotoxicity.

Results

Cytotoxicity of glucose and sesamin on BV2 cells

In our study, high glucose concentrations, which mimic the in vitro glucose levels of diabetes and its complications, were utilized to stimulate microglial activation. It is essential to select a non-cytotoxic concentration of glucose for BV2 cells. Therefore, MTT assay was proceeded to determine the cytotoxic effect of glucose on BV2 cells. The cells were treated with different concentrations (0–100 mM) of glucose for 48 h. We found that concentrations of glucose up to 50 mM had no cytotoxicity on BV2 cells, while 100 mM of glucose showed a significant cytotoxicity (Fig. 1A). According to this result, 12.5, 25, and 50 mM glucose concentrations were chosen for further investigations.

Figure 1.

Figure 1

Effects of (A) glucose and (B) sesamin (Se) on BV2 cell viability. Cells were incubated with diverse doses of glucose (0–100 mM) or sesamin (0–80 μM) for 48 h. The BV2 cell viability was detected by MTT assay. The results are showed as the mean ± SEM from three independent experiments. **P < 0.05 versus the control group.

To make certain that sesamin concentrations used in the study were not toxic to BV2 cells, the cells were incubated with sesamin at the concentrations of 0–80 μM (twofold dilution). After 48 h of incubation, all doses of sesamin did not reveal any noticeable cytotoxicity (Fig. 1B). Therefore, three concentrations of sesamin, 10, 20, and 40 μM, were utilized in the next experiments.

High glucose enhanced microglial activation in BV2 cells

Previous studies have proved that high glucose can trigger inflammatory activation of BV2 microglial cells. In the activated state, these cells were transformed from the resting ramified phenotype to the activated amoeboid phenotype. High glucose-associated activated BV2 cells could produce ROS and inflammatory-mediated molecules, such as NO, TNF-⍺, IL-1β, and IL-6. These ROS and inflammatory mediators promote oxidative stress and neuroinflammation, which consequently cause neuronal damage or death22,35–37.

To confirm that high glucose could induce microglial activation, BV2 cells were stimulated by glucose at high concentrations (12.5, 25, and 50 mM). We firstly conducted Real-time PCR to examine the mRNA level of pro-inflammatory cytokines, which are IL-1β, TNF-⍺, and IL-6. As shown in Fig. 2A–C, glucose doses at 25 and 50 mM significantly elevated the mRNA level of all cytokines in BV2 cells, except IL-6. Accordingly, glucose dose at 50 mM was selected to investigate whether high glucose dose can augment the excretion of IL-1β and TNF-⍺ from the BV2 cells into the culture medium. From the result of ELISA (Fig. 2D,E), we discovered that 50 mM glucose could significantly augment the release of IL-1β and TNF-⍺ from BV2 cells. All these data indicated that high glucose (50 mM) does upregulate the production of IL-1β and TNF-⍺ at the transcriptional level.

Figure 2.

Figure 2

Effects of high glucose on pro-inflammatory cytokines, IL-1β, TNF-⍺, and IL6, gene expression (A), and secretion (B) in BV2 cells. Cells were incubated with either three doses of glucose (12.5, 25, 50 mM) for 24 h or only 50 mM glucose for 48 h. Next, the level of mRNA and protein of these pro-inflammatory cytokines were measured by real time-PCR and ELISA, respectively. The data are displayed as the mean ± SEM from three individual experiments. #P < 0.05 or ##P < 0.01 versus the control group.

Free radicals generated by activated microglia, including NO and ROS, play a key role in neurodegenerative progression18. Thus, we next studied the effects of high glucose in BV2 cells on the release of NO, ROS, and the gene expression of inducible nitric oxide synthases (iNOS), which is the inducible enzyme responsible for NO production, using Griess’s assay, DCFDA assay, and real-time PCR respectively. After exposing BV2 cells to high glucose doses (25 and 50 mM), significant increases in cellular ROS production (Fig. 3B), NO release and iNOS gene expression, were found out, reflecting the induction of microglial activation by high glucose (Fig. 3A,C).

Figure 3.

Figure 3

Effects of high glucose on features indicating microglial activation in BV2 cells, including nitric oxide (NO) release (A), cellular ROS generation (B), iNOS gene expression (C), and morphological alteration (D). Cells were incubated with either three doses of glucose (12.5, 25, 50 mM) or only 50 mM glucose for 24 or 48 h depending on the experiment. The experiments, composed of Griess’s assay, H2DCFDA assay, real-time PCR, and the observation under a light microscope, were performed to determine the level of nitric oxide, cellular ROS, iNOS mRNA, and also the morphological alteration, respectively. In morphological observation, photos were taken at ×20 magnification and selected from one experiment as a representative from three independent experiments. The scale bar is 50 μm. The values are demonstrated as the mean ± SEM from three independent experiments. #P < 0.05 or ##P < 0.01 versus the control group.

The alteration of BV2 cells’ morphology has been used to affirm the activation of microglia38,39. In this study, shifting to the activated form of BV2 microglial cells was observed under the light microscope after they were treated with 50 mM glucose for 48 h. The morphology of untreated BV2 cells displayed a slender soma with the distal ramification, being characterized as the resting ramified microglia. Following stimulation with high glucose, BV2 microglia had a larger spherical soma with shorter branches, and this morphology was characterized as the activated amoeboid microglia (Fig. 3D). Altogether, we could summarize that high glucose could induce the inflammatory microglial activation and consecutive production of neurotoxic molecules such as IL-1β, TNF-⍺, NO, and ROS. Glucose at 50 mM was applied to the later experiments because of its highest potency to promote inflammatory responses in BV2 cells.

High glucose-enhanced microglial activation is mediated by the activation of p38 and JNK of MAPK signaling pathways

Activation of MAPK signaling pathways, comprising p38, JNK, and ERK, has recently been reported to be a crucial process correlated to hyperglycemia-motivated inflammatory reactions in activated microglia23,39. Therefore, the phosphorylation of MAPKs in BV2 cells was explored by western blot analysis following the high glucose treatment. We found that after stimulation with 50 mM glucose for 60 min, the phosphorylated forms of p38 and JNK were increased significantly. However, the significant upregulation was not observed in ERK signaling pathway (Fig. 4A,B), indicating that high glucose triggered microglial activation via p38 and JNK signaling pathways.

Figure 4.

Figure 4

Effects of high glucose on the activation of MAPKs signaling pathways in BV2 cells. The cells were incubated with 50 mM of glucose for different times, such as 15, 30, and 60 min. The protein expression of phosphorylated(P)-p38, P-JNK, P-ERK, p38, JNK, and ERK was examined by western blot analysis (A). The band intensity of these proteins was quantified by Total lab TL120 and was utilized to analyze the level of protein expression by normalizing with the band intensity of β-actin (B). Data are presented as the means ± SEM from three distinct experiments. #P < 0.05 or ##P < 0.01 versus the control group.

Sesamin restrained high glucose-persuaded microglial activation

To examine the effect of sesamin on high glucose-induced microglial activation, BV2 cells were pre-incubated with sesamin at 10, 20, and 40 μM before high glucose (50 mM) was added to the media. In the absence of pretreatment with sesamin, 50 mM glucose obviously caused microglial activation since the results showed increased production of neurotoxic mediators (IL-1β, TNF-⍺, NO, ROS), enhanced expression of their genes (IL1B, TNFA, and iNOS), and the transformation to an activated form morphologically (Figs. 5, 6). In comparison with the sesamin untreated group, we could see that pre-incubation with sesamin at 20 and 40 μM significantly reduced the level of inflammatory mediators (IL-1β, TNF-⍺, NO) released by high glucose-activated BV2 microglia (Fig. 5B), and the expression of the indicated genes (Fig. 5A). These inhibitory effects of sesamin were dose-dependent too. Moreover, pretreating with sesamin could substantially reverse the high glucose-elevated ROS production and morphological changes in BV2 cells (Fig. 6A,B). From the results, we could suggest that sesamin inhibited the activation of microglia induced by high glucose and consequent inflammatory responses.

Figure 5.

Figure 5

Effects of sesamin on inflammatory gene expression (A) and secretion of inflammatory mediators (B) in high glucose-activated BV2 cells. The pretreatment of BV2 cells with sesamin (10, 20, 40 μM) for 4 h was performed before BV2 cells were treated with 50 mM of glucose. Following the incubation for 24 or 48 h, the gene expression (IL1B, TNFA, iNOS) and the secretion of inflammatory mediators (IL-1β, TNF-⍺, NO) were tested by real-time PCR and ELISA, other than NO that was studied by Griess’s assay. The outcomes are shown as the means ± SEM from three individual experiments. #P < 0.05 versus the control group and *P < 0.05 or **P < 0.01 versus the glucose-treated group.

Figure 6.

Figure 6

Effects of sesamin on cellular ROS generation (A) and morphological alteration (B) in high glucose-activated BV2 cells. The pre-incubation of BV2 cells with sesamin (10, 20, 40 μM) for 4 h was carried out before BV2 cells were incubated with 50 mM of glucose. After 24 or 48 h, cellular ROS generation and morphological change were inquired by H2DCFDA assay and the observation under a light microscope), respectively. In morphological observation, photos were taken at ×20 magnification and selected from one experiment as a representative from three independent experiments. The scale bar is 50 μm. The results are exhibited as the means ± SEM from three separate experiments. #P < 0.05 versus the control group and *P < 0.05 or **P < 0.01 versus the glucose-treated group.

Sesamin diminished high glucose-induced microglial activation by modulating the activation of p38 and JNK signaling pathways

As the previous experiment implied that the activation of p38 and JNK were involved in high glucose-induced microglial activation, we investigated whether these signaling pathways are linked to the inhibitory effect of sesamin on BV2 microglial activation stimulated by high glucose. The results revealed that while high glucose considerably enhanced the phosphorylation of p38 and JNK compared to control, sesamin pretreatment in BV2 cells significantly deterred that enhancement in a dose dependent manner (Fig. 7A,B). These evidences hinted that anti-microglial activation effects of sesamin were related to the inhibition of p38 and JNK activation.

Figure 7.

Figure 7

Effects of sesamin on the activation of p38 and JNK MAPKs signaling pathways in high glucose-activated BV2 cells. The cells were pretreated with sesamin (10, 20, 40 μM) for 4 h and then were exposed to 50 mM of glucose for 60 min. After that, the protein expression of P-p38, P-JNK, p38, and JNK was determined by western blot assay (A). The band intensity of these proteins was measured by Total lab TL120 and was utilized to analyze the level of protein expression by normalizing with the band intensity of β-actin (B). The values are demonstrated as the means ± SEM from three diverse experiments. #P < 0.05 versus the control group and *P < 0.05 or **P < 0.01 versus the glucose-treated group.

Inhibitory effects of sesamin on high glucose-induced microglial activation defended PC12 cells from neurotoxicity triggered by activated microglia

The model of culturing differentiated PC12 cells in BV2 microglial conditioned medium (CM) has been vastly used in previous researches to study whether the anti-microglial activation effect of compounds result in the protection of neurons against neuronal damage or death provoked by microglial activation40. In this experiment, we investigated the neuroprotective effect of sesamin by treating PC12 cells with the conditioned medium collected from BV2 cell culture for 48 h. The neurotoxicity and morphology of PC12 cells were then determined using MTT assay and light microscope, respectively. The results showed that CM from BV2 cells treated with high glucose-alone caused a significant decrease in PC12 cell viability comparing with the CM from control BV2 cells, implying that it had a neurotoxic effect on PC12 cells. In contrast, the cell viability was not diminished in PC12 cells incubated with CM from high glucose and sesamin treated BV2 cells (Fig. 8). Corresponding to the neurotoxicity results, the detrimental morphology with a smaller soma and degraded neurite outgrowth was found in PC12 cells cultured in the CM from high glucose-stimulated BV2 cells. As expected, the damaged cell morphology was improved in PC12 cells cultured in the CM from sesamin-pretreated BV2 cells. These results point out that anti-microglial activation capabilities of sesamin in BV2 cells could subsequently protect PC12 cells from activated microglial-induced neurotoxicity.

Figure 8.

Figure 8

Indirect effects of sesamin on PC12 cell neurotoxicity induced by conditioned medium (CM) from high glucose-activated BV2 microglia. PC12 cells were exposed to CM from the BV2 cell culture. CM collected from BV2 cells were divided into six groups: CM from control BV2 cells (CM_Control), CM from BV cells treated with glucose alone (50 mM) (CM_Glucose 50 mM), CM from BV cells treated with sesamin (10, 20 and 40 μM) and glucose (50 mM)- (CM_Glucose + Se), and CM from BV cells treated with sesamin (40 μM) alone (CM_Se). Following incubation with CM for 48 h, PC12 cell viability was detected by MTT assay (A), and the morphology of PC12 cells was observed using a light microscope (B). In morphological observation, photos were taken at ×20 magnification and selected from one experiment as a representative from three independent experiments. The scale bar is 100 μm. The data is presented as a mean ± SEM of three different experiments. #P < 0.05 versus CM_Control group and *P < 0.05 and **P < 0.01 versus the CM_Glucose 50 mM group.

Discussion

DM is one of the most common chronic metabolic disorders worldwide and the major characterization of DM is high blood glucose, hyperglycemia, which contributes to severe brain complications, such as NDDs41,42. Since many studies affirmed that type 2 DM patients have a higher risk of developing NDDs (AD and PD) when compared with non-diabetic patients43,44, the discovery of the preventive strategy for DM-induced NDDs has become critical for the diabetic patients.

Currently, growing evidence confirmed the crucial role of microglia in the development of diabetes neuropathies as well as NDDs45–47. While any brain injury or pathological stimuli can trigger activation of brain’s microglia, the counterpart of peripheral macrophages, which are serving as a sensor of brain injury, the activation leads to various inflammatory responses during which an abundance of inflammatory mediators and neurotoxic factors were excreted influencing neighboring neurons and brain homeostasis processes. Excessive microglial activation and subsequent neuroinflammation undoubtedly initiate deterioration of neurons resulting in progression of NDDs18,48–50. It has been confirmed that hyperglycemia in diabetic conditions can cause an inflammatory microglial activation, and consequent neurodegeneration in the distinct NDDs models like AD and PD47,51–54. From all evidence, we hypothesized that modulation of microglial activation may be a therapeutic option in diabetes-aggravated NDDs.

Although Hwang and research group reported that extent of intracerebral glucose increased upon hyperglycemia was smaller in type 2 DM patients compared with healthy volunteers55, other research revealed the concentration of brain glucose is escalated in chronically hyperglycemic diabetic rat21,56. Over the past few years, many studies have applied high dosage-glucose treatment to imitate the hyperglycemic condition of diabetes in in vitro experiments which are discovering the mechanism of brain complications triggered by hyperglycemic circumstances57–59. Our study, likewise, utilized high glucose doses to attest its effects on microglial cells; 12.5, 25, 50 mM glucose were used to mimic the sugar levels in diabetes mellitus and its complications, diabetic ketoacidosis and hyperglycemia hyperosmolar status24,60. We discovered that the high glucose concentrations could clearly promote the activation of microglia along with a significant increment in the production of inflammatory factors particularly pro-inflammatory cytokines (IL-1β and TNF-⍺) and nitric oxide (NO), and their productions were regulated at their mRNA level. In addition, we confirmed the role of high glucose in the microglial activation utilizing the morphology of BV2 cells which was altered from the resting ramified feature to the activated amoeboid feature after being exposed to high dosage glucose. Our results are consistent with prior studies that suggested high glucose could induce inflammatory microglial activation in vitro23,59,61.

Here, many previous studies implicating high glucose treatment proved that correction of osmolality showed no significant effect on inflammation or oxidative stress as the use of glucose itself in various neuronal cells58,62–64. While high glucose at 50 mM significantly augmented LPS-induced microglial activation reflected by increased production of cytokines such as TNF-α and IL-6, the osmotic control, mannitol, did not show similar changes in primary rat microglia cells58. Similarly, in BV2 cells, high glucose, 25 mM or 33 mM, significantly induced microglial activation and ROS production, but, mannitol, in the concentration comparable to the glucose used, did not63,64. Although there was no previous study that used osmolality correction as high as 50 mM in BV2 cells, one study in PC12 cells demonstrated that the influence of mannitol was not seen until the osmolality increased up to 150 mM62. Hence, it can be assured that change in osmolality due to high dose glucose used in this study does not interfere with the results on effects of high glucose, including inflammatory responses and oxidative stress, observed in BV2 cells.

MAPK signaling pathways have been informed to be important pathways involved in hyperglycemia or high glucose-persuaded microglial activation in diabetic models. Previous examinations revealed that high glucose caused the elevated phosphorylation of MAPKs, p38, JNK, and ERK, in microglia22,23,65. Consistent with these data, in this study, a significant increment of phosphorylated MAPKs, except ERK, was observed in BV2 cells treated with 50 mM glucose; the phosphorylation of ERK was slightly increased though not significant.

As mentioned above, limiting microglial activation may be the potential way to prevent diabetic NDDs. Over a decade, phytochemicals have received an increasing interest for their therapeutic effects on several diseases along with lesser adverse effects66,67. Therefore, we paid an attention to sesamin, a phytochemical with numerous reported beneficial effects on diabetes and its brain complications. Sesamin is a type of lignans extracted from sesame seed oil (Sesamum indicum) and its powerful antioxidant and anti-inflammatory properties were approved by various studies28,68,69. Since there are in vivo affirmations of the blood–brain barrier permeability of sesamin70, recent researches focused on the neuroprotective effects of this compound. Sesamin exhibited the inhibitory effects against microglial activation induced by lots of stimuli71–73 and also a protective role in many neurodegenerative models, for instance, AD and PD27,74–76. Furthermore, Farbood and associates presented that sesamin defended rats from diabetes-aggravated hyperglycemia and subsequent cognitive decline34. Although protective effects of sesamin against hyperglycemia-mediated neuropathies have been confirmed, its effects on neurotoxicity, triggered by hyperglycemia via microglial activation, have not been clarified yet. Hence, we tried to find out whether sesamin inhibits the microglial activation under high glucose condition and its subsequent neuroprotective effect.

From our results, sesamin was shown to hinder high glucose-caused microglial activation. In high glucose-exposed BV2 microglia, a decrease of activated amoeboid morphology was observed when pretreated with sesamin in addition to a significant reduction of the release of inflammatory mediators like nitric oxide, IL-1β, and TNF-⍺ which was regulated at the transcriptional level. Furthermore, the anti-microglial activation abilities of sesamin were found to be related with the decrement of p38 and JNK phosphorylation corresponding with previous studies which proved that the inhibitory effects of sesamin against microglial activation are linked with the restraint of p38 and JNK signaling pathways72,73,77. Overall, we could imply that sesamin diminished inflammatory microglial activation under high glucose condition through inhibition of the p38 and JNK activation.

The system of culturing differentiated PC12 cells in BV2 microglial-conditioned medium (CM), which can emulate the activated microglia-neurons interaction in brain, has been utilized in the research that are interested in the effects of compounds on neurodegeneration triggered by activated microglia40,78,79. We applied this system to investigate how sesamin affects microglial activation-induced neuronal detriment in this study. While the CM from high glucose-treated BV2 cells had a toxic effect on differentiated PC12 cells as expected, the pre-incubation of BV2 cells with sesamin could defend PC12 cells from neurotoxicity, interestingly. Both cell viability and morphology of PC12 cells exposed to the CM from activated BV12 cells were improved by the pretreatment with sesamin. It is suggestive that sesamin protects PC12 cells by downregulating the production and secretion of pro-inflammatory mediators, TNF-⍺, IL-1β and nitric oxide, from high glucose-stimulated BV2 cells.

However, blockade of production of harmful mediators from microglial activation is not the sole pathway of neuroprotection by sesamin. Sesamin itself also has a direct protective effect on neuronal cells since it was reported to inhibit the apoptotic cell death of PC12 cells resulting from the inflammation, oxidative stress or nitrosative stress80,81. In our previous work, the apoptosis of PC12 cells exposed to the conditioned medium from LPS-treated BV2 cells can be reduced by direct sesamin treatment on PC12 cells81. Moreover, Bournival et al. showed that sesamin protects PC12 cells from high glucose-induced cell death through anti-apoptotic properties or anti-oxidative effect via increasing superoxide dismutase activity80. These studies suggested sesamin might directly protects PC12 cells exposed to the CM from high glucose-activated BV2 cells. Approximately 20% of sesamin was remained in the media of BV2 culture after 24- or 48-h treatment period compared to the sesamin control at ‘0’ hour (Supplementary Fig. S1). Since there was still sesamin left in the conditioned media that was used to treat PC12 cells, this could be an additional protective factor acting directly in PC12 cells beside its inhibitory effect on BV2 cells activation. Regretfully, it was one of the limitations of this study not to explore the direct effect of sesamin in PC12 cells. Anyhow, at least from the results of previous studies, it can be speculated that sesamin act not only in BV2 cells but also in PC12 cells, directly protecting them probably through inhibition of apoptotic pathways via reduction of oxidative or nitrosative stress.

Altogether, our results suggested that sesamin could improve inflammatory microglial activation, under high glucose circumstance, resulting in the protection of PC12 cells against activated microglial-mediated neurotoxicity. These results pointed out that the suppression of microglial activation by sesamin may be a preventive approach for hyperglycemia-associated NDDs in DM patients. However, as this finding is from in vitro experiments, it is crucial to further affirm the role of sesamin as a protective factor against microglial activation-mediated neurodegeneration using the diabetic animal model and clinical trials.

Methods

Cell culture, treatment, and conditioned medium (CM) preparation

Murine BV2 microglial cell line was acquired from ICLC (Genova, Italy). These cells were cultured in low glucose (1 g/L or 5.5 mM) glucose Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Grand Island, NY, USA) supplemented with 10% (v/v) heat-inactivated fetal calf serum (FCS) (Gibco, Grand Island, NY, USA), 100 units/mL penicillin, and 100 μg/mL streptomycin (Gibco, Grand Island, NY, USA). Cell lines were sustained in 37 °C humidified incubator under 5% CO2. In the experiments, BV2 cells were seeded in different multi-well plates. The number of cells was 1 × 104 or 5 × 104 cells/well in 96- or 24-well plates, respectively. Next, these cells were untreated or pretreated with sesamin at concentrations of 10, 20, and 40 μM for 4 h and then treated with either various concentrations (12.5, 25, 50 mM) of glucose (Sigma-Aldrich, St. Louis, MO, USA) or only glucose at 50 mM for various durations such as 15–60 min or 24- or 48-h depending on the experiment.

The conditioned medium (CM) from BV2 cell culture was prepared to treat PC12 cells. CM was collected from 6 groups, comprising control, glucose 50 mM, glucose with sesamin (Se) 10 μM, glucose with Se 20 μM, glucose with Se 40 μM, and Se alone. After 48 h-exposure of BV2 cells to 50 mM glucose, the culture medium was gathered and centrifuged at 150g for 5 min prior to displacing cell debris. The CM was stored at − 20 °C and preheated before utilization. Then, CM was added to differentiated PC12 cell culture.

Rat pheochromocytoma PC12 cell line was procured from CLS (Eppelheim Germany). The cells were grown in 10% (v/v) horse serum, HS (Gibco-BRL, Grand Island, NY, USA), 5% (v/v) FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin mixed in high glucose (4.5 g/L or 25 mM) DMEM. Before plating PC12 cells in multi-well plates, 0.1 mg/mL poly-l-lysine (Sigma-Aldrich, St. Louis, MO, USA) was coated on each well plate. Cell concentration was 2 × 104 or 4.5 × 105 cells/well in 96- or 6-well plates, respectively. The experiment was performed after the induction of PC12 cells by 40 ng/mL of nerve growth factor (NGF, R&D Systems, Minneapolis, MN) to be differentiated into neuron-like cells.

Preparation of sesamin

Sesamin was extracted from sesame seeds obtained from Lampang province, Thailand. The voucher specimens (BKF no. 138181) were approved by the National Park, Wildlife and Plant Conservation Department, Ministry of Natural Resources and Environment, Bangkok, Thailand. Sesamin was prepared as previously reported in Phitak’s study and confirmed to be identical to trustworthy sesamin sources (Sigma Aldrich)82. Sesamin obtained was firstly dissolved in dimethyl sulfoxide (DMSO) to make a stock solution (100 mM) and then diluted to desired concentrations using the culture media. All the experiments are done in compliance with relevant institutional guidelines.

Cytotoxicity assays

The cytotoxicity of glucose or sesamin in BV2 cells was investigated by 3-(4,5-dimethyl-thiazol-2-yl)-2, 5-diphenyltetrazolium bromide, MTT (Sigma-Aldrich, St. Louis, MO) assay. Concisely, BV2 cells were treated with several concentrations of glucose or sesamin for 48 h. For PC12 cells, they were treated with CM from different groups. After the treatment, both BV2 and PC12 cells were incubated with 0.5 mg/mL MTT solution diluted in DMEM without serum for 4 h under 37 °C. Next, the DMEM was replaced by dimethyl sulfoxide (DMSO) (Sigma-Aldrich, St. Louis, MO, USA) to dissolve the formazan crystals. After shaking the plate, the optical density (OD) at 540 nm was measured using a microplate reader. The results were shown as the percentage of cell viability compared with the control group.

Morphological examination

The morphology of BV2 cells and PC12 cells were inspected under a light microscope and pictures were taken at 20× magnification using EOS Utility Software—Canon USA, Inc. In BV2 cells, we observed the transformation from resting state (ramified shape) to activated state (amoeboid shape). In PC12 cells, we observed the appearances of neurodegeneration.

Real-time PCR assay

The extraction of total cellular RNA from BV2 cells was carried out using the illustra RNAspin Mini Kit (GE healthcare, Europe GmbH, Freiburg, Germany). In reverse transcription processes, 500 ng of total RNA was converted to cDNA using iScriptTM cDNA synthesis kit (Bio-rad, Hercules, CA, USA) according to the provider’s protocol. The mRNA levels of inflammatory genes were determined by real-time PCR using SensiFAST TM SYBR® Lo-ROX (Bio-Rad, Hercules, CA, USA). Reactions were directed in Applied Biosystems 7500/7500 Fast Real-Time PCR system. The mRNA levels of target genes were estimated relatively with that of β-actin (ACTB) using the 2−ΔΔC(T) method. The primer sequences of genes used in this study are described in Table 1.

Table 1.

List of primer sequences used for the mRNA level study.

Gene names Sequence (5′–3′) Accession number
IL1B F: GACCTGCTTCTTTGAGGCTGAC R: TTCATCTCGAAGCCTGCAGTG NM_031512.2
IL6 F: AAAGAGTTGTGCAATGGCAATTCT R: AAGTGCATCATCGTTGTTCATACA NM_012589.2
TNFA F: CTCCAGCTGGAAGACTCCTCCCAG R: CCCGACTACGTGCTCCTCACC NM_012675.3
iNOS F: CGTGAAGAAAACCCCTTGTG R: CAAAATCTCTCCACTGCCCC NM_010927.4
ACTB F: GTAAAGACCTCTATGCCAACA R: GGACTCATCGTACTCCTGCT MN_031144.3

Inflammatory cytokine release assay

The medium retained from the BV2 cell culture was examined for the level of inflammatory cytokines, including IL-1β and IL-6, using ELISA kits (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. The concentration of each inflammatory cytokine was calculated by the calibration curve of known concentrations of the respective inflammatory cytokine.

NO release assay

The culture medium of BV2 cells was collected for nitric oxide (NO) measurement using Griess’s method. This medium was fused with the same volume of the Griess reagent. After incubating in the dark for 15 min, the absorbance at 540 nm was evaluated using a microplate reader. NO level in the medium was calculated from the sodium nitrite calibration curve and then shown as the relative values compared with the control group.

Intracellular ROS assay

ROS generation in BV2 cells was investigated by measuring the fluorescence intensity of cultures after the addition of cell-permeable H2DCFDA (2′,7′-dichlorofluorescein diacetate) (Sigma-Aldrich, St. Louis, MO, USA). When the indicated treatment period was completed, cells were washed one time with phosphate-buffered saline (PBS) and incubated with 10 μM H2DCFDA for 30 min at 37 °C. After the washing step, the fluorescence intensity of dichlorofluorescein (DCF), the altered form of H2DCFDA induced by ROS oxidation, was quantified using a SynergyTM H4 Hybrid Multi-Mode Microplate Reader with 485 nm excitation and 528 nm emission wavelengths. The results were presented relative to the control group.

Western blot assay

BV2 cells were harvested and lysed with lysis buffer after being exposed to the intended treatments. Cell debris was removed following the centrifugation, and then the supernatants were collected. The Bradford protein reagent (Bio-Rad, Munich, Germany) was used to measure protein concentrations. The separation of proteins was executed using 12% SDS-PAGE before the proteins were shifted to the nitrocellulose membrane (GE Healthcare Europe GmbH, Freiburg, Germany). After that, the membranes were blocked and exposed to specific antibodies, antibodies against p38, p-p38, JNK, p-JNK, ERK, p- ERK, and β-actin overnight at 4 °C. The used dilution of these antibodies (Cell Signaling Technology, MA, USA) was 1:1000. The membranes were then incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000 dilution) prior to the band detection using a Supersignal West Femto Maximum Sensitivity Substrate kit (Thermo Fisher, Lifetechnologies). The relative band intensity to control was analyzed by the TotalLab TL120 software v2006 (for Windows, TotalLab software, Newcastle upon Tyne, UK, www.nonlinear.com). β-actin was used as the internal control.

Statistics

The experiments were repeated at least three times independently and the results were expressed as a mean ± SEM. The data from the experiment were analyzed using the one-way analysis of variance (ANOVA) followed by Post Hoc multiple comparison. The calculations were carried out using SPSS software. P-value < 0.05 or 0.01 indicated the statistical significance.

Conclusion

The present results revealed that high glucose condition induced microglial activation and inflammatory reactions in BV2 cells via the activation of p38 and JNK signaling pathways. Additionally, the CM of high glucose-activated BV2 cell culture induced neurotoxicity in differentiated PC12 cells. This outcome indicated that neurotoxicity was mediated by high glucose-provoked microglial activation. Next, we discovered that sesamin possessed the potent abilities to restrain inflammatory microglial activation and the underlying mechanism correlated with these inhibitory potentials is the modulation of p38 and JNK activation. Moreover, the anti-microglial activation effects of sesamin could protect PC12 cells against activated microglia-promoted neurotoxicity. Thus, sesamin might be a promising compound to be used for the prevention of diabetes-associated NDDs.

Supplementary Information

Supplementary Figures. (14.2MB, docx)

Acknowledgements

This research was supported by Thailand Excellence Center for Tissue Engineering and Stem Cells, Chiang Mai University, Thailand.

Author contributions

Study conception, design and methodology were contributed by P.K., C.K., T.P. and P.P. Materials and resources are supplied by P.K. Investigations, Data curation and analysis were performed by C.K. and M.P. The first draft of the manuscript was prepared by C.K., T.H.S. and P.K. Reviewing and editing was done by T.P., P.P. and P.K. All authors have read and approved the final submitted manuscript.

Funding

The authors declare that no funding was received for conducting this study.

Data availability

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-022-15411-3.

References

  • 1.Sima AA. Diabetes underlies common neurological disorders. Ann. Neurol. 2004;56(4):459–461. doi: 10.1002/ana.20249. [DOI] [PubMed] [Google Scholar]
  • 2.Saeedi P, et al. Mortality attributable to diabetes in 20–79 years old adults, 2019 estimates: Results from the International Diabetes Federation Diabetes Atlas, 9(th) edition. Diabetes Res. Clin. Pract. 2020;162:108086. doi: 10.1016/j.diabres.2020.108086. [DOI] [PubMed] [Google Scholar]
  • 3.Khazaei H, Pesce M, Patruno A, Aneva IY, Farzaei MH. Medicinal plants for diabetes associated neurodegenerative diseases: A systematic review of preclinical studies. Phytother. Res. 2021;35(4):1697–1718. doi: 10.1002/ptr.6903. [DOI] [PubMed] [Google Scholar]
  • 4.Schernhammer E, Hansen J, Rugbjerg K, Wermuth L, Ritz B. Diabetes and the risk of developing Parkinson's disease in Denmark. Diabetes Care. 2011;34(5):1102–1108. doi: 10.2337/dc10-1333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Profenno LA, Porsteinsson AP, Faraone SV. Meta-analysis of Alzheimer's disease risk with obesity, diabetes, and related disorders. Biol. Psychiatry. 2010;67(6):505–512. doi: 10.1016/j.biopsych.2009.02.013. [DOI] [PubMed] [Google Scholar]
  • 6.Gao HM, Hong JS. Why neurodegenerative diseases are progressive: Uncontrolled inflammation drives disease progression. Trends Immunol. 2008;29(8):357–365. doi: 10.1016/j.it.2008.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Landrigan PJ, et al. Early environmental origins of neurodegenerative disease in later life. Environ. Health Perspect. 2005;113(9):1230–1233. doi: 10.1289/ehp.7571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Saini V. Molecular mechanisms of insulin resistance in type 2 diabetes mellitus. World J. Diabetes. 2010;1(3):68–75. doi: 10.4239/wjd.v1.i3.68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Jayaraman A, Pike CJ. Alzheimer's disease and type 2 diabetes: Multiple mechanisms contribute to interactions. Curr. Diabetes Rep. 2014;14(4):476. doi: 10.1007/s11892-014-0476-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Shi Q, Liu S, Fonseca VA, Thethi TK, Shi L. Effect of metformin on neurodegenerative disease among elderly adult US veterans with type 2 diabetes mellitus. BMJ Open. 2019;9(7):e024954. doi: 10.1136/bmjopen-2018-024954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Wahlqvist ML, et al. Metformin-inclusive sulfonylurea therapy reduces the risk of Parkinson's disease occurring with Type 2 diabetes in a Taiwanese population cohort. Parkinsonism Relat. Disord. 2012;18(6):753–758. doi: 10.1016/j.parkreldis.2012.03.010. [DOI] [PubMed] [Google Scholar]
  • 12.Pugazhenthi S, Qin L, Reddy PH. Common neurodegenerative pathways in obesity, diabetes, and Alzheimer's disease. Biochim. Biophys. Acta Mol. Basis Dis. 2017;1863(5):1037–1045. doi: 10.1016/j.bbadis.2016.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Elahi M, et al. Region-specific vulnerability to oxidative stress, neuroinflammation, and tau hyperphosphorylation in experimental diabetes mellitus mice. J. Alzheimers Dis. 2016;51(4):1209–1224. doi: 10.3233/JAD-150820. [DOI] [PubMed] [Google Scholar]
  • 14.Sandireddy R, Yerra VG, Areti A, Komirishetty P, Kumar A. Neuroinflammation and oxidative stress in diabetic neuropathy: Futuristic strategies based on these targets. Int. J. Endocrinol. 2014;2014:674987. doi: 10.1155/2014/674987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rom S, et al. Hyperglycemia-driven neuroinflammation compromises BBB leading to memory loss in both diabetes mellitus (DM) type 1 and type 2 mouse models. Mol. Neurobiol. 2019;56(3):1883–1896. doi: 10.1007/s12035-018-1195-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Streit WJ, Mrak RE, Griffin WS. Microglia and neuroinflammation: A pathological perspective. J. Neuroinflamm. 2004;1(1):14. doi: 10.1186/1742-2094-1-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Leng F, Edison P. Neuroinflammation and microglial activation in Alzheimer disease: Where do we go from here? Nat. Rev. Neurol. 2021;17(3):157–172. doi: 10.1038/s41582-020-00435-y. [DOI] [PubMed] [Google Scholar]
  • 18.Lull ME, Block ML. Microglial activation and chronic neurodegeneration. Neurotherapeutics. 2010;7(4):354–365. doi: 10.1016/j.nurt.2010.05.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Murtishaw AS, et al. Intermittent streptozotocin administration induces behavioral and pathological features relevant to Alzheimer's disease and vascular dementia. Neuropharmacology. 2018;137:164–177. doi: 10.1016/j.neuropharm.2018.04.021. [DOI] [PubMed] [Google Scholar]
  • 20.Renaud J, et al. Dopaminergic neurodegeneration in a rat model of long-term hyperglycemia: Preferential degeneration of the nigrostriatal motor pathway. Neurobiol. Aging. 2018;69:117–128. doi: 10.1016/j.neurobiolaging.2018.05.010. [DOI] [PubMed] [Google Scholar]
  • 21.Jacob RJ, Fan X, Evans ML, Dziura J, Sherwin RS. Brain glucose levels are elevated in chronically hyperglycemic diabetic rats: No evidence for protective adaptation by the blood brain barrier. Metabolism. 2002;51(12):1522–1524. doi: 10.1053/meta.2002.36347. [DOI] [PubMed] [Google Scholar]
  • 22.Hsieh CF, Liu CK, Lee CT, Yu LE, Wang JY. Acute glucose fluctuation impacts microglial activity, leading to inflammatory activation or self-degradation. Sci. Rep. 2019;9(1):840. doi: 10.1038/s41598-018-37215-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li Y, et al. TREM2 regulates high glucose-induced microglial inflammation via the NLRP3 signaling pathway. Brain Sci. 2021 doi: 10.3390/brainsci11070896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zhang J, et al. TREM-2-p38 MAPK signaling regulates neuroinflammation during chronic cerebral hypoperfusion combined with diabetes mellitus. J. Neuroinflamm. 2020;17(1):2. doi: 10.1186/s12974-019-1688-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Krishnaiah D, Sarbatly R, Bono A. Phytochemical antioxidants for health and medicine—A move towards nature. Biotechnol. Mol. Biol. Rev. 2007;1:97–104. [Google Scholar]
  • 26.Thuy TD, et al. Novel therapeutic effects of sesamin on diabetes-induced cardiac dysfunction. Mol. Med. Rep. 2017;15(5):2949–2956. doi: 10.3892/mmr.2017.6420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Keowkase R, Shoomarom N, Bunargin W, Sitthithaworn W, Weerapreeyakul N. Sesamin and sesamolin reduce amyloid-beta toxicity in a transgenic Caenorhabditis elegans. Biomed. Pharmacother. 2018;107:656–664. doi: 10.1016/j.biopha.2018.08.037. [DOI] [PubMed] [Google Scholar]
  • 28.Mohammad Shahi M, Zakerzadeh M, Zakerkish M, Zarei M, Saki A. Effect of sesamin supplementation on glycemic status, inflammatory markers, and adiponectin levels in patients with type 2 diabetes mellitus. J. Diet. Suppl. 2017;14(1):65–75. doi: 10.1080/19390211.2016.1204404. [DOI] [PubMed] [Google Scholar]
  • 29.Utsunomiya T, et al. Antioxidant and anti-inflammatory effects of a diet supplemented with sesamin on hepatic ischemia-reperfusion injury in rats. Hepatogastroenterology. 2003;50(53):1609–1613. [PubMed] [Google Scholar]
  • 30.Ahmad S, et al. Anti-inflammatory role of sesamin in STZ induced mice model of diabetic retinopathy. J. Neuroimmunol. 2016;295–296:47–53. doi: 10.1016/j.jneuroim.2016.04.002. [DOI] [PubMed] [Google Scholar]
  • 31.Bournival J, Plouffe M, Renaud J, Provencher C, Martinoli MG. Quercetin and sesamin protect dopaminergic cells from MPP+-induced neuroinflammation in a microglial (N9)-neuronal (PC12) coculture system. Oxid. Med. Cell Longev. 2012;2012:921941. doi: 10.1155/2012/921941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Zhao Y, et al. (+)-Sesamin attenuates chronic unpredictable mild stress-induced depressive-like behaviors and memory deficits via suppression of neuroinflammation. J. Nutr. Biochem. 2019;64:61–71. doi: 10.1016/j.jnutbio.2018.10.006. [DOI] [PubMed] [Google Scholar]
  • 33.Ahmad S, et al. Sesamin attenuates neurotoxicity in mouse model of ischemic brain stroke. Neurotoxicology. 2014;45:100–110. doi: 10.1016/j.neuro.2014.10.002. [DOI] [PubMed] [Google Scholar]
  • 34.Farbood Y, et al. Sesamin: A promising protective agent against diabetes-associated cognitive decline in rats. Life Sci. 2019;230:169–177. doi: 10.1016/j.lfs.2019.05.071. [DOI] [PubMed] [Google Scholar]
  • 35.Zhang T, et al. Erianin alleviates diabetic retinopathy by reducing retinal inflammation initiated by microglial cells via inhibiting hyperglycemia-mediated ERK1/2-NF-kappaB signaling pathway. FASEB J. 2019;33(11):11776–11790. doi: 10.1096/fj.201802614RRR. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Onasanwo SA, Velagapudi R, El-Bakoush A, Olajide OA. Inhibition of neuroinflammation in BV2 microglia by the biflavonoid kolaviron is dependent on the Nrf2/ARE antioxidant protective mechanism. Mol. Cell Biochem. 2016;414(1–2):23–36. doi: 10.1007/s11010-016-2655-8. [DOI] [PubMed] [Google Scholar]
  • 37.Yang L, Tong Y, Chen PF, Miao S, Zhou RY. Neuroprotection of dihydrotestosterone via suppression of the toll-like receptor 4/nuclear factor-kappa B signaling pathway in high glucose-induced BV-2 microglia inflammatory responses. NeuroReport. 2020;31(2):139–147. doi: 10.1097/WNR.0000000000001385. [DOI] [PubMed] [Google Scholar]
  • 38.Dai XJ, et al. Activation of BV2 microglia by lipopolysaccharide triggers an inflammatory reaction in PC12 cell apoptosis through a toll-like receptor 4-dependent pathway. Cell Stress Chaperones. 2015;20(2):321–331. doi: 10.1007/s12192-014-0552-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Song XY, et al. IMM-H004, a novel coumarin derivative compound, attenuates the production of inflammatory mediatory mediators in lipopolysaccharide-activated BV2 microglia. Brain Res. Bull. 2014;106:30–38. doi: 10.1016/j.brainresbull.2014.05.002. [DOI] [PubMed] [Google Scholar]
  • 40.Kaewmool C, Udomruk S, Phitak T, Pothacharoen P, Kongtawelert P. Cyanidin-3-O-glucoside protects PC12 cells against neuronal apoptosis mediated by LPS-stimulated BV2 microglial activation. Neurotox. Res. 2020;37(1):111–125. doi: 10.1007/s12640-019-00102-1. [DOI] [PubMed] [Google Scholar]
  • 41.Shinjyo N, Parkinson J, Bell J, Katsuno T, Bligh A. Berberine for prevention of dementia associated with diabetes and its comorbidities: A systematic review. J. Integr. Med. 2020;18(2):125–151. doi: 10.1016/j.joim.2020.01.004. [DOI] [PubMed] [Google Scholar]
  • 42.Bello-Chavolla OY, Antonio-Villa NE, Vargas-Vazquez A, Avila-Funes JA, Aguilar-Salinas CA. Pathophysiological mechanisms linking type 2 diabetes and dementia: Review of evidence from clinical, translational and epidemiological research. Curr. Diabetes Rev. 2019;15(6):456–470. doi: 10.2174/1573399815666190129155654. [DOI] [PubMed] [Google Scholar]
  • 43.Cereda E, et al. Diabetes and risk of Parkinson's disease: A systematic review and meta-analysis. Diabetes Care. 2011;34(12):2614–2623. doi: 10.2337/dc11-1584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Biessels GJ, Staekenborg S, Brunner E, Brayne C, Scheltens P. Risk of dementia in diabetes mellitus: A systematic review. Lancet Neurol. 2006;5(1):64–74. doi: 10.1016/S1474-4422(05)70284-2. [DOI] [PubMed] [Google Scholar]
  • 45.Simo R, Ciudin A, Simo-Servat O, Hernandez C. Cognitive impairment and dementia: a new emerging complication of type 2 diabetes-The diabetologist's perspective. Acta Diabetol. 2017;54(5):417–424. doi: 10.1007/s00592-017-0970-5. [DOI] [PubMed] [Google Scholar]
  • 46.Wodarski R, Clark AK, Grist J, Marchand F, Malcangio M. Gabapentin reverses microglial activation in the spinal cord of streptozotocin-induced diabetic rats. Eur. J. Pain. 2009;13(8):807–811. doi: 10.1016/j.ejpain.2008.09.010. [DOI] [PubMed] [Google Scholar]
  • 47.Yun JH, et al. STAT3 activation in microglia exacerbates hippocampal neuronal apoptosis in diabetic brains. J. Cell Physiol. 2021;236(10):7058–7070. doi: 10.1002/jcp.30373. [DOI] [PubMed] [Google Scholar]
  • 48.Luo XG, Chen SD. The changing phenotype of microglia from homeostasis to disease. Transl. Neurodegener. 2012;1(1):9. doi: 10.1186/2047-9158-1-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Heneka MT, Kummer MP, Latz E. Innate immune activation in neurodegenerative disease. Nat. Rev. Immunol. 2014;14(7):463–477. doi: 10.1038/nri3705. [DOI] [PubMed] [Google Scholar]
  • 50.Dheen ST, Kaur C, Ling EA. Microglial activation and its implications in the brain diseases. Curr. Med. Chem. 2007;14(11):1189–1197. doi: 10.2174/092986707780597961. [DOI] [PubMed] [Google Scholar]
  • 51.Hwang IK, et al. Activation of microglia and induction of pro-inflammatory cytokines in the hippocampus of type 2 diabetic rats. Neurol. Res. 2014;36(9):824–832. doi: 10.1179/1743132814Y.0000000330. [DOI] [PubMed] [Google Scholar]
  • 52.Oliveira WH, et al. Effects of metformin on inflammation and short-term memory in streptozotocin-induced diabetic mice. Brain Res. 2016;1644:149–160. doi: 10.1016/j.brainres.2016.05.013. [DOI] [PubMed] [Google Scholar]
  • 53.Sonneville R, et al. Impact of hyperglycemia on neuropathological alterations during critical illness. J. Clin. Endocrinol. Metab. 2012;97(6):2113–2123. doi: 10.1210/jc.2011-2971. [DOI] [PubMed] [Google Scholar]
  • 54.Liu Y, Li M, Zhang Z, Ye Y, Zhou J. Role of microglia-neuron interactions in diabetic encephalopathy. Ageing Res. Rev. 2018;42:28–39. doi: 10.1016/j.arr.2017.12.005. [DOI] [PubMed] [Google Scholar]
  • 55.Hwang JJ, et al. Blunted rise in brain glucose levels during hyperglycemia in adults with obesity and T2DM. JCI Insight. 2017 doi: 10.1172/jci.insight.95913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Wang WT, Lee P, Yeh HW, Smirnova IV, Choi IY. Effects of acute and chronic hyperglycemia on the neurochemical profiles in the rat brain with streptozotocin-induced diabetes detected using in vivo (1)H MR spectroscopy at 9.4 T. J. Neurochem. 2012;121(3):407–417. doi: 10.1111/j.1471-4159.2012.07698.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Chen C, et al. Chronic hyperglycemia regulates microglia polarization through ERK5. Aging (Albany NY). 2019;11(2):697–706. doi: 10.18632/aging.101770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Zhang X, et al. Enhancement of LPS-induced microglial inflammation response via TLR4 under high glucose conditions. Cell Physiol. Biochem. 2015;35(4):1571–1581. doi: 10.1159/000373972. [DOI] [PubMed] [Google Scholar]
  • 59.Quan Y, Jiang CT, Xue B, Zhu SG, Wang X. High glucose stimulates TNFalpha and MCP-1 expression in rat microglia via ROS and NF-kappaB pathways. Acta Pharmacol. Sin. 2011;32(2):188–193. doi: 10.1038/aps.2010.174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Karslioglu French E, Donihi AC, Korytkowski MT. Diabetic ketoacidosis and hyperosmolar hyperglycemic syndrome: Review of acute decompensated diabetes in adult patients. BMJ. 2019;365:l1114. doi: 10.1136/bmj.l1114. [DOI] [PubMed] [Google Scholar]
  • 61.Song J, Lee JE. ASK1 modulates the expression of microRNA Let7A in microglia under high glucose in vitro condition. Front. Cell Neurosci. 2015;9:198. doi: 10.3389/fncel.2015.00198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Liu X, Xiao Q, Zhao K, Gao Y. Ghrelin inhibits high glucose-induced PC12 cell apoptosis by regulating TLR4/NF-kappaB pathway. Inflammation. 2013;36(6):1286–1294. doi: 10.1007/s10753-013-9667-2. [DOI] [PubMed] [Google Scholar]
  • 63.Zhang T, et al. Natural flavonoid galangin alleviates microglia-trigged blood-retinal barrier dysfunction during the development of diabetic retinopathy. J. Nutr. Biochem. 2019;65:1–14. doi: 10.1016/j.jnutbio.2018.11.006. [DOI] [PubMed] [Google Scholar]
  • 64.Mei X, et al. Scutellarin alleviates blood-retina-barrier oxidative stress injury initiated by activated microglia cells during the development of diabetic retinopathy. Biochem. Pharmacol. 2019;159:82–95. doi: 10.1016/j.bcp.2018.11.011. [DOI] [PubMed] [Google Scholar]
  • 65.Zhu SH, et al. Paeoniflorin suppressed high glucose-induced retinal microglia MMP-9 expression and inflammatory response via inhibition of TLR4/NF-kappaB pathway through upregulation of SOCS3 in diabetic retinopathy. Inflammation. 2017;40(5):1475–1486. doi: 10.1007/s10753-017-0571-z. [DOI] [PubMed] [Google Scholar]
  • 66.Kim J, Lee HJ, Lee KW. Naturally occurring phytochemicals for the prevention of Alzheimer's disease. J. Neurochem. 2010;112(6):1415–1430. doi: 10.1111/j.1471-4159.2009.06562.x. [DOI] [PubMed] [Google Scholar]
  • 67.Khalivulla SI, Mohammed A, Mallikarjuna K. Novel phytochemical constituents and their potential to manage diabetes. Curr. Pharm. Des. 2021;27(6):775–788. doi: 10.2174/1381612826666201222154159. [DOI] [PubMed] [Google Scholar]
  • 68.Mahendra Kumar C, Singh SA. Bioactive lignans from sesame (Sesamum indicum L.): Evaluation of their antioxidant and antibacterial effects for food applications. J. Food Sci. Technol. 2015;52(5):2934–2941. doi: 10.1007/s13197-014-1334-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Majdalawieh AF, Yousef SM, Abu-Yousef IA, Nasrallah GK. Immunomodulatory and anti-inflammatory effects of sesamin: Mechanisms of action and future directions. Crit. Rev. Food Sci. Nutr. 2021 doi: 10.1080/10408398.2021.1881438. [DOI] [PubMed] [Google Scholar]
  • 70.Tomimori N, Rogi T, Shibata H. Absorption, distribution, metabolism, and excretion of [(14) C]sesamin in rats. Mol. Nutr. Food Res. 2017 doi: 10.1002/mnfr.201600844. [DOI] [PubMed] [Google Scholar]
  • 71.Hou RC, Wu CC, Yang CH, Jeng KC. Protective effects of sesamin and sesamolin on murine BV-2 microglia cell line under hypoxia. Neurosci. Lett. 2004;367(1):10–13. doi: 10.1016/j.neulet.2004.05.073. [DOI] [PubMed] [Google Scholar]
  • 72.Jeng KC, Hou RC, Wang JC, Ping LI. Sesamin inhibits lipopolysaccharide-induced cytokine production by suppression of p38 mitogen-activated protein kinase and nuclear factor-kappaB. Immunol. Lett. 2005;97(1):101–106. doi: 10.1016/j.imlet.2004.10.004. [DOI] [PubMed] [Google Scholar]
  • 73.Ohnishi M, et al. Sesamin suppresses activation of microglia and p44/42 MAPK pathway, which confers neuroprotection in rat intracerebral hemorrhage. Neuroscience. 2013;232:45–52. doi: 10.1016/j.neuroscience.2012.11.057. [DOI] [PubMed] [Google Scholar]
  • 74.Ito N, Saito H, Seki S, Ueda F, Asada T. Effects of composite supplement containing astaxanthin and sesamin on cognitive functions in people with mild cognitive impairment: A randomized, double-blind, placebo-controlled trial. J. Alzheimers Dis. 2018;62(4):1767–1775. doi: 10.3233/JAD-170969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Ruankham W, et al. Sesamin and sesamol attenuate H2O2-induced oxidative stress on human neuronal cells via the SIRT1-SIRT3-FOXO3a signaling pathway. Nutr. Neurosci. 2021;24(2):90–101. doi: 10.1080/1028415X.2019.1596613. [DOI] [PubMed] [Google Scholar]
  • 76.Baluchnejadmojarad T, Mansouri M, Ghalami J, Mokhtari Z, Roghani M. Sesamin imparts neuroprotection against intrastriatal 6-hydroxydopamine toxicity by inhibition of astroglial activation, apoptosis, and oxidative stress. Biomed. Pharmacother. 2017;88:754–761. doi: 10.1016/j.biopha.2017.01.123. [DOI] [PubMed] [Google Scholar]
  • 77.Udomruk S, et al. Sesamin suppresses advanced glycation end products induced microglial reactivity using BV2 microglial cell line as a model. Brain Res. Bull. 2021;172:190–202. doi: 10.1016/j.brainresbull.2021.04.012. [DOI] [PubMed] [Google Scholar]
  • 78.Hui B, Zhang L, Zhou Q, Hui L. Pristimerin inhibits LPS-triggered neurotoxicity in BV-2 microglia cells through modulating IRAK1/TRAF6/TAK1-mediated NF-kappaB and AP-1 signaling pathways in vitro. Neurotox. Res. 2018;33(2):268–283. doi: 10.1007/s12640-017-9837-3. [DOI] [PubMed] [Google Scholar]
  • 79.Bi W, et al. Rifampicin improves neuronal apoptosis in LPS-stimulated cocultured BV2 cells through inhibition of the TLR-4 pathway. Mol. Med. Rep. 2014;10(4):1793–1799. doi: 10.3892/mmr.2014.2480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Bournival J, Francoeur MA, Renaud J, Martinoli MG. Quercetin and sesamin protect neuronal PC12 cells from high-glucose-induced oxidation, nitrosative stress, and apoptosis. Rejuvenation Res. 2012;15(3):322–333. doi: 10.1089/rej.2011.1242. [DOI] [PubMed] [Google Scholar]
  • 81.Udomruk S, Kaewmool C, Pothacharoen P, Phitak T, Kongtawelert P. Sesamin suppresses LPS-induced microglial activation via regulation of TLR4 expression. J. Funct. Foods. 2018;49:32–43. doi: 10.1016/j.jff.2018.08.020. [DOI] [Google Scholar]
  • 82.Phitak T, et al. Chondroprotective and anti-inflammatory effects of sesamin. Phytochemistry. 2012;80:77–88. doi: 10.1016/j.phytochem.2012.05.016. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures. (14.2MB, docx)

Data Availability Statement

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES