Skip to main content
Experimental and Therapeutic Medicine logoLink to Experimental and Therapeutic Medicine
. 2022 Jun 14;24(2):511. doi: 10.3892/etm.2022.11438

Applications of polymerase chain reaction-based methods for the diagnosis of plague (Review)

Yanan Zhang 1, Zhanli Wang 1, Wenrui Wang 2, Hui Yu 1,3,✉, Min Jin 1,4
PMCID: PMC9257939  PMID: 35837060

Abstract

Plague is an acute bacterial infection caused by Yersinia pestis. The three major clinical forms of plague are bubonic, pneumonic and septicemic, which have high case-mortality rates. Therefore, rapid and reliable diagnostic tools are crucial. Currently, bacteriological means and traditional serological assays are used for detecting infection with Y. pestis. However, such methods have their limitations. Polymerase chain reaction (PCR) is one of the most useful tools for rapid diagnosis of plague. The present review introduced the main PCR techniques and their applications for detecting and confirmation of Y. pestis. The advantages and disadvantages of the different PCR methods were also summarized.

Keywords: polymerase chain reaction techniques, plague, Yersinia pestis, molecular diagnosis

1. Introduction

Plague is a zoonotic infection disease having a high mortality rate without treatment. It may present three distinct clinical forms: bubonic, septicemic and pneumonic (1). Yersinia pestis (Y. pestis), a member of the genus Yersinia which belongs to the Enterobacteriaceae family, is the etiological agent of plague (2). Y. pestis is a highly pathogenic gram-negative coccobacillus, which are nonmsotile, non-spore-forming, oxidase-negative, catalase-positive and lactose-negative, exhibiting bipolar staining with Giemsa, Wright's and Wayson stains (3). It grows at temperatures ranging from 4-40˚C and the optimal temperature for growth is 28-30˚C (4). At present, four biotypes of Y. pestis are recognized, including Antiqua, Orientalis, Mediaevalis and Microtus, on the basis of their ability to ferment glycerol and form nitrite from nitrate (5,6). Among them, three classic biotypes (Antiqua, Orientalis and Mediaevalis) of Y. pestis demonstrate no difference in their pathology in animals or humans (7). By contrast, Microtus is nonpathogenic for humans (8). Y. pestis has a complex infectious cycle, which starts within an insect vector (fleas) followed by transmission to a mammalian host (rodents and humans) (9) (Fig. 1).

Figure 1.

Figure 1

Transmission routes of plague. Rodents act as hosts and reservoirs for Y. pestis, vectored by fleas. Mammals, which are not the natural hosts of Y. pestis, may become infected via the bite of an infected flea. Infection may be transmitted to humans through flea bites or through direct contact with infected animals.

The bacterial pathogen, Y. pestis, has caused at least three pandemics in human history. The first historically documented pandemic started with the Justinianic Plague (AD 541-544) in Pelusium, Egypt (10), which caused tens of millions of mortalities throughout North Africa, Europe, central and southern Asia and Arabia. The second plague pandemic (14-18th centuries) started with the Black Death (1347-1353). This pandemic persisted for over 400 years and devastated Europe and the nearby regions (11). The third plague pandemic originated from Yunnan province of China in the 1850s and spread globally at the end of the 19th century (12).

Early diagnosis and treatment can effectively reduce the mortality of bubonic plague and septicemic plague (13,14). Polymerase chain reaction (PCR)-based methods have enabled the rapid identification of cultured or uncultured bacteria (15). Previous reviews describing microbiological and molecular aspect, molecular typing and molecular diagnostic techniques of Y. pestis, are available (16-20). The present review focused on the applications of PCR-based methods for detection of Y. pestis and attempt to compile and update technical aspects of PCR strategies in diagnosis of Y. pestis infection.

Laboratory diagnosis of plague

At present, there are various laboratory tests for diagnosis of plague, such as bacterial culture, staining techniques, serological evidence, phage tests, DNA hybridization and PCR analysis (21). Isolation and identification of pathogen in the laboratory is gold standard for plague diagnosis (22). Clinical specimens for analysis can include blood, bubo aspirates, sputum, or cerebrospinal fluid. Y. pestis can be cultivated on culture media, such as brain heart infusion broth, MacConkey agar and sheep blood agar. Isolation of Y. pestis should be performed under biosafety level 3 conditions. However, bacteriological evidence is time consuming due to the low growth rate of Y. pestis. Serological tests are often used to diagnosis plague, including the agar-gel precipitin inhibition, the complement fixation, passive hemagglutination (PHA) test (23), immunochromatography test (24), enzyme-linked immunosorbent assay (ELISA) (25), dot enzyme-immunosorbent assay (DOT-ELISA) (26) and the dissociation-enhanced lanthanide fluorescent immunoassays (DELFIA) (27). Serological tests seem to be more effective but are expensive and labor intensive. Moreover, it can be unspecific due to serological cross-reactivity with other enteropathogenic bacteria (24). DNA hybridization using Y. pestis-specific DNA probe may be used for plague diagnosis (28). The minimum detection limits of this method are ~105 bacteria, which limits its clinical application. PCR is well suited molecular biology tool for diagnosis of pathogens. At present, confirmation of plague is performed using reverse transcription PCR targeting a plasminogen activator gene (pla) and 60-Md plasmid-located gene (caf1) and in the case of discordant or uncertain results, a PCR targeting pla, caf1 and an invasin protein gene (inv) is performed (Fig. 2).

Figure 2.

Figure 2

Algorithm for the molecular biology tests of plague. DNA confirmation on the presence of Y. pestis in human specimens is performed using quantitative PCR targeting pla and caf1 and in the case of discordant or uncertain results, a conventional PCR targeting pla, caf1 and inv is performed. pla, plasminogen activator gene; caf1, 60-Md plasmid-located gene; inv, invasin protein gene.

PCR-based methods for diagnosis of plague

The rapid identification of the Y. pestis is crucial, so that more specific therapy can be initiated. PCR is a key technique for accurate detection of Y. pestis due to its higher sensitivity and specificity within several hours and without any cultivation. Y. pestis genome has a size of 4,380±135 kb with a 46 to 47 mol% G+C content. The advances concerning the structure of the Y. pestis genome led to the development of specific PCR assays for plague diagnosis. The first PCR-based test for identification of Y. pestis was introduced by Bulat et al (29) in 1991. They performed gene typing with PCR assay to identify six Yersinia species (Y. pestis, Y. pseudotuberculosis, Y. enterocolitica, Y. kirstensenii, Y. frederiksenii and Y. intermedia). Previous studies further report the determination of the molecular typing and the genetic variations of Y. pestis using PCR methods (30-35). For example, the PCR-based O-genotyping proves useful to type Y. pseudotuberculosis and Y. pestis (36). PCR is also a useful tool for analysis of genomic polymorphism of typical and atypical strains of the Y. pestis (37). Additionally, the developed approach based on PCR allows for an effective differentiation of Y. pestis strains of various subspecies (38-40). Some studies elucidated a mechanism by which Y. pestis may be transmitted between host species using PCR (41,42). Researchers also developed a standard curve-based competitive PCR to quantitate Y. pestis in individual fleas, which is more reliable than colony count (43). The PCR method is used to determine bacterial susceptibility to antibiotics by the quantification of differentially expressed marker genes (44-47). A number of studies present the rapid diagnosis of plague and the detection of prominent virulence markers of Y. pestis strains using this technique (48,49). So far, PCR has proven useful in application as a diagnostic method for routine plague surveillance and outbreak investigations (50-55).

2. Standard PCR

Standard PCR is replacing the more traditional microbiological assays in the detection of Y. pestis. This approach requires development of highly specific oligonucleotide primers unique to Y. pestis. Primer pairs include the primers for sequences of caf1, pla, inv, a Y. pestis-specific region of a yopM gene, 23S ribosomal DNA interspace region and insertion sequence (56-60). Table I gives the different primers for standard PCR.

Table I.

Sequences of primers for the standard PCR.

Author, year Gene Forward primer Reverse primer Product, bp (Refs.)
Rahalison et al, 2000 caf1 CAGTTCCGTTATCG CCATTGC TATTGGTTAGATACG GTTACGGT 501 (56)
Nyirenda et al, 2018 pla ATCTTACTTTCCGTG AGAAG CTTGGATGTTGAGCT TCCTA 480 (57)
Tsukano et al, 1996 inv TAAGGGTACTATCGC GGCGGA CGTGAAATTAACCGT CACACT 295 (59)
  yopM ATAACTCATCGGGGG CAAAAT GCG TTA TTT ATC CGA ATT TAG C 565  
  caf1 CAGGAACCACTAGC ACATC CCCCCACAAGGTTC TCAC 171  
Radnedge et al, 2001 Insertion sequence TGTAGCCGCTAAGCA CTACCATCC GGCAACAGCTCAACAC CTTTGG 276 (58)
  Insertion sequence GCATGACCGAAACGT CATCCTG GGATACTTCGCGCATATC TTGCC 332  
  Insertion sequence GGATAACGTTGCAG CAGCTTCG CCTTCGCCACCTTCAC CTGC 250  
  Insertion sequence TCCAAAATCGGAGA ATTACTATGGGC CGTTGTTGATGCCGT CA CTTTG 226  
  23S rRNA CTACCTTAGGACC GTTATAGTTAC GAAGGAACTAGGCAAA ATGGT    
  JS GCAGCTTAGGCTGTC ATCG CTATCGCCTGATTGGA GAGG 223  

caf1, capsular antigen fraction 1; pla, plasminogen activator; inv, invasin; yopM, Yersinia outer protein M.

Standard PCR is a cost-effective approach for the rapid detection of Y. pestis (61). Zasada et al (62) present an application of this assay for detection and identification of Y. pestis, which takes <50 min and is cheaper than reverse transcription PCR. Studies also showed that this approach showed high specificity when compared with ELISA and the culture of Y. pestis (56). Additionally, standard PCR seems to be relatively rapid and sensitive when compared to the conventional culture-based method. Hinnebusch and Schwan (15) report that this assay may detect as few as 10 cells of Y. pestis. Singh et al (63) developed a standard PCR assay coupled with lateral flow strips. The analytical sensitivity of assay is 1 pg genomic DNA of Y. pestis and 500 copies of target DNA sequence harbored in a recombinant plasmid. However, Rahalison et al (56) reveal that the sensitivity of this technique is 50% relative to the results of culture and 35.2% relative to the results of the ELISA due to suboptimal field conditions and the volumes of samples. Therefore, it is worth noting that sample volume used and efficient DNA extraction protocol direct influence the sensitivity of standard PCR. Moreover, standard PCR may be used for the effective differentiation of typical and atypical plague pathogen strains. A rapid and sensitive one-step PCR assay has been developed to identify and discriminate pathogenic Y. enterocolitica from other members of this genus using a set of species-specific primers (64,65). Zhou et al (66) also identified 28 signature genes of Y. pestis. PCR amplification of these signature sequences is ideal for rapid and specific characterization of pathogens without cross-reaction with the closely related Y. pseudotuberculosis.

By using specific probe for the amplicon detection, standard PCR is considered sensitive and specific. However, it cannot be monitored in real time and requires the performance of any postreaction processing, such as the electrophoresis gel. Moreover, standard PCR method is relatively poor in detecting the low numbers of pathogens in the biopsy sample. So far, there have been numerous modifications of the PCR technology for increasing the sensitivity of detection.

3. Reverse transcription PCR

Compared to conventional PCR, reverse transcription PCR has several advantages, including speed, simplicity, reproducibility, quantitative capability and low risk of contamination (67-70). Reverse transcription PCR for the rapid detection and differentiation of Y. pestis has been developed, targeting caf1, Ymt, pla, hemin storage genes (hmsH, hmsF and hmsR) and irp2 iron-regulating gene (71,72). Table II gives the different primers and probes for the reverse transcription PCR.

Table II.

Sequences of primers and probes for the reverse transcription PCR.

Author, year Gene Primer/probe sequences (5'-3') Product, bp (Refs.)
Bai et al, 2020 pst Forward: GCGAAGCAAACAGGATTTATTG 116 (40)
    Reverse: GAGGTGCTGTTCTCACTTTATC    
    Probe: FAM-AGCCTCCTTCCCTCGAAGCAT ATAATACCC-BHQ1    
  ypo2088 Forward: TCGGCAACAGCTCAACACCT 107  
    Reverse: ATGCATTGGACGGCATCACG    
    Probe: CALRD610-CGCCCTCGAATCGCT GGCCAACTGC-BHQ2    
  opgG Forward: ACGTGGGCGTGAATTCTCTCAA 126  
    Reverse: GCCGTTGGGATCTCCACCAA    
    Probe: QUAS670‐CCTGCGCCCAAGCGCG TGGG-BHQ2    
  18S rRNA Forward: CAGATACCGCCCTAGTTCTAA 153  
    Reverse: GTT TCA GCT TTG CAA CCA TAC    
    Probe: HEX-TCATCGGAGGAACTTCGGC GGATC-BHQ1    
Riehm et al, 2011 pst Forward: TACGGTTACGGTTACAGCAT   (72)
    Reverse: GGTGATCCCATGTACTTAACA    
    Probe: 6FAM-ACCTGCTGCAAGTTTACC GCCTTTGG-BBQ    
  Ymt Forward: AGGACCTAATATGGAGCATGAC    
    Reverse: CTAACAAAGCCTCAATAATCCA    
    Probe: 6FAM-TCCAAGCACTCACGAGA TCTTGCTAA-BBQ    
Liu et al, 2016 caf1 Forward: CCACTGCAACGGCAACTCTT 71 (75)
    Reverse: TGTAATTGGAGCGCCTTCCT    
    Probe: QUAS705-TTGAACCAGCCCGCAT CACTCTTACA-BHQ3    
Woron et al, 2006 caf1 Forward: GCAACTGCTAATGCGGCAGAT 176 (98)
    Reverse: CCTGTTTTATAGCCGCCAAGAG    
    Probe: TAMRA-TGCAAGCACCACTGC AACGGCAAC-BHQ1    
  pla Forward: GCTTTATGACGCAGAAACAGGA 270  
    Reverse: AACCAGCCTTTCACATTGAGGT    
    Probe: JOE-TGGACGTCTCTGGCTTCC GGTC-BHQ2    
  entF3 Forward: AACGACGGCATTCACGGTA 122  
    Reverse: TGGTGATGAGTTGGACGTTAGG    
    Probe: ROX-CGGCCAAAATGGCGTGAT AAATACCTT-BHQ1    
Tomaso et al, 2003 pla Forward: GTAATAGGTTATAACCAGCGCTT 232 (79)
    Reverse: AGACTTTGGCATTAGGTGTG    
    Probe: HEX-ATGCCATATATTGGACTTG CAGGCCAGT-BHQ1    

caf1, capsular antigen fraction 1; pla, plasminogen activator.

Reverse transcription PCR is proposed as a timely, cost-effective and accurate diagnostic assay (73,74). The reliability of this method was evaluated in 1,050 clinical specimens and high values of specificity were obtained (75). An autonomous pathogen detection system was developed by coupling reverse transcription TaqMan assay, which generate extremely low false positive rate (76). Woubit et al (77) also identify the genomic targets of Y. pestis to design the primers. Primer sets are used to specifically detect pathogen with reverse transcription PCR assays and this assay is found to be sensitive. A 5' nuclease PCR assay for detection of the Y. pestis has been developed with a detection threshold of 1.6 pg of total cell DNA (78). Tomaso et al (79) established a reverse transcription PCR assay for the specific detection of Y. pestis. The lower limit of detection is ~0.1 genome equivalent. Skottman et al (80) report the development of reverse transcription PCR assays for detection of Y. pestis with a sensitivity of 1 fg of total DNA in the PCR tube. In addition, some researchers develop and validate reverse transcription PCR for the differentiation and quantification of Y. pestis. Comer et al (81) report reverse transcription PCR assays to determine absolute bacterial numbers in flea vector and mammalian host tissues. A quadruplex reverse transcription PCR assay proved to be successful in differentiating Y. pestis from Y. pseudotuberculosis (82). Chase et al (83) also designed reverse transcription PCR assays to discriminate Y. pestis DNA from all other Yersinia species tested and from the closely related Y. pseudotuberculosis. Moreover, reverse transcription PCR assays have been developed for simultaneous detection of various organisms. Liu et al (75) developed a reverse transcription PCR-based TaqMan array card that can simultaneously detect 26 organisms, including Y. pestis. Notably, reverse transcription PCR allows the detection of only live Y. pestis using amplification of plague diagnostic bacteriophages (84). It is therefore a useful method for the differentiation among inactive and active states of Y. pestis.

Some researchers develop reverse transcription PCR for the specific detection and quantification of Y. pestis from various samples, such as complex food, synthetic building debris and leachate and spleen samples of animals (85-89). Hennebique et al (90) also report the development of a reverse transcription PCR assay for the detection of Y. pestis in various types of samples and demonstrate good performances.

Some researchers have compared reverse transcription PCR assay performance across various platforms. Christensen et al (91) detect Y. pestis by reverse transcription PCR on the R.A.P.I.D., the LightCycler and the Smart Cycler platforms. They find that the tested assays have comparable sensitivity and specificity on these rapid cycling instruments. Matero et al (92) also compare this assay performance between the Applied Biosystems 7300/7500 and the RAZOR instruments for detection of Y. pestis. Although no notable differences between two platforms were observed in analytical sensitivity or specificity, the duration of thermocycling with the RAZOR instrument was significantly shorter (40 min vs. 100 min with ABI 7300/7500). Mölsä et al (93) compare the performance of a novel portable reverse transcription PCR thermocycler PikoReal to ABI 7300 for the detection of Y. pestis. The PikoReal system may be a more efficient alternative to detect biothreat agents under field conditions.

When compared to other PCR based methods used for detection of Y. pestis, reverse transcription PCR is a sensitive method that quantifies the number of Y. pestis in biopsy specimens through the quantification of bacterial DNA in real time. However, it may not be as sensitive as nested PCR. Additionally, the application of reverse transcription PCR is usually based on the commercial kits, so it will be more expensive, especially when two genes are targeted.

4. Multiplex PCR

Multiplex PCR is a type of PCR technique which amplifies more than one target DNA in one reaction system at one time. Elsholz et al (94) designed a multiplex PCR method for the parallel detection of a panel of the pathogens, including B. anthracis, Y. pestis, F. tularensis and ortho pox viruses (genus). Stenkova et al (95) show that the multiplex PCR provides an improved method for detection of the Yersinia genus with identification of pathogenic species (Y. pestis, Y. pseudotuberculosis, Y. enterocolitica). Stevenson et al (96) further detect flea-associated microorganisms, such as Bartonella strains and Y. pestis, in prairie dogs and their fleas using multiplex PCR. Additionally, the multiplex PCR can be used to detect and identify Y. pestis using multiplex primers, including caf1, yopM, pla and inv genes (97). Woron et al also reported the 4-target multiplex reverse transcription PCR assay for Y. pestis (98).

The multiplex PCR assay can successfully identify Y. pestis with high sensitivity (99). Vanlalhmuaka et al (100) developed a multiplex PCR-based reverse line blot macroarray for simultaneous detection and characterization of four pathogens, including B. anthracis, Y. pestis, B. melitensis and B. pseudomallei. This assay is able to detect 8x102 cfu/ml for Y. pestis. Similarly, Batra et al (101) describe a sensitive and specific multiplex PCR assay for the simultaneous detection of B. anthracis, Y. pestis, B. pseudomallei and Brucella species. The sensitivity in spiked blood samples was 50 colony forming units (cfus)/25 µl reaction for the detection of Y. pestis.

Multiplex PCR demonstrates high specificity and reliability (102). Wilson et al (103) developed a multiplexed PCR-coupled liquid bead array for the detection of Y. pestis. The assay correctly identified the presence of pathogen with low material costs. Tran et al (104) detected Y. pestis DNA in dental pulp specimens collected from graves with high throughput multiplex PCR, confirmed the outbreaks of plague in medieval Venice. Melo et al (105) show that the multiplex-PCR technique is a valuable tool for the plague control programme. A multiplex oligonucleotide ligation-PCR has also been developed for the detection of Y. pestis, representing considerable potential in the field of diagnostics and surveillance (106). A previous study also showed that there was no significant difference in detection rates between blood culture, singleplex PCR and multiplex PCR within the Y. pestis model (107).

Multiplex PCR can be a powerful tool for the simultaneous quantification of more than one pathogen in a single reaction by combination of primers and probes. The advantages of this method include ease of sample collection, improvement in amplification efficiency and reduction of laboratory time. This technique is more suitable for screening of pathogenic bacteria.

5. Nested and semi-nested PCR

The nested and semi-nested PCR assays have advantages of high sensitivity and easy applicability for the detection of Y. pestis in various samples. Trebesius et al (108) present the semi-nested PCR approach based on 16S and 23S rDNAs with respect to diagnosis of plague. A single-tube nested-PCR technique targeting the caf1 gene was evaluated for plague diagnosis, which showed more sensitive than conventional PCR (109). Glukhov et al (110) develop a nested PCR method to distinguish the culture of Y. pestis from cultures of other microorganism, demonstrating a higher sensitivity and specificity than standard PCR.

6. Other PCR-based assays

A microchip PCR array instrument was developed for rapid detection of Y. pestis with the detection limits of 105-107 organisms/L (111). Pingle et al (112) developed a PCR-ligase detection reaction-capillary electrophoresis assay for the identification of pathogens, including Y. pestis. Jacob et al (113) describe the identification of highly pathogenic bacteria using an assay coupling biothreat group-specific PCR with electrospray ionization mass spectrometry. Song et al (114) also developed a SNP-based multiplexed oligonucleotide ligation-PCR for rapid Y. pestis detection and antibiotic resistance characterization. Souza et al (115) developed a method to differentiate Yersinia species using high-resolution melting analysis. Jeng et al (116) further reported a reverse transcription-PCR-electrospray ionization mass spectrometry assay for distinguishing biothreat agents, including B. anthracis, Y. pestis, F. tularensis, Brucella spp., Burkholderia spp. and R. prowazekii. Other PCR-based assays have been used for detection of Y. pestis, such as ligation-mediated PCR, suicide PCR, immuno-PCR and viability PCR (117-123).

7. Sampling and sample treatment

The sensitivity limit of PCR depends on the method used for preparing the sample (124) and the presence of PCR inhibitors that are often found in biological samples (125). A previous study showed that some components in the tissues can inhibit PCR (126). Leal et al (127) found that the spleen suspension of animals experimentally infected with Y. pestis can be used as PCR amplification template without DNA extraction. The sensitivity and specificity were enhanced by amplification after the second-round PCR. Afanas'ev et al (128) treated the samples of plague-infected fleas with an affine sorbent prior to PCR analysis. They found that the use of magnoimmunosorbent prevents the inhibitory effect of flea tissues and makes it possible to have a specific concentration of plague microbial DNA. The high-quality DNA before PCR gene amplification is essential for the diagnostic of pathogenic bacteria. Coyne et al (129) evaluate the Schleicher and Schuell IsoCode Stix DNA isolation device and the Qiagen QIAamp DNA Mini kit for isolating Y. pestis DNA from serum and whole-blood samples. They find that the two methods achieve comparable detection limits. Dauphin et al (130) evaluate five commercially available DNA extraction kits. TaqMan reverse transcription PCR analysis revealed that the MasterPure kit was best extraction method for Y. pestis suspensions and spiked environmental samples. Gilbert et al (131) show that various methods of tooth manipulation can influence the PCR-based detection of Y. pestis DNA in human teeth from European excavations of putative plague victims. They use a novel contamination-minimizing embedding technique to reduce the levels of environmental bacterial DNA presented in DNA extracts. Hong-Geller et al (132) evaluate the sample recovery efficiencies of two collection methods (swabs and wipes) for Y. pestis from nonporous surfaces. They found that collection efficiency was surface-dependent, indicating the importance of surface interactions in pathogen detection.

8. Perspective and challenge

The developed approach based on PCR is applicable for identifying and confirming Y. pestis (133,134). This system also allows for effective differentiation of Yersinia strains of various subspecies. In addition, the PCR assay is able to determine bacterial susceptibility to antibiotics and prominent virulence markers of Y. pestis. Compared with traditional techniques, PCR-based is simple, rapid, highly sensitive and specific and it has proven useful in application as a diagnostic strategy for routine plague surveillance of epidemics. However, the PCR inhibitors may be present in samples. The suboptimal field conditions, sample recovery efficiency and DNA extraction quality directly influence the sensitivity and specificity of most PCR-based methods. Therefore, future studies should focus on the standardization of sample processing.

Acknowledgements

Not applicable.

Funding Statement

Funding: The present study was supported by Key Scientific and Technology Project of Inner Mongolia Autonomous Region (grant no. 2021ZD0006).

Availability of data and materials

Not applicable.

Authors' contributions

YZ contributed to the acquisition, analysis and systematization of data and manuscript writing. ZW and WW contributed to the acquisition and analysis of data. HY and MJ contributed to the systematization of data and critical revision. All authors read and approved the final version of the manuscript. Data authentication is not applicable.

Ethics approval and consent to participate

Not applicable.

Patients consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

  • 1.Zietz BP, Dunkelberg H. The history of the plague and the research on the causative agent Yersinia pestis. Int J Hyg Environ Health. 2004;207:165–178. doi: 10.1078/1438-4639-00259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Drancourt M, Raoult D. Molecular history of plague. Clin Microbiol Infect. 2016;22:911–915. doi: 10.1016/j.cmi.2016.08.031. [DOI] [PubMed] [Google Scholar]
  • 3.Devignat R. Varieties of Pasteurella pestis; new hypothesis. Bull World Health Organ. 1951;4:247–263. (In Undetermined Language) [PMC free article] [PubMed] [Google Scholar]
  • 4.Brubaker RR. Factors promoting acute and chronic diseases caused by yersiniae. Clin Microbiol Rev. 1991;4:309–324. doi: 10.1128/CMR.4.3.309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Dai E, Tong Z, Wang X, Li M, Cui B, Dai R, Zhou D, Pei D, Song Y, Zhang J, et al. Identification of different regions among strains of Yersinia pestis by suppression subtractive hybridization. Res Microbiol. 2005;156:785–789. doi: 10.1016/j.resmic.2005.02.012. [DOI] [PubMed] [Google Scholar]
  • 6.Drancourt M. Plague in the genomic area. Clin Microbiol Infect. 2012;18:224–230. doi: 10.1111/j.1469-0691.2012.03774.x. [DOI] [PubMed] [Google Scholar]
  • 7.Brubaker RR. The genus Yersinia: Biochemistry and genetics of virulence. Curr Top Microbiol Immunol. 1972;57:111–158. doi: 10.1007/978-3-642-65297-4_4. [DOI] [PubMed] [Google Scholar]
  • 8.Zhou D, Tong Z, Song Y, Han Y, Pei D, Pang X, Zhai J, Li M, Cui B, Qi Z, et al. Genetics of metabolic variations between Yersinia pestis biovars and the proposal of a new biovar, microtus. J Bacteriol. 2004;186:5147–5152. doi: 10.1128/JB.186.15.5147-5152.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Perry RD, Fetherston JD. Yersinia pestis-etiologic agent of plague. Clin Microbiol Rev. 1997;10:35–66. doi: 10.1128/CMR.10.1.35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mordechai L, Eisenberg M, Newfield TP, Izdebski A, Kay JE, Poinar H. The justinianic plague: An inconsequential pandemic? Proc Natl Acad Sci USA. 2019;116:25546–25554. doi: 10.1073/pnas.1903797116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Susat J, Bonczarowska JH, Pētersone-Gordina E, Immel A, Nebel A, Gerhards G, Krause-Kyora B. Yersinia pestis strains from Latvia show depletion of the pla virulence gene at the end of the second plague pandemic. Sci Rep. 2020;10(14628) doi: 10.1038/s41598-020-71530-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Bramanti B, Dean KR, Walløe L, Chr*Stenseth N. The third plague pandemic in Europe. Proc Biol Sci. 2019;286(20182429) doi: 10.1098/rspb.2018.2429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Nikiforov VV, Gao H, Zhou L, Anisimov A. Plague: Clinics, diagnosis and treatment. Adv Exp Med Biol. 2016;918:293–312. doi: 10.1007/978-94-024-0890-4_11. [DOI] [PubMed] [Google Scholar]
  • 14.Jullien S, Dissanayake HA, Chaplin M. Rapid diagnostic tests for plague. Cochrane Database Syst Rev. 2020;6(CD013459) doi: 10.1002/14651858.CD013459.pub2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hinnebusch J, Schwan TG. New method for plague surveillance using polymerase chain reaction to detect Yersinia pestis in fleas. J Clin Microbiol. 1993;31:1511–1514. doi: 10.1128/jcm.31.6.1511-1514.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Wake A. Pathogenicity of Yersinia pestis: Microbiological and molecular aspect. Nihon Saikingaku Zasshi. 1995;50:651–669. doi: 10.3412/jsb.50.651. (In Japanese) [DOI] [PubMed] [Google Scholar]
  • 17.Platonov ME, Evseeva VV, Dentovskaya SV, Anisimov AP. Molecular typing of Yersinia pestis. Mol Gen Mikrobiol Virusol. 2013:3–12. (In Russian) [PubMed] [Google Scholar]
  • 18.Wolkowicz T. The utility and perspectives of NGS-based methods in BSL-3 and BSL-4 laboratory-sequencing and analysis strategies. Brief Funct Genomics. 2018;17:471–476. doi: 10.1093/bfgp/elx033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Neubauer H, Sprague LD, Scholz H, Hensel A. Diagnosis o Yersinia enterocolitica infections: A review on classical identification techniques and new molecular biological methods. Berl Munch Tierarztl Wochenschr. 2001;114:1–7. (In German) [PubMed] [Google Scholar]
  • 20.Jones SW, Dobson ME, Francesconi SC, Schoske R, Crawford R. DNA assays for detection, identification and individualization of select agent microorganisms. Croat Med J. 2005;46:522–529. [PubMed] [Google Scholar]
  • 21.Gaweł J, Bartoszcze M, Osiak B. Yersinia pestis pathogenesis and diagnostics. Przegl Epidemiol. 2006;60:315–321. (In Polish) [PubMed] [Google Scholar]
  • 22.Yang R. Plague: Recognition, treatment and prevention. J Clin Microbiol. 2017;56:e01519–17. doi: 10.1128/JCM.01519-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Marshall JD Jr, Mangiafico JA, Cavanaugh DC. Comparison of the reliability and sensitivity of three serological procedures in detecting antibody to Yersinia pestis (Pasteurella pestis) Appl Microbiol. 1972;24:202–204. doi: 10.1128/am.24.2.202-204.1972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kopylov PKh, Platonov ME, Ablamunits VG, Kombarova TI, Ivanov SA, Kadnikova LA, Somov AN, Dentovskaya SV, Uversky VN, Anisimov AP. Yersinia pestis caf1 protein: Effect of sequence polymorphism on intrinsic disorder propensity, serological cross-reactivity and cross-protectivity of isoforms. PLoS One. 2016;11(e0162308) doi: 10.1371/journal.pone.0162308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Shepherd AJ, Leman PA, Hummitzsch DE, Swanepoel R. A comparison of serological techniques for plague surveillance. Trans R Soc Trop Med Hyg. 1984;78:771–773. doi: 10.1016/0035-9203(84)90014-2. [DOI] [PubMed] [Google Scholar]
  • 26.de*Almeida AM, Ferreira LC. Evaluation of three serological tests for the detection of human plague in northeast Brazil. Mem Inst Oswaldo Cruz. 1992;87:87–92. doi: 10.1590/s0074-02761992000100014. [DOI] [PubMed] [Google Scholar]
  • 27.Smith DR, Rossi CA, Kijek TM, Henchal EA, Ludwig GV. Comparison of dissociation-enhanced lanthanide fluorescent immunoassays to enzyme-linked immunosorbent assays for detection of staphylococcal enterotoxin B, Yersinia pestis-specific F1 antigen and Venezuelan equine encephalitis virus. Clin Diagn Lab Immunol. 2001;8:1070–1075. doi: 10.1128/CDLI.8.6.1070-1075.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.McDonough KA, Schwan TG, Thomas RE, Falkow S. Identification of a Yersinia pestis-specific DNA probe with potential for use in plague surveillance. J Clin Microbiol. 1988;26:2515–2519. doi: 10.1128/jcm.26.12.2515-2519.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bulat SA, Mikhaĭlo NV, Koroliuk AM. The gene identification of bacterial species and serovariants by the polymerase chain reaction with universal oligonucleotides: The reidentification of earlier isolated strains of Yersinia pseudotuberculosis. Zh Mikrobiol Epidemiol Immunobiol. 1991:2–7. (In Russian) [PubMed] [Google Scholar]
  • 30.Eroshenko GA, Odinokov GN, Kukleva LM, Pavlova AI, Krasnov IaM, Shavina NIu, Guseva NP, Vinogradova NA, Kutyrev VV. Standard algorithm of molecular typing of Yersinia pestis strains. Zh Mikrobiol Epidemiol Immunobiol. 2012:25–35. (In Russian) [PubMed] [Google Scholar]
  • 31.Tong ZZ, Zhou DS, Song YJ, Zhang L, Pei D, Han YP, Pang X, Li M, Cui BZ, Wang J, et al. Genetic variations in the pgm locus among natural isolates of Yersinia pestis. J Gen Appl Microbiol. 2005;51:11–19. doi: 10.2323/jgam.51.11. [DOI] [PubMed] [Google Scholar]
  • 32.Kim W, Song MO, Song W, Kim KJ, Chung SI, Choi CS, Park YH. Comparison of 16S rDNA analysis and rep-PCR genomic fingerprinting for molecular identification of Yersinia pseudotuberculosis. Antonie Van Leeuwenhoek. 2003;83:125–133. doi: 10.1023/a:1023301924932. [DOI] [PubMed] [Google Scholar]
  • 33.Li Y, Dai E, Cui Y, Li M, Zhang Y, Wu M, Zhou D, Guo Z, Dai X, Cui B, et al. Different region analysis for genotyping Yersinia pestis isolates from China. PLoS One. 2008;3(e2166) doi: 10.1371/journal.pone.0002166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kingston JJ, Tuteja U, Kapil M, Murali HS, Batra HV. Genotyping of Indian Yersinia pestis strains by MLVA and repetitive DNA sequence based PCRs. Antonie Van Leeuwenhoek. 2009;96:303–312. doi: 10.1007/s10482-009-9347-2. [DOI] [PubMed] [Google Scholar]
  • 35.Motin VL, Georgescu AM, Elliott JM, Hu P, Worsham PL, Ott LL, Slezak TR, Sokhansanj BA, Regala WM, Brubaker RR, Garcia E. Genetic variability of Yersinia pestis isolates as predicted by PCR-based IS100 genotyping and analysis of structural genes encoding glycerol-3-phosphate dehydrogenase (glpD) J Bacteriol. 2002;184:1019–1027. doi: 10.1128/jb.184.4.1019-1027.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Bogdanovich T, Carniel E, Fukushima H, Skurnik M. Use of O-antigen gene cluster-specific PCRs for the identification and O-genotyping of Yersinia pseudotuberculosis and Yersinia pestis. J Clin Microbiol. 2003;41:5103–5112. doi: 10.1128/JCM.41.11.5103-5112.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Savostina EP, Popov IuA, Kashmanova TN, Iashechkin IuI. Analysis of genomic polymorphism of typical and atypical strains of the plague pathogen using polymerase chain reaction with universal primers. Mol Gen Mikrobiol Virusol. 2004:22–26. (In Russian) [PubMed] [Google Scholar]
  • 38.Nikiforov KA, Oglodin EG, Kukleva LM, Eroshenko GA, Germanchuk VG, Devdariani ZL, Kutyrev VV. Subspecies differentiation of Yersinia pestis strains by PCR with hybridization-fluorescent detection. Zh Mikrobiol Epidemiol Immunobiol. 2017:22–27. (In English, Russian) [PubMed] [Google Scholar]
  • 39.Matero P, Pasanen T, Laukkanen R, Tissari P, Tarkka E, Vaara M, Skurnik M. Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis. APMIS. 2009;117:34–44. doi: 10.1111/j.1600-0463.2008.00013.x. [DOI] [PubMed] [Google Scholar]
  • 40.Bai Y, Motin V, Enscore RE, Osikowicz L, Rosales Rizzo M, Hojgaard A, Kosoy M, Eisen RJ. Pentaplex real-time PCR for differential detection of Yersinia pestis and Y. pseudotuberculosis and application for testing fleas collected during plague epizootics. Microbiologyopen. 2020;9(e1105) doi: 10.1002/mbo3.1105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Franklin HA, Stapp P, Cohen A. Polymerase chain reaction (PCR) identification of rodent blood meals confirms host sharing by flea vectors of plague. J Vector Ecol. 2010;35:363–371. doi: 10.1111/j.1948-7134.2010.00095.x. [DOI] [PubMed] [Google Scholar]
  • 42.Engelthaler DM, Hinnebusch BJ, Rittner CM, Gage KL. Quantitative competitive PCR as a technique for exploring flea-Yersina pestis dynamics. Am J Trop Med Hyg. 2000;62:552–560. doi: 10.4269/ajtmh.2000.62.552. [DOI] [PubMed] [Google Scholar]
  • 43.Hinnebusch BJ, Gage KL, Schwan TG. Estimation of vector infectivity rates for plague by means of a standard curve-based competitive polymerase chain reaction method to quantify Yersinia pestis in fleas. Am J Trop Med Hyg. 1998;58:562–569. doi: 10.4269/ajtmh.1998.58.562. [DOI] [PubMed] [Google Scholar]
  • 44.Dai R, He J, Zha X, Wang Y, Zhang X, Gao H, Yang X, Li J, Xin Y, Wang Y, et al. A novel mechanism of streptomycin resistance in Yersinia pestis: Mutation in the rpsL gene. PLoS Negl Trop Dis. 2021;15(e0009324) doi: 10.1371/journal.pntd.0009324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Steinberger-Levy I, Shifman O, Zvi A, Ariel N, Beth-Din A, Israeli O, Gur D, Aftalion M, Maoz S, Ber R. A rapid molecular test for determining Yersinia pestis susceptibility to ciprofloxacin by the quantification of differentially expressed marker genes. Front Microbiol. 2016;7(763) doi: 10.3389/fmicb.2016.00763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Lindler LE, Fan W, Jahan N. Detection of ciprofloxacin-resistant Yersinia pestis by fluorogenic PCR using the LightCycler. J Clin Microbiol. 2001;39:3649–3655. doi: 10.1128/JCM.39.10.3649-3655.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Shifman O, Steinberger-Levy I, Aloni-Grinstein R, Gur D, Aftalion M, Ron I, Mamroud E, Ber R, Rotem S. A rapid antimicrobial susceptibility test for determining Yersinia pestis susceptibility to Doxycycline by RT-PCR quantification of RNA markers. Front Microbiol. 2019;10(754) doi: 10.3389/fmicb.2019.00754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Ehlers J, Krüger A, Rakotondranary SJ, Ratovonamana RY, Poppert S, Ganzhorn JU, Tappe D. Molecular detection of Rickettsia spp., Borrelia spp., Bartonella spp. and Yersinia pestis in ectoparasites of endemic and domestic animals in southwest Madagascar. Acta Trop. 2020;205(105339) doi: 10.1016/j.actatropica.2020.105339. [DOI] [PubMed] [Google Scholar]
  • 49.Leal NC, Almeida AM. Diagnosis of plague and identification of virulence markers in Yersinia pestis by multiplex-PCR. Rev Inst Med Trop Sao Paulo. 1999;41:339–342. doi: 10.1590/s0036-46651999000600002. [DOI] [PubMed] [Google Scholar]
  • 50.Griffin KA, Martin DJ, Rosen LE, Sirochman MA, Walsh DP, Wolfe LL, Miller MW. Detection of Yersinia pestis DNA in prairie dog-associated fleas by polymerase chain reaction assay of purified DNA. J Wildl Dis. 2010;46:636–643. doi: 10.7589/0090-3558-46.2.636. [DOI] [PubMed] [Google Scholar]
  • 51.Neubauer H, Meyer H, Prior J, Aleksic S, Hensel A, Splettstösser W. A combination of different polymerase chain reaction (PCR) assays for the presumptive identification of Yersinia pestis. J Vet Med B Infect Dis Vet Public Health. 2000;47:573–580. doi: 10.1046/j.1439-0450.2000.00384.x. [DOI] [PubMed] [Google Scholar]
  • 52.Mize EL, Britten HB. Detections of Yersinia pestis east of the known distribution of active plague in the United States. Vector Borne Zoonotic Dis. 2016;16:88–95. doi: 10.1089/vbz.2015.1825. [DOI] [PubMed] [Google Scholar]
  • 53.Safari Foroshani N, Karami A, Pourali F. Simultaneous and rapid detection of Salmonella typhi, Bacillus anthracis, and Yersinia pestis by using multiplex polymerase chain reaction (PCR) Iran Red Crescent Med J. 2013;15(e9208) doi: 10.5812/ircmj.9208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Engelthaler DM, Gage KL, Montenieri JA, Chu M, Carter LG. PCR detection of Yersinia pestis in fleas: Comparison with mouse inoculation. J Clin Microbiol. 1999;37:1980–1984. doi: 10.1128/JCM.37.6.1980-1984.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Nyirenda SS, Hang'ombe BM, Mulenga E, Kilonzo BS. Serological and PCR investigation of Yersinia pestis in potential reservoir hosts from a plague outbreak focus in Zambia. BMC Res Notes. 2017;10(345) doi: 10.1186/s13104-017-2667-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Rahalison L, Vololonirina E, Ratsitorahina M, Chanteau S. Diagnosis of bubonic plague by PCR in Madagascar under field conditions. J Clin Microbiol. 2000;38:260–263. doi: 10.1128/JCM.38.1.260-263.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Nyirenda SS, Hang Ombe BM, Simulundu E, Mulenga E, Moonga L, Machang U RS, Misinzo G, Kilonzo BS. Molecular epidemiological investigations of plague in Eastern Province of Zambia. BMC Microbiol. 2018;18(2) doi: 10.1186/s12866-017-1146-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Radnedge L, Gamez-Chin S, McCready PM, Worsham PL, Andersen GL. Identification of nucleotide sequences for the specific and rapid detection of Yersinia pestis. Appl Environ Microbiol. 2001;67:3759–3762. doi: 10.1128/AEM.67.8.3759-3762.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Tsukano H, Itoh K, Suzuki S, Watanabe H. Detection and identification of Yersinia pestis by polymerase chain reaction (PCR) using multiplex primers. Microbiol Immunol. 1996;40:773–775. doi: 10.1111/j.1348-0421.1996.tb01140.x. [DOI] [PubMed] [Google Scholar]
  • 60.Zhang Z, Wu L, Liang Y, Wang S, He J, Yu D, Li W. Identification of Yersinia pestis of Xilingele plateau ecotype isolated from China using insertion sequences as target. Ann Clin Lab Sci. 2019;49:656–660. [PubMed] [Google Scholar]
  • 61.Ziwa MH, Matee MI, Kilonzo BS, Hang'ombe BM. Evidence of Yersinia pestis DNA in rodents in plague outbreak foci in Mbulu and Karatu Districts, northern Tanzania. Tanzan J Health Res. 2013;15:152–157. doi: 10.4314/thrb.v15i3.1. [DOI] [PubMed] [Google Scholar]
  • 62.Zasada AA, Formińska K, Zacharczuk K. Fast identification of Yersinia pestis, Bacillus anthracis and Francisella tularensis based on conventional PCR. Pol J Microbiol. 2013;62:453–455. [PubMed] [Google Scholar]
  • 63.Singh R, Pal V, Kumar M, Tripathi NK, Goel AK. Development of a PCR-lateral flow assay for rapid detection of Yersinia pestis, the causative agent of plague. Acta Trop. 2021;220(105958) doi: 10.1016/j.actatropica.2021.105958. [DOI] [PubMed] [Google Scholar]
  • 64.Arnold T, Hensel A, Hagen R, Aleksic S, Neubauer H, Scholz HC. A highly specific one-step PCR-assay for the rapid discrimination of enteropathogenic Yersinia enterocolitica from pathogenic Yersinia pseudotuberculosis and Yersinia pestis. Syst Appl Microbiol. 2001;24:285–289. doi: 10.1078/0723-2020-00040. [DOI] [PubMed] [Google Scholar]
  • 65.Trukhachev AL, Ivanova VS, Arsen'eva TE, Lebedeva SA, Goncharenko EV. Search for primers on the basis of Yersinia pestis chromosomal DNA for effective PCR identification of typical and atypical plague pathogen strains. Klin Lab Diagn. 2008:49–52. (In Russian) [PubMed] [Google Scholar]
  • 66.Zhou D, Han Y, Dai E, Pei D, Song Y, Zhai J, Du Z, Wang J, Guo Z, Yang R. Identification of signature genes for rapid and specific characterization of Yersinia pestis. Microbiol Immunol. 2004;48:263–269. doi: 10.1111/j.1348-0421.2004.tb03522.x. [DOI] [PubMed] [Google Scholar]
  • 67.Fenollar F, Raoult D. Molecular genetic methods for the diagnosis of fastidious microorganisms. APMIS. 2004;112:785–807. doi: 10.1111/j.1600-0463.2004.apm11211-1206.x. [DOI] [PubMed] [Google Scholar]
  • 68.Anderson B, Rashid MH, Carter C, Pasternack G, Rajanna C, Revazishvili T, Dean T, Senecal A, Sulakvelidze A. Enumeration of bacteriophage particles: Comparative analysis of the traditional plaque assay and real-time QPCR- and nanosight-based assays. Bacteriophage. 2011;1:86–93. doi: 10.4161/bact.1.2.15456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Tomaso H, Jacob D, Eickhoff M, Scholz HC, Al Dahouk S, Kattar MM, Reischl U, Plicka H, Olsen JS, Nikkari S, et al. Preliminary validation of real-time PCR assays for the identification of Yersinia pestis. Clin Chem Lab Med. 2008;46:1239–1244. doi: 10.1515/CCLM.2008.251. [DOI] [PubMed] [Google Scholar]
  • 70.Rachwal PA, Rose HL, Cox V, Lukaszewski RA, Murch AL, Weller SA. The potential of TaqMan array cards for detection of multiple biological agents by real-time PCR. PLoS One. 2012;7(e35971) doi: 10.1371/journal.pone.0035971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Gaddy CE, Cuevas PF, Hartman LJ, Howe GB, Worsham PL, Minogue TD. Development of real-time PCR assays for specific detection of hmsH, hmsF, hmsR, and irp2 located within the 102-kb pgm locus of Yersinia pestis. Mol Cell Probes. 2014;28:288–295. doi: 10.1016/j.mcp.2014.08.004. [DOI] [PubMed] [Google Scholar]
  • 72.Riehm JM, Rahalison L, Scholz HC, Thoma B, Pfeffer M, Razanakoto LM, Al Dahouk S, Neubauer H, Tomaso H. Detection of Yersinia pestis using real-time PCR in patients with suspected bubonic plague. Mol Cell Probes. 2011;25:8–12. doi: 10.1016/j.mcp.2010.09.002. [DOI] [PubMed] [Google Scholar]
  • 73.Yang S, Rothman RE, Hardick J, Kuroki M, Hardick A, Doshi V, Ramachandran P, Gaydos CA. Rapid polymerase chain reaction-based screening assay for bacterial biothreat agents. Acad Emerg Med. 2008;15:388–392. doi: 10.1111/j.1553-2712.2008.00061.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Amoako KK, Goji N, Macmillan T, Said KB, Druhan S, Tanaka E, Thomas EG. Development of multitarget real-time PCR for the rapid, specific, and sensitive detection of Yersinia pestis in milk and ground beef. J Food Prot. 2010;73:18–25. doi: 10.4315/0362-028x-73.1.18. [DOI] [PubMed] [Google Scholar]
  • 75.Liu J, Ochieng C, Wiersma S, Ströher U, Towner JS, Whitmer S, Nichol ST, Moore CC, Kersh GJ, Kato C, et al. Development of a TaqMan array card for acute-febrile-illness outbreak investigation and surveillance of emerging pathogens, including Ebola virus. J Clin Microbiol. 2016;54:49–58. doi: 10.1128/JCM.02257-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Hindson BJ, McBride MT, Makarewicz AJ, Henderer BD, Setlur US, Smith SM, Gutierrez DM, Metz TR, Nasarabadi SL, Venkateswaran KS, et al. Autonomous detection of aerosolized biological agents by multiplexed immunoassay with polymerase chain reaction confirmation. Anal Chem. 2005;77:284–289. doi: 10.1021/ac0489014. [DOI] [PubMed] [Google Scholar]
  • 77.Woubit A, Yehualaeshet T, Habtemariam T, Samuel T. Novel genomic tools for specific and real-time detection of biothreat and frequently encountered foodborne pathogens. J Food Prot. 2012;75:660–670. doi: 10.4315/0362-028X.JFP-11-480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Higgins JA, Ezzell J, Hinnebusch BJ, Shipley M, Henchal EA, Ibrahim MS. 5' nuclease PCR assay to detect Yersinia pestis. J Clin Microbiol. 1998;36:2284–2288. doi: 10.1128/JCM.36.8.2284-2288.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Tomaso H, Reisinger EC, Al Dahouk S, Frangoulidis D, Rakin A, Landt O, Neubauer H. Rapid detection of Yersinia pestis with multiplex real-time PCR assays using fluorescent hybridisation probes. FEMS Immunol Med Microbiol. 2003;38:117–126. doi: 10.1016/S0928-8244(03)00184-6. [DOI] [PubMed] [Google Scholar]
  • 80.Skottman T, Piiparinen H, Hyytiäinen H, Myllys V, Skurnik M, Nikkari S. Simultaneous real-time PCR detection of Bacillus anthracis, Francisella tularensis and Yersinia pestis. Eur J Clin Microbiol Infect Dis. 2007;26:207–211. doi: 10.1007/s10096-007-0262-z. [DOI] [PubMed] [Google Scholar]
  • 81.Comer JE, Lorange EA, Hinnebusch BJ. Examining the vector-host-pathogen interface with quantitative molecular tools. Methods Mol Biol. 2008;431:123–131. doi: 10.1007/978-1-60327-032-8_10. [DOI] [PubMed] [Google Scholar]
  • 82.Stewart A, Satterfield B, Cohen M, O'Neill K, Robison R. A quadruplex real-time PCR assay for the detection of Yersinia pestis and its plasmids. J Med Microbiol. 2008;57:324–331. doi: 10.1099/jmm.0.47485-0. [DOI] [PubMed] [Google Scholar]
  • 83.Chase CJ, Ulrich MP, Wasieloski LP Jr, Kondig JP, Garrison J, Lindler LE, Kulesh DA. Real-time PCR assays targeting a unique chromosomal sequence of Yersinia pestis. Clin Chem. 2005;51:1778–1785. doi: 10.1373/clinchem.2005.051839. [DOI] [PubMed] [Google Scholar]
  • 84.Sergueev KV, He Y, Borschel RH, Nikolich MP, Filippov AA. Rapid and sensitive detection of Yersinia pestis using amplification of plague diagnostic bacteriophages monitored by real-time PCR. PLoS One. 2010;5(e11337) doi: 10.1371/journal.pone.0011337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Satterfield BC, Kulesh DA, Norwood DA, Wasieloski LP Jr, Caplan MR, West JA. Tentacle probes: Differentiation of difficult single-nucleotide polymorphisms and deletions by presence or absence of a signal in real-time PCR. Clin Chem. 2007;53:2042–2050. doi: 10.1373/clinchem.2007.091488. [DOI] [PubMed] [Google Scholar]
  • 86.Sting R, Eisenberg T, Hrubenja M. Rapid and reasonable molecular identification of bacteria and fungi in microbiological diagnostics using rapid real-time PCR and sanger sequencing. J Microbiol Methods. 2019;159:148–156. doi: 10.1016/j.mimet.2019.03.005. [DOI] [PubMed] [Google Scholar]
  • 87.Saikaly PE, Barlaz MA, de*Los*Reyes FL*III. Development of quantitative real-time PCR assays for detection and quantification of surrogate biological warfare agents in building debris and leachate. Appl Environ Microbiol. 2007;73:6557–6565. doi: 10.1128/AEM.00779-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Thomas MC, Janzen TW, Huscyzynsky G, Mathews A, Amoako KK. Development of a novel multiplexed qPCR and pyrosequencing method for the detection of human pathogenic yersiniae. Int J Food Microbiol. 2017;257:247–253. doi: 10.1016/j.ijfoodmicro.2017.06.019. [DOI] [PubMed] [Google Scholar]
  • 89.Mostafavi E, Ghasemi A, Rohani M, Molaeipoor L, Esmaeili S, Mohammadi Z, Mahmoudi A, Aliabadian M, Johansson A. Molecular survey of tularemia and plague in small mammals from Iran. Front Cell Infect Microbiol. 2018;8(215) doi: 10.3389/fcimb.2018.00215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Hennebique A, Gas F, Batina H, De Araujo C, Bizet K, Maurin M. Evaluation of the biotoxis qPCR detection kit for Francisella tularensis detection in clinical and environmental samples. J Clin Microbiol. 2020;59:e01434–20. doi: 10.1128/JCM.01434-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Christensen DR, Hartman LJ, Loveless BM, Frye MS, Shipley MA, Bridge DL, Richards MJ, Kaplan RS, Garrison J, Baldwin CD, et al. Detection of biological threat agents by real-time PCR: Comparison of assay performance on the R.A.P.I.D., the LightCycler, and the smart cycler platforms. Clin Chem. 2006;52:141–145. doi: 10.1373/clinchem.2005.052522. [DOI] [PubMed] [Google Scholar]
  • 92.Matero P, Hemmilä H, Tomaso H, Piiparinen H, Rantakokko-Jalava K, Nuotio L, Nikkari S. Rapid field detection assays for Bacillus anthracis, Brucella spp., Francisella tularensis and Yersinia pestis. Clin Microbiol Infect. 2011;17:34–43. doi: 10.1111/j.1469-0691.2010.03178.x. [DOI] [PubMed] [Google Scholar]
  • 93.Mölsä M, Hemmilä H, Katz A, Niemimaa J, Forbes KM, Huitu O, Stuart P, Henttonen H, Nikkari S. Monitoring biothreat agents (Francisella tularensis, Bacillus anthracis and Yersinia pestis) with a portable real-time PCR instrument. J Microbiol Methods. 2015;115:89–93. doi: 10.1016/j.mimet.2015.05.026. [DOI] [PubMed] [Google Scholar]
  • 94.Elsholz B, Nitsche A, Achenbach J, Ellerbrok H, Blohm L, Albers J, Pauli G, Hintsche R, Wörl R. Electrical microarrays for highly sensitive detection of multiplex PCR products from biological agents. Biosens Bioelectron. 2009;24:1737–1743. doi: 10.1016/j.bios.2008.09.003. [DOI] [PubMed] [Google Scholar]
  • 95.Stenkova AM, Isaeva MP, Rasskazov VA. Development of a multiplex PCR for detection of the Yersinia genus with identification of pathogenic species (Y. pestis, Y. pseudotuberculosis, Y. enterocolitica) Mol Gen Mikrobiol Virusol. 2008:18–23. (In Russian) [PubMed] [Google Scholar]
  • 96.Stevenson HL, Bai Y, Kosoy MY, Montenieri JA, Lowell JL, Chu MC, Gage KL. Detection of novel Bartonella strains and Yersinia pestis in prairie dogs and their fleas (Siphonaptera: Ceratophyllidae and Pulicidae) using multiplex polymerase chain reaction. J Med Entomol. 2003;40:329–337. doi: 10.1603/0022-2585-40.3.329. [DOI] [PubMed] [Google Scholar]
  • 97.Demeure CE, Dussurget O, Mas Fiol G, Le Guern AS, Savin C, Pizarro-Cerdá J. Yersinia pestis and plague: An updated view on evolution, virulence determinants, immune subversion, vaccination, and diagnostics. Genes Immun. 2019;20:357–370. doi: 10.1038/s41435-019-0065-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Woron AM, Nazarian EJ, Egan C, McDonough KA, Cirino NM, Limberger RJ, Musser KA. Development and evaluation of a 4-target multiplex real-time polymerase chain reaction assay for the detection and characterization of Yersinia pestis. Diagn Microbiol Infect Dis. 2006;56:261–268. doi: 10.1016/j.diagmicrobio.2006.06.009. [DOI] [PubMed] [Google Scholar]
  • 99.He J, Kraft AJ, Fan J, Van Dyke M, Wang L, Bose ME, Khanna M, Metallo JA, Henrickson KJ. Simultaneous detection of CDC category ‘A’ DNA and RNA bioterrorism agents by use of multiplex PCR & RT-PCR enzyme hybridization assays. Viruses. 2009;1:441–459. doi: 10.3390/v1030441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Vanlalhmuaka Thavachelvam K, Tuteja U, Sarika K, Nagendra S, Kumar S. Reverse line blot macroarray for simultaneous detection and characterization of four biological warfare agents. Indian J Microbiol. 2013;53:41–47. doi: 10.1007/s12088-012-0330-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Batra SA, Krupanidhi S, Tuteja U. A sensitive & specific multiplex PCR assay for simultaneous detection of Bacillus anthracis, Yersinia pestis, Burkholderia pseudomallei & Brucella species. Indian J Med Res. 2013;138:111–116. [PMC free article] [PubMed] [Google Scholar]
  • 102.Regan JF, Makarewicz AJ, Hindson BJ, Metz TR, Gutierrez DM, Corzett TH, Hadley DR, Mahnke RC, Henderer BD, Breneman JW IV, et al. Environmental monitoring for biological threat agents using the autonomous pathogen detection system with multiplexed polymerase chain reaction. Anal Chem. 2008;80:7422–7429. doi: 10.1021/ac801125x. [DOI] [PubMed] [Google Scholar]
  • 103.Wilson WJ, Erler AM, Nasarabadi SL, Skowronski EW, Imbro PM. A multiplexed PCR-coupled liquid bead array for the simultaneous detection of four biothreat agents. Mol Cell Probes. 2005;19:137–144. doi: 10.1016/j.mcp.2004.10.005. [DOI] [PubMed] [Google Scholar]
  • 104.Tran TN, Signoli M, Fozzati L, Aboudharam G, Raoult D, Drancourt M. High throughput, multiplexed pathogen detection authenticates plague waves in medieval Venice, Italy. PLoS One. 2011;6(e16735) doi: 10.1371/journal.pone.0016735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105.Melo AC, Almeida AM, Leal NC. Retrospective study of a plague outbreak by multiplex-PCR. Lett Appl Microbiol. 2003;37:361–364. doi: 10.1046/j.1472-765x.2003.01377.x. [DOI] [PubMed] [Google Scholar]
  • 106.Deshpande A, Gans J, Graves SW, Green L, Taylor L, Kim HB, Kunde YA, Leonard PM, Li PE, Mark J, et al. A rapid multiplex assay for nucleic acid-based diagnostics. J Microbiol Methods. 2010;80:155–163. doi: 10.1016/j.mimet.2009.12.001. [DOI] [PubMed] [Google Scholar]
  • 107.Weller SA, Cox V, Essex-Lopresti A, Hartley MG, Parsons TM, Rachwal PA, Stapleton HL, Lukaszewski RA. Evaluation of two multiplex real-time PCR screening capabilities for the detection of Bacillus anthracis, Francisella tularensis and Yersinia pestis in blood samples generated from murine infection models. J Med Microbiol. 2012;61:1546–1555. doi: 10.1099/jmm.0.049007-0. [DOI] [PubMed] [Google Scholar]
  • 108.Trebesius K, Harmsen D, Rakin A, Schmelz J, Heesemann J. Development of rRNA-targeted PCR and in situ hybridization with fluorescently labelled oligonucleotides for detection of Yersinia species. J Clin Microbiol. 1998;36:2557–2564. doi: 10.1128/JCM.36.9.2557-2564.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 109.Souza G, Abath F, Leal N, Farias A, Almeida A. Development and evaluation of a single tube nested PCR based approach (STNPCR) for the diagnosis of plague. Adv Exp Med Biol. 2007;603:351–359. doi: 10.1007/978-0-387-72124-8_32. [DOI] [PubMed] [Google Scholar]
  • 110.Glukhov AI, Gordeev SA, Al'tshuler ML, Zykova IE, Severin SE. Use of nested PCR in detection of the plague pathogen. Klin Lab Diagn. 2003:48–50. (In Russian) [PubMed] [Google Scholar]
  • 111.Belgrader P, Benett W, Hadley D, Long G, Mariella R Jr, Milanovich F, Nasarabadi S, Nelson W, Richards J, Stratton P. Rapid pathogen detection using a microchip PCR array instrument. Clin Chem. 1998;44:2191–2194. [PubMed] [Google Scholar]
  • 112.Pingle MR, Granger K, Feinberg P, Shatsky R, Sterling B, Rundell M, Spitzer E, Larone D, Golightly L, Barany F. Multiplexed identification of blood-borne bacterial pathogens by use of a novel 16S rRNA gene PCR-ligase detection reaction-capillary electrophoresis assay. J Clin Microbiol. 2007;45:1927–1935. doi: 10.1128/JCM.00226-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 113.Jacob D, Sauer U, Housley R, Washington C, Sannes-Lowery K, Ecker DJ, Sampath R, Grunow R. Rapid and high-throughput detection of highly pathogenic bacteria by Ibis PLEX-ID technology. PLoS One. 2012;7(e39928) doi: 10.1371/journal.pone.0039928. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 114.Song J, Li PE, Gans J, Vuyisich M, Deshpande A, Wolinsky M, White PS. Simultaneous pathogen detection and antibiotic resistance characterization using SNP-based multiplexed oligonucleotide ligation-PCR (MOL-PCR) Adv Exp Med Biol. 2010;680:455–464. doi: 10.1007/978-1-4419-5913-3_51. [DOI] [PubMed] [Google Scholar]
  • 115.Souza RA, Frazão MR, Almeida AM, Falcão JP. Rapid and efficient differentiation of Yersinia species using high-resolution melting analysis. J Microbiol Methods. 2015;115:6–12. doi: 10.1016/j.mimet.2015.05.014. [DOI] [PubMed] [Google Scholar]
  • 116.Jeng K, Hardick J, Rothman R, Yang S, Won H, Peterson S, Hsieh YH, Masek BJ, Carroll KC, Gaydos CA. Reverse transcription-PCR-electrospray ionization mass spectrometry for rapid detection of biothreat and common respiratory pathogens. J Clin Microbiol. 2013;51:3300–3307. doi: 10.1128/JCM.01443-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 117.Jelinkova P, Hrdy J, Markova J, Dresler J, Pajer P, Pavlis O, Branich P, Borilova G, Reichelova M, Babak V, et al. Development and inter-laboratory validation of diagnostics panel for detection of biothreat bacteria based on MOL-PCR assay. Microorganisms. 2020;9(38) doi: 10.3390/microorganisms9010038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 118.Woubit A, Yehualaeshet T, Roberts S, Graham M, Kim M, Samuel T. Customizable PCR-microplate array for differential identification of multiple pathogens. J Food Prot. 2013;76:1948–1957. doi: 10.4315/0362-028X.JFP-13-153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 119.Malou N, Tran TN, Nappez C, Signoli M, Le Forestier C, Castex D, Drancourt M, Raoult D. Immuno-PCR-a new tool for paleomicrobiology: The plague paradigm. PLoS One. 2012;7(e31744) doi: 10.1371/journal.pone.0031744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 120.Mayboroda O, Gonzalez Benito A, Sabaté del Rio J, Svobodova M, Julich S, Tomaso H, O'Sullivan CK, Katakis I. Isothermal solid-phase amplification system for detection of Yersinia pestis. Anal Bioanal Chem. 2016;408:671–676. doi: 10.1007/s00216-015-9177-1. [DOI] [PubMed] [Google Scholar]
  • 121.Kane SR, Shah SR, Alfaro TM. Development of a rapid viability polymerase chain reaction method for detection of Yersinia pestis. J Microbiol Methods. 2019;162:21–27. doi: 10.1016/j.mimet.2019.05.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 122.Iqbal SS, Chambers JP, Goode MT, Valdes JJ, Brubaker RR. Detection of Yersinia pestis by pesticin fluorogenic probe-coupled PCR. Mol Cell Probes. 2000;14:109–114. doi: 10.1006/mcpr.2000.0295. [DOI] [PubMed] [Google Scholar]
  • 123.Raoult D, Aboudharam G, Crubézy E, Larrouy G, Ludes B, Drancourt M. Molecular identification by ‘suicide PCR’ of Yersinia pestis as the agent of medieval black death. Proc Natl Acad Sci USA. 2000;97:12800–12803. doi: 10.1073/pnas.220225197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 124.Norkina OV, Kulichenko AN, Gintsburg AL, Tuchkov IV, Popov YuA, Aksenov MU, Drosdov IG. Development of a diagnostic test for Yersinia pestis by the polymerase chain reaction. J Appl Bacteriol. 1994;76:240–245. doi: 10.1111/j.1365-2672.1994.tb01622.x. [DOI] [PubMed] [Google Scholar]
  • 125.Loïez C, Herwegh S, Wallet F, Armand S, Guinet F, Courcol RJ. Detection of Yersinia pestis in sputum by real-time PCR. J Clin Microbiol. 2003;41:4873–4875. doi: 10.1128/JCM.41.10.4873-4875.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 126.Feng N, Zhou Y, Fan Y, Bi Y, Yang R, Zhou Y, Wang X. Yersinia pestis detection by loop-mediated isothermal amplification combined with magnetic bead capture of DNA. Braz J Microbiol. 2018;49:128–137. doi: 10.1016/j.bjm.2017.03.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 127.Leal NC, Abath FG, Alves LC, de*Almeida AM. A simple PCR-based procedure for plague diagnosis. Rev Inst Med Trop Sao Paulo. 1996;38:371–373. doi: 10.1590/s0036-46651996000500009. [DOI] [PubMed] [Google Scholar]
  • 128.Afanas'ev EN, Briukhanov AF, Briukhanova GD, Tiumentseva IS, Chzhichzhou S, Zharinova NV, Efremenko VI, Zharnikova IV. Detection of plague microbe in the fleas by polymerase chain reaction by using magnetic immunosorbents. Med Parazitol (Mosk) 2004:33–36. (In Russian) [PubMed] [Google Scholar]
  • 129.Coyne SR, Craw PD, Norwood DA, Ulrich MP. Comparative analysis of the schleicher and schuell IsoCode stix DNA isolation device and the qiagen qiaamp DNA mini kit. J Clin Microbiol. 2004;42:4859–4862. doi: 10.1128/JCM.42.10.4859-4862.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 130.Dauphin LA, Stephens KW, Eufinger SC, Bowen MD. Comparison of five commercial DNA extraction kits for the recovery of Yersinia pestis DNA from bacterial suspensions and spiked environmental samples. J Appl Microbiol. 2010;108:163–172. doi: 10.1111/j.1365-2672.2009.04404.x. [DOI] [PubMed] [Google Scholar]
  • 131.Gilbert MTP, Cuccui J, White W, Lynnerup N, Titball RW, Cooper A, Prentice MB. Absence of Yersinia pestis-specific DNA in human teeth from five European excavations of putative plague victims. Microbiology (Reading) 2004;150:341–354. doi: 10.1099/mic.0.26594-0. [DOI] [PubMed] [Google Scholar]
  • 132.Hong-Geller E, Valdez YE, Shou Y, Yoshida TM, Marrone BL, Dunbar JM. Evaluation of Bacillus anthracis and Yersinia pestis sample collection from nonporous surfaces by quantitative real-time PCR. Lett Appl Microbiol. 2010;50:431–437. doi: 10.1111/j.1472-765X.2010.02821.x. [DOI] [PubMed] [Google Scholar]
  • 133.Ramasindrazana B, Parany MN, Rasoamalala F, Rasoanoro M, Rahajandraibe S, Vogler AJ, Sahl JW, Andrianaivoarimanana V, Rajerison M, Wagner DM. Local-scale diversity of Yersinia pestis: A case study from Ambohitromby, Ankazobe District, Madagascar. Zoonoses Public Health. 2022;69:61–70. doi: 10.1111/zph.12892. [DOI] [PubMed] [Google Scholar]
  • 134.Essbauer S, Baumann K, Schlegel M, Faulde MK, Lewitzki J, Sauer SC, Frangoulidis D, Riehm JM, Dobler G, Teifke JP, et al. Small mammals as reservoir for zoonotic agents in Afghanistan. Mil Med. 2022;187:e189–e196. doi: 10.1093/milmed/usab008. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Not applicable.


Articles from Experimental and Therapeutic Medicine are provided here courtesy of Spandidos Publications

RESOURCES