Skip to main content
NCBI home page
Journal of Animal Science logoLink to Journal of Animal Science
. 2022 May 31;100(7):skac199. doi: 10.1093/jas/skac199

Constant light exposure in early life induces m6A-mediated inhibition of IGF gene family in the chicken

Yang Yang 1,2, Peirong Xu 3,4, Jie Liu 5,6, Mindie Zhao 7,8, Wei Cong 9,10, Wanwan Han 11,12, Deyun Wang 13,14, Ruqian Zhao 15,16,✉
PMCID: PMC9259593  PMID: 35641104

Abstract

Insulin-like growth factor (IGF) family plays important roles in regulating the development of various organ systems through stimulating cell proliferation and differentiation. Photoperiod is an important factor affecting growth and development in the chicken, yet the effect of constant light exposure in early life on IGF1 and IGF2 expression in the chicken remains unclear. In this study, one-day-old chickens were kept in either constant light (24L:0D, LL) or natural photoperiod (12L:12D, LD) for the first week of life and then maintained in constant light from 8 to 21 d of age. Constant light exposure in early life reduced mRNA expression of IGF gene family, including mRNA expression of IGF1, IGF2, and IGF2 binding proteins, in the hippocampus, hypothalamus, and liver of chickens at both 7 and 21 d of age. Moreover, constant light exposure increased mRNA expression of genes involved in RNA methylation N6-methyladenosine (m6A) in a tissue-specific manner. Interestingly, higher m6A on 3ʹUTR of IGF2 mRNA coincides with lower IGF2 mRNA, indicating a possible role of m6A in the post-transcriptional regulation of IGF2 expression in the hippocampus, hypothalamus, and liver of chickens. These findings suggest a m6A-mediated gene regulation of IGF gene family in different organs of chicken and expand our knowledge on mechanism of gene regulation in response to early life experience.

Keywords: chicken, constant light, IGF2, IGF2BPs, m6A

1. Constant light exposure reduces the expression of IGF1, IGF2 and IGF2BPs genes in a age-dependent and tissue-specific manner.

2. LL increases m6A on 3ʹUTR of IGF2 mRNA in hippocampus, hypothalamus, and liver.

Introduction

Insulin-like growth factors (IGFs) play a critical role in regulating cell proliferation and differentiation in almost all tissues (Poreba and Durzynska, 2020). It is composed of two IGFs (IGF1 and IGF2), two IGF receptors (IGF1R and IGF2R), and six IGF-binding proteins (IGFBPs; Shimasaki and Ling, 1991, Kavran et al., 2014). Meanwhile, IGFs system exerts many effects in the brain (Fernandez and Torres-Aleman, 2012), regulating cell differentiation and brain growth, metabolic and behavioral adaptation, food seeking and energy homeostasis, and spatial memory. IGF1 and IGF2 play an important role in hippocampal (Llorens-Martin et al., 2009) and hypothalamic (Perez-Martin et al., 2010) neurogenesis especially during early life, via binding to their receptors. IGF1 and IGF2 are produced virtually by all tissues and may act in endocrine, autocrine, and paracrine fashions. Liver is the main source of endocrine IGFs (Yakar et al., 2002) that travel through the bloodstream to the target tissues, including brain, to exert their biological functions through binding to the specific receptors. Apart from its endocrine function, IGFs produced locally in hippocampus (Lindholm et al., 1996) and hypothalamus (Schneider et al., 2003) act via autocrine–paracrine fashion to regulate neuron survival and various neuron activities (Fernandez and Torres-Aleman, 2012).

Nowadays, light pollution is a potential risk factor for animal and human health (Navara and Nelson, 2007). Aberrant light exposure (such as light at night and super-intensity light) induces sleep disturbances (Deboer et al., 2007) and mood disorders, as well as major depressive disorder (Dumont and Beaulieu, 2007). In poultry, photoperiod is an important factor affecting the growth, development and behavior of broiler chickens (Olanrewaju et al., 2013; Zheng et al., 2013). It has been reported that different wavelengths of light has varying stimulatory effects on IGF1 expression in the chicken (Bai et al., 2016). Compared with red and green light, exposure to white and blue light reduced plasma IGF1 levels and muscle expression of IGF1R mRNA in the chicken (Bai et al., 2016). In addition, compared with green LED light, red LED light reduced IGF1 levels in barfin flounder (Takahashi et al., 2016). Previously, we reported that white LED light exposure for 24 h significantly reduced IGF1 secretion and decreased IGF1 mRNA expression in hippocampal neuron cells (Yang et al., 2017). However, the effect of photoperiod during early posthatch stage on IGF1 and IGF2 expression in chicken hippocampus, hypothalamus and liver is still unclear.

N6-methyladenosine (m6A) is a well-known post-transcriptional modification on RNAs, which plays critical roles in regulating mRNA metabolism, especially in RNA splicing, degradation and translation (Lan et al., 2021). M6A modification is dynamically regulated through interplay among m6A “writers” (methyltransferases, including METTL3, METTL14, and WTAP), “erasers” (demethylases, including fat mass and obesity-associated gene FTO and ALKBH5), and “readers” (binding proteins, including YTHDF1, YTHDF2, and YTHDF3; Cao et al., 2016). A recent study has identified IGF2 mRNA binding proteins (IGF2BPs, IGF2BP1/2/3) as a new class of m6A binding proteins that protect m6A-modified mRNAs from decay (Huang et al., 2018). IGF2BPs are important regulators of the IGF system that affect multiple aspects of target RNAs, including localization, translation, and stability (Degrauwe et al., 2016). In addition, IGF2BPs play a specific role in regulating IGF2 and IGF1R mRNA expression, leading to increased IGF signaling in different types of tumor (Hafner et al., 2010; Panebianco et al., 2017). However, the effect of photoperiod during early posthatch stage on m6A modification and IGF2BPs expression in chicken hippocampus, hypothalamus, and liver is still unknown.

Therefore, the objectives of the present study were, first, to elaborate the effects of early posthatch constant light on the expression of IGF gene family in chicken hippocampus, hypothalamus, and liver; second, to delineate the expression of IGF2BPs and m6A-related genes in chicken hippocampus, hypothalamus, and liver; and third, to investigate the possible link between m6A modification and IGF2 expression in chicken hippocampus, hypothalamus, and liver.

Materials and Methods

Ethics statement

The experimental protocol was approved by the Animal Ethics Committee of Nanjing Agricultural University. The project number is 31972638. The sampling procedures complied with the “Guidelines on Ethical Treatment of Experimental Animals’’ (2006) No. 398 set by the Ministry of Science and Technology, China.

Animals and experimental design

The chicken model employed in this study is a locally bred chicken line used for meat production in China. Eighty 1-d-old male Yellow-footed chickens were purchased from Changzhou Lihua Livestock and Poultry Co., Ltd. and randomly divided into normal (LD) and constant (LL) photoperiods groups. In the first week after hatching, LD group was reared under the light regime of 12 h light:12 h dark, with light on at 07:00 h and off at 19:00 h, whereas LL group was kept under the light regime of 24 h light:0 h dark. The light intensity was about 200 lux for both groups in the first week, due to the illumination from the heat lamps. From 8 to 21 d, chickens from both groups were maintained under the same light regime (12L:12D) until the end of the experiment (21 d). The light intensity was about 80 lux for both groups from the second week when the heat lamps were removed. The birds in LD and LL groups were housed in two adjacent rooms with the same condition except the lighting regime set for each group. Birds in each room were housed in 2 individual cages with 20 birds per cage for the first week and then distributed into four cages with 10 birds per cage thereafter till the end of the experiment. Feed and water were provided ad libitum. The room temperature was set according to the standard established by the breeding company. In detail, the temperature was 35 °C for the first 2 d, 32 to 34 °C from 3 to 7 d, 30 to 32 °C from 8 to 14 d, and 27 to 30 °C from 15 to 21 d. The feed consumption per cage was recorded daily, and the body weight was recorded every week. By the end of the experiment, chickens were anesthetized with sodium pentobarbital and the hippocampus, hypothalamus, and liver were quickly excised, frozen immediately in liquid nitrogen, and stored at −80 °C until use.

RNA isolation and real-time PCR

High-quality total RNA was isolated from 30 mg of hippocampus, hypothalamus, and liver samples using Trizol reagents (Invitrogen, Carlsbad, CA). One microgram of RNA was reverse-transcribed according to the manufacturer’s protocol (Vazyme Biotech, Nanjing, Jiangsu, China). Four-microliter cDNA was diluted (1:20) and then used for real-time PCR in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA). Peptidylprolyl isomerase A was used as an internal control to normalize the technical variations. Data were analyzed using the method of 2−ΔΔCT and presented relative to the LD group. All primers (Table 1) were synthesized by Suzhou GENEWIZ Biological Technology Co., Ltd (Suzhou, Jiangsu, China).

Table 1.

The primers sequences for RT-PCR and SELECT

Target genes Primer sequences (5ʹ−3ʹ)
Igf-1 F: TGGCCTGTGTTTGCTTACCT R: TCCCTTGTGGTGTAAGCGTC
Igf-2 F: ATACTGCTGCTACTGCTGGC R: ACAATGCCACGGTTGATCCT
Igf-1r F: GCCGTCCTTCCTGGAAATCA R: CTCGGCTTTGTGTCCTGAGT
Igfbp2 F: CCAATGTCAGCCAGAGAAC R: ACAGGCAGGACACAAGAG
Igf2bp1 F: AAGGCACAAGGCAGGATT R: GCAGCTCATTGACGGTTTT
Igf2bp2 F: TCAACAGGCCAACCTGATCC R: TTCTTCCCAATGATGGCCCC
Igf2bp3 F: GCTGCTGCTGCTTCATATCCAC R: CCTGCTTGCCAATAATAGCTCCA
Fto F: TCACCAAGGCGACCTCTACT R: GCTGAACCGAGGTGAAAAGC
Mettl3 F: ATCCTGGAGCTGCTCAACAC R: AGATTCGTCCGTGTGCTTGT
Mettl14 F: ATTCGACCAGGATGGCTGAC R: GACTTGGGTGGTGGTGACTT
Ythdf1 F: AACAACCAGCTCCGACACAT R: GATTCTGACGTTCCTTCCGC
Ythdf2 F: AAGGCCAAGGCAACAAAGTG R: ATATGCATTGTTCGGCCGGG
PPIA F: TTACGGGGAGAAGTTTGCCG R: TGGTGATCTGCTTGCTCGTC
SELECT
IGF-2 N site F: tagccagtaccgtagtgcgtgCAGCGCCCGGCAGCAAAAAG
R: TCAAGTGCCCAACTGTCCCTcagaggctgagtcgctgcat
IGF-2 X1 site F: tagccagtaccgtagtgcgtgGGGGGGCCGAGTCTCGCCAG
R: CTCTCCCCAGGAGATCACAAcagaggctgagtcgctgcat
IGF-2 X2 site F: tagccagtaccgtagtgcgtgAGGGGCTCAGGGGGGCCGAG
R: CTCGCCAGTCTCTCCCCAGGcagaggctgagtcgctgcat
IGF-2 X3 site F: tagccagtaccgtagtgcgtgCGACCGGCCCCCAGGAATGA
R: CTGTGACCAGCCGGCTCGATcagaggctgagtcgctgcat
Open in a new tab

Single-base elongation and ligation-based qPCR amplification method (SELECT) assay

The SELECT assay for monitoring site-specific m6A levels in the 3ʹUTR of IGF2 mRNA was performed as described previously (Xiao et al., 2018). The specific probes for N, X1, X2, and X3 sites on IGF2 mRNA (Table 1) were synthesized by Suzhou GENEWIZ Biological Technology Co., Ltd..

Statistical analysis

All data are presented as means ± SEM, and the differences among groups were analyzed using T-test for independent samples with SPSS 20.0 for windows. The differences were considered statistically significant when P < 0.05.

Results

The protein contents of IGF1 and IGF2 in serum, hippocampus, hypothalamus, and liver of chickens

The protein contents of IGF1 and IGF2 were significantly decreased (P < 0.05) in serum (Figure 1A and E), hippocampus (Figure 1B and F), and liver (Figure 1D and H) of LL chickens at both 7 and 21 d of age. In hypothalamus, significant decrease (P < 0.05) of IGF1 and IGF2 protein content was detected in LL chickens at 7 d of age (Figure 1C and G).

Figure 1.

Figure 1.

Open in a new tab

The protein contents of IGF1 and IGF2 in serum, hippocampus, hypothalamus, and liver of chickens. (A–D) IGF1 levels in serum, hippocampus, hypothalamus, and liver of 7- and 21-d-old chickens; (E–H) IGF2 levels in serum, hippocampus, hypothalamus, and liver of 7- and 21-d-old chickens. Values are mean ± SEM (n = 6), *P < 0.05, **P < 0.01, compared with LD.

The expression of IGF gene family in hippocampus, hypothalamus, and liver of chickens

The mRNA expression of IGF1, IGF1R, IGF2, and IGFBP2 was significantly decreased (P < 0.05) in hippocampus (Figure 2A), hypothalamus (Figure 2B), and liver (Figure 2C) of LL chickens at 7 d of age. At 21 d of age, chickens from LL group showed a significant down-regulation (P < 0.05) of hippocampal expression of IGF1 and IGF2 mRNA expression (Figure 2D), as well as significantly decreased (P < 0.05) hypothalamus expression of IGF2 and IGF1R mRNA expression (Figure 2E). In addition, the mRNA expression of IGF2 in liver was significantly decreased (P < 0.05) at 7 d of age, whereas IGF1R mRNA expression tended (P = 0.06) to decrease in the liver of LL group at 21 d of age (Figure 2F).

Figure 2.

Figure 2.

Open in a new tab

The expression of IGF gene family in hippocampus, hypothalamus, and liver of chickens. (A–C) IGF1, IGF1R, IGF2, and IGFBP2 mRNA expression in hippocampus, hypothalamus, and liver of 7-d-old chickens; (D–F) IGF1, IGF1R, IGF2, and IGFBP2 mRNA expression in hippocampus, hypothalamus, and liver of 21-d-old chickens. Values are mean ± SEM (n = 12), *P < 0.05, **P < 0.01, compared with LD.

IGF2BPs mRNA expression in hippocampus, hypothalamus, and liver of chickens

Hippocampal expression of IGF2BP2 mRNA was significantly decreased (P < 0.01) in LL chickens at 7 d of age (Figure 3A). Also, constant light exposure significantly (P < 0.05) increased IGF2BP1 and decreased IGF2BP2 mRNA expression in hypothalamus at 7 d of age (Figure 3B). In addition, constant light exposure significantly decreased (P < 0.01) IGF2BP3 mRNA expression in the liver of LL chickens at 7 d of age (Figure 3C). At 21 d of age, IGF2BP2 mRNA expression was significantly decreased (P < 0.05) in hippocampus (Figure 3D) and hypothalamus of LL chickens (Figure 3E). Meanwhile, hippocampal expression of IGF2BP3 mRNA expression tended to decrease in LL chickens (Figure 3D).

Figure 3.

Figure 3.

Open in a new tab

The expression of IGF2BPs mRNA in hippocampus, hypothalamus, and liver of chickens. (A–C) IGF2BP1, IGF2BP2, and IGF2BP3 mRNA expression in hippocampus, hypothalamus, and liver of 7-d-old chickens; (D–F) IGF2BP1, IGF2BP2, and IGF2BP3 mRNA expression in hippocampus, hypothalamus, and liver of 21-d-old chickens. Values are mean ± SEM (n = 12), *P < 0.05, **P < 0.01, compared with LD.

The expression of m6A related genes in chicken hippocampus, hypothalamus, and liver

At 7 d of age, FTO mRNA expression was significantly decreased (P < 0.05) in LL chicken hippocampus (Figure 4A). METTL3 and YTHDF2 mRNA expression was significantly decreased (P < 0.05) in both hippocampus and hypothalamus of LL chickens (Figure 4B). Also, FTO mRNA expression tended to decrease (P = 0.08) and YTHDF1 mRNA expression tended to increase (P = 0.06) in LL chicken hypothalamus at 7 d of age (Figure 4B). Meanwhile, METTL3, YTHDF1 and YTHDF2 mRNA expression was significantly increased (P < 0.05) in LL chicken liver at 7 d of age (Figure 4C). At 21 d of age, hippocampal expression of FTO, METTL14 and YTHDF2 mRNA was significantly increased (P < 0.05) in LL chickens (Figure 4D). Also, FTO and METTL3 mRNA expression was significantly increased (P < 0.05) in LL chicken hypothalamus at 21 d of age (Figure 4E). In addition, FTO mRNA expression was significantly decreased (P < 0.05) in LL chicken liver at 21 d of age (Figure 4F).

Figure 4.

Figure 4.

Open in a new tab

The expression of m6A-related genes in hippocampus, hypothalamus, and liver of chickens. (A–C) FTO, METTL3, METTL14, YTHDF1, and YTHDF2 mRNA expression in hippocampus, hypothalamus, and liver of 7-d-old chickens; (D–F) FTO, METTL3, METTL14, YTHDF1, and YTHDF2 mRNA expression in hippocampus, hypothalamus, and liver of 21-d-old chickens. Values are mean ± SEM (n = 12), *P < 0.05, **P < 0.01, compared with LD.

Site-specific m6A levels on 3’UTR of IGF2 mRNA in hippocampus, hypothalamus, and liver of 7-d-old chickens

To explore the possible link between the site-specific m6A modification on IGF2 mRNA and IGF2 mRNA expression in hippocampus, hypothalamus and liver, RNA samples were subjected to single-base elongation and ligation-based qPCR amplification method (SELECT) assay. Three specific m6A sites (Figure 5A) were identified in 3ʹUTR (X1, X2, and X3) of IGF2 mRNA, respectively, from published MeRIP-seq database (Hu et al., 2020). N site located in the 3ʹUTR without consensus m6A motif was selected as a negative control. In chicken hippocampus, constant light exposure did not affect the CT value of N (Figure 5B) or X2 (Figure 5D) sites, but significantly increased (P < 0.01) the CT value of X1 (Figure 5C) and X3 (Figure 5E) sites. Also, in hypothalamus, constant light exposure did not affect the CT value of N (Figure 5F) or X2 (Figure 5H) sites, but significantly increased (P < 0.01) the CT value of X1 (Figure 5G) and X3 (Figure 5I) sites. Meanwhile, constant light exposure did not affect the CT value of N (Figure 5J), X1 (Figure 5K), or X2 (Figure 5L) sites, but significantly increased (P < 0.01) the CT value of X3 (Figure 5M) site in the liver.

Figure 5.

Figure 5

Open in a new tab

The site-specific m6A levels of IGF2 mRNA 3’UTR in hippocampus, hypothalamus, and liver of 7-d-old chickens. Validation of m6A modification in IGF2 mRNA 3’UTR using single-base elongation and ligation-based qPCR amplification method (SELECT). (A) Schematic graph of N, X1, X2, and X3 site in IGF2 gene; (B–E) amplification curve and qPCR CT value of IGF2 N, X1, X2, and X3 site in hippocampus; (F–I) amplification curve and qPCR CT value of IGF2 N, X1, X2, and X3 site in hypothalamus; (J–M) Amplification curve and qPCR CT value of IGF2 N, X1, X2, and X3 site in liver. Values are mean ± SEM (n = 12), **P < 0.01, compared with LD.

The site-specific m6A levels of IGF2 mRNA 3’UTR in hippocampus, hypothalamus, and liver of 21-d-old chickens

In hippocampus, constant light exposure did not affect the CT value of N (Figure 6A) or X2 (Figure 6C) sites, but significantly increased (P < 0.01) the CT value of X3 (Figure 6D) site. The CT value of X1 (Figure 6B) site tended to increase in LL group. Meanwhile, in hypothalamus, constant light exposure did not affect the CT value of N (Figure 6E), X1 (Figure 6F), or X2 (Figure 6G) sites, but significantly increased (P < 0.01) the CT value of X3 (Figure 6H) site. In addition, constant light exposure did not affect the CT value of N (Figure 6I), X1 (Figure 6J), X2 (Figure 6K), or X3 (Figure 6L) sites in the liver.

Figure 6.

Figure 6.

Open in a new tab

The site-specific m6A levels of IGF2 mRNA 3’UTR in hippocampus, hypothalamus, and liver of 21-d-old chickens. (A–D) Amplification curve and qPCR CT value of IGF2 N, X1, X2, and X3 site in hippocampus; (E–H) amplification curve and qPCR CT value of IGF2 N, X1, X2, and X3 site in hypothalamus; (I–L) Amplification curve and qPCR CT value of IGF2 N, X1, X2, and X3 site in liver. Values are mean ± SEM (n = 12), **P < 0.01, compared with LD.

Discussion

Previously, we reported that constant light exposure during the first week of posthatch life did not affect the body weight of chickens. However, the feed conversion ratio was significantly increased in LL group at the third week, due to significantly increased feed intake. Moreover, serum CORT level was significantly higher, whereas serum melatonin and 5-HT levels were significantly lower, in LL group at both 7 and 21 d of age. Furthermore, behavior tests (including open field test, balance beam test, and tonic immobility test) revealed that constant light in early life significantly increased the fear-related behaviors in chickens (Yang et al., 2022). In this study, we observed that early posthatch constant light exposure reduced IGF gene expression in hippocampus, hypothalamus, and liver. The influence of constant light exposure on the expression of IGF gene family in hippocampus, hypothalamus, and liver appears to be age-dependent, less pronounced changes were detected at 21 d of age, compared with 7 d of age. Our results are consistent with a previous study in which IGF gene expression in posthatch growth have a time-dependent effect in chickens (McMurtry, 1998). Moreover, in 21-d-old chickens, IGF1 gene expression was decreased only in hippocampus of LL chickens, whereas no changes were determined in hypothalamus or liver. Our data are consistent with a previous study that IGF1 gene transcription is controlled by different hormonal, nutritional, and tissue-specific inputs in mammals (Rotwein, 2019).

IGF2BPs are important regulators of the IGF system, being involved in RNAs localization, translation, and stability (Degrauwe et al., 2016; Cao et al., 2018). Recently, IGF2BPs are identified as a new class of m6A readers that could guard m6A-modified mRNAs from decay (Huang et al., 2018; Hu et al., 2020). Similar to IGF2 mRNA expression, the alterations of IGF2BPs gene expression were also age dependent and tissue specific. Early posthatch constant light exposure decreased IGF2BP2 expression in the hippocampus and hypothalamus of chickens at 7 and 21 d of age, yet IGF2BP3 expression was enhanced in the liver of 7-d-old LL chickens. These results implicate that early posthatch constant light exposure may affect the mRNA m6A levels in hippocampus, hypothalamus, and liver of chickens.

Indeed, we found that early posthatch constant light exposure affected the expression of genes related to m6A modification in an age dependent and tissue specific. The m6A methylation plays important roles in the regulation of neurogenesis and stress responses through m6A-mediated post-transcriptional modification, including RNA splicing, nuclear export, and RNA degradation (Chokkalla et al., 2020). In this study, we found for the first time that early posthatch constant light exposure enhanced the expression of m6A methyltransferase METTL3 and binding protein YTHDF2 on hippocampus, hypothalamus, and liver in 7-d-old chickens, and increased the expression of YTHDF2 and METTL14 in hippocampus and METTL3 expression in hypothalamus of 21-d-old chickens. These results imply that early posthatch constant light exposure may enhance m6A levels in hippocampus, hypothalamus, and liver at 7 d of age, whereas this may happen only in hippocampus and hypothalamus at 21 d of age. These results agree with our previous study that constant light exposure increased m6A levels in mouse hippocampus (Yang et al., 2021). In addition, YTHDF2 has been reported that to play a negative role in mRNA stability (Wang et al., 2014). Thus, we speculated that m6A may be involved in the post-transcriptional regulation of IGF2 mRNA in hippocampus, hypothalamus, and liver. Indeed, the three predicted m6A sites X1, X2, and X3 were hypermethylated in a age-dependent and tissue-specific manner in hippocampus, hypothalamus, and liver. Therefore, it is likely that the decrease of IGF2 expression was due to m6A-mediated mRNA degradation (Ke et al., 2017). Nevertheless, a functional verification study is required to elucidate the role of m6A on these sites in IGF2 gene regulation in chicken hippocampus, hypothalamus, and liver.

Conclusion

In conclusion, our study shows that early posthatch constant light exposure reduced the mRNA expression of IGF1, IGF2, and IGF2BPs genes in hippocampus, hypothalamus, and liver of chickens at both 7 and 21 d of age. Meanwhile, constant light exposure increased the mRNA expression of m6A-related genes in hippocampus, hypothalamus, and liver of chickens. Moreover, higher m6A on 3ʹUTR of IGF2 mRNA coincided with lower IGF2 mRNA, indicating a possible role of m6A in the post-transcriptional regulation of IGF2 expression in the chicken. These findings provide evidence of early posthatch constant light exposure reduces the expression of IGF family in an age-dependent and tissue-specific manner, and imply a role of RNA m6A modification in the regulation of IGF2 in the chicken.

Acknowledgments

We thank the collaboration of the research team involved in this study and all the support of Nanjing Agricultural University and Jiangsu Collaborative Innovation Center of Meat Production and Processing, Quality, and Safety Control.

Glossary

Abbreviations

IGF

insulin-like growth factor

IGF2BPs

insulin-like growth factor 2 mRNA binding proteins

m6A

N6-methyladenosine

Contributor Information

Yang Yang, MOE Joint International Research Laboratory of Animal Health & Food Safety, Institute of Immunology, Nanjing Agricultural University, Nanjing 210095, P. R. China; Key Laboratory of Animal Physiology and Biochemistry, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, P. R. China.

Peirong Xu, MOE Joint International Research Laboratory of Animal Health & Food Safety, Institute of Immunology, Nanjing Agricultural University, Nanjing 210095, P. R. China; Key Laboratory of Animal Physiology and Biochemistry, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, P. R. China.

Jie Liu, MOE Joint International Research Laboratory of Animal Health & Food Safety, Institute of Immunology, Nanjing Agricultural University, Nanjing 210095, P. R. China; Key Laboratory of Animal Physiology and Biochemistry, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, P. R. China.

Mindie Zhao, MOE Joint International Research Laboratory of Animal Health & Food Safety, Institute of Immunology, Nanjing Agricultural University, Nanjing 210095, P. R. China; Key Laboratory of Animal Physiology and Biochemistry, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, P. R. China.

Wei Cong, MOE Joint International Research Laboratory of Animal Health & Food Safety, Institute of Immunology, Nanjing Agricultural University, Nanjing 210095, P. R. China; Key Laboratory of Animal Physiology and Biochemistry, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, P. R. China.

Wanwan Han, MOE Joint International Research Laboratory of Animal Health & Food Safety, Institute of Immunology, Nanjing Agricultural University, Nanjing 210095, P. R. China; Key Laboratory of Animal Physiology and Biochemistry, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, P. R. China.

Deyun Wang, MOE Joint International Research Laboratory of Animal Health & Food Safety, Institute of Immunology, Nanjing Agricultural University, Nanjing 210095, P. R. China; Institute of Traditional Chinese Veterinary Medicine, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, P. R. China.

Ruqian Zhao, MOE Joint International Research Laboratory of Animal Health & Food Safety, Institute of Immunology, Nanjing Agricultural University, Nanjing 210095, P. R. China; Key Laboratory of Animal Physiology and Biochemistry, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, P. R. China.

Funding

This work was supported by the National Natural Science Foundation of China (31972638), the National Key Research and Development Program of China (2016YFD0500502), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), and the Postgraduate Research and Practice Innovation Program of Jiangsu Province (KYCX18_0716). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Author contributions

Y.Y. and P.Z. contributed to behavior tests, data analysis, and drafting of the manuscript. Y.Y., J.L., and W.C. were responsible for animal care and sampling. M.Z. and W.H. provided technical support. R.Z. and Y.Y. contributed to conception, experimental design, and data interpretation. R.Z. and D.W. contributed to critical revision of the manuscript.

Ethics approval and consent to participate

The experimental protocol was approved by the Animal Ethics Committee of Nanjing Agricultural University. The project number is 31972638. The sampling procedures complied with the “Guidelines on Ethical Treatment of Experimental Animals” (2006) No. 398 set by the Ministry of Science and Technology, China.

Author agreement

The corresponding author and all the authors have read and approved the final submitted manuscript. We further confirm that the order of authors listed in the manuscript has been approved by all of us.

Conflict of interest statement

The authors declare no conflict of interest.

Literature Cited

  1. Bai, X., Wang Y., Wang Z., Cao J., Dong Y., and Chen Y.. . 2016. In ovo exposure to monochromatic lights affect posthatch muscle growth and satellite cell proliferation of chicks: role of IGF-1. Growth Factors. 34:107–118. doi: 10.1080/08977194.2016.1199553 [DOI] [PubMed] [Google Scholar]
  2. Cao, G., Li H. B., Yin Z., and Flavell R. A.. . 2016. Recent advances in dynamic m6A RNA modification. Open Biol. 6:160003. doi: 10.1098/rsob.160003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cao, J., Mu Q., and Huang H.. . 2018. The roles of insulin-like growth factor 2 mRNA-binding protein 2 in cancer and cancer stem cells. Stem Cells Inter. 2018:4217259. doi: 10.1155/2018/4217259 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chokkalla, A. K., Mehta S. L., and Vemuganti R.. . 2020. Epitranscriptomic regulation by m(6)A RNA methylation in brain development and diseases. J. Cereb. Blood Flow Metab. 40:2331–2349. doi: 10.1177/0271678X20960033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Deboer, T., Detari L., and Meijer J. H.. . 2007. Long term effects of sleep deprivation on the mammalian circadian pacemaker. Sleep 30:257–262. doi: 10.1093/sleep/30.3.257 [DOI] [PubMed] [Google Scholar]
  6. Degrauwe, N., Suva M. L., Janiszewska M., Riggi N., and Stamenkovic I.. . 2016. IMPs: an RNA-binding protein family that provides a link between stem cell maintenance in normal development and cancer. Genes Dev. 30:2459–2474. doi: 10.1101/gad.287540.116 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dumont, M., and Beaulieu C.. . 2007. Light exposure in the natural environment: relevance to mood and sleep disorders. Sleep Med. 8:557–565. doi: 10.1016/j.sleep.2006.11.008 [DOI] [PubMed] [Google Scholar]
  8. Fernandez, A. M., and Torres-Aleman I.. . 2012. The many faces of insulin-like peptide signalling in the brain. Nat. Rev. Neurosci. 13:225–239. doi: 10.1038/nrn3209 [DOI] [PubMed] [Google Scholar]
  9. Hafner, M., Landthaler M., Burger L., Khorshid M., Hausser J., Berninger P., Rothballer A., Ascano M. Jr, Jungkamp A. C., Munschauer M., . et al. 2010. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141:129–141. doi: 10.1016/j.cell.2010.03.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hu, X., Peng W. X., Zhou H., Jiang J., Zhou X., Huang D., . et al. 2020. IGF2BP2 regulates DANCR by serving as an N6-methyladenosine reader. Cell Death Differ. 27:1782–1794. doi: 10.1038/s41418-019-0461-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hu, Y., Feng Y., Zhang L., Jia Y., Cai D., Qian S. B., . et al. 2020. GR-mediated FTO transactivation induces lipid accumulation in hepatocytes via demethylation of m(6)A on lipogenic mRNAs. RNA Biol. 17:930–942. doi: 10.1080/15476286.2020.1736868 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Huang, H., Weng H., Sun W., Qin X., Shi H., Wu H., . et al. 2018. Recognition of RNA N(6)-methyladenosine by IGF2BP proteins enhances mRNA stability and translation. Nat. Cell Biol. 20:285–295. doi: 10.1038/s41556-018-0045-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kavran, J. M., McCabe J. M., Byrne P. O., Connacher M. K., Wang Z., Ramek A., . et al. 2014. How IGF-1 activates its receptor. eLife. 3:e03772. doi: 10.7554/eLife.03772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ke, S., Pandya-Jones A., Saito Y., Fak J. J., Vagbo C. B., Geula S., . et al. 2017. m(6)A mRNA modifications are deposited in nascent pre-mRNA and are not required for splicing but do specify cytoplasmic turnover. Genes Dev. 31:990–1006. doi: 10.1101/gad.301036.117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lan, Q., Liu P. Y., Bell J. L., Wang J. Y., Huttelmaier S., Zhang X. D., . et al. 2021. The emerging roles of RNA m(6)A methylation and demethylation as critical regulators of tumorigenesis, drug sensitivity, and resistance. Cancer Res. 81:3431–3440. doi: 10.1158/0008-5472.CAN-20-4107 [DOI] [PubMed] [Google Scholar]
  16. Lindholm, D., Carroll P., Tzimagiorgis G., and Thoenen H.. . 1996. Autocrine-paracrine regulation of hippocampal neuron survival by IGF-1 and the neurotrophins BDNF, NT-3 and NT-4. Eur. J. Neurosci. 8:1452–1460. doi: 10.1111/j.1460-9568.1996.tb01607.x [DOI] [PubMed] [Google Scholar]
  17. Llorens-Martin, M., Torres-Aleman I., and Trejo J. L.. . 2009. Mechanisms mediating brain plasticity: IGF1 and adult hippocampal neurogenesis. Neuroscientist. 15:134–148. doi: 10.1177/1073858408331371 [DOI] [PubMed] [Google Scholar]
  18. McMurtry, J. P. 1998. Nutritional and developmental roles of insulin-like growth factors in poultry. J. Nutr. 128:302S–305S. doi: 10.1093/jn/128.2.302S [DOI] [PubMed] [Google Scholar]
  19. Navara, K. J., and Nelson R. J.. . 2007. The dark side of light at night: physiological, epidemiological, and ecological consequences. J. Pineal Res. 43:215–224. doi: 10.1111/j.1600-079X.2007.00473.x [DOI] [PubMed] [Google Scholar]
  20. Olanrewaju, H. A., Purswell J. L., Collier S. D., and Branton S. L.. . 2013. Interactive effects of photoperiod and light intensity on blood physiological and biochemical reactions of broilers grown to heavy weights. Poult. Sci. 92:1029–1039. doi: 10.3382/ps.2012-02792 [DOI] [PubMed] [Google Scholar]
  21. Panebianco, F., Kelly L. M., Liu P., Zhong S., Dacic S., Wang X., . et al. 2017. THADA fusion is a mechanism of IGF2BP3 activation and IGF1R signaling in thyroid cancer. Proc. Natl. Acad. Sci. USA 114:2307–2312. doi: 10.1073/pnas.1614265114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Perez-Martin, M., Cifuentes M., Grondona J. M., Lopez-Avalos M. D., Gomez-Pinedo U., Garcia-Verdugo J. M., . et al. 2010. IGF-I stimulates neurogenesis in the hypothalamus of adult rats. Eur. J. Neurosci. 31:1533–1548. doi: 10.1111/j.1460-9568.2010.07220.x [DOI] [PubMed] [Google Scholar]
  23. Poreba, E., and Durzynska J.. . 2020. Nuclear localization and actions of the insulin-like growth factor 1 (IGF-1) system components: Transcriptional regulation and DNA damage response. Mutat. Res. Rev. Mutat. Res. 784:108307. [DOI] [PubMed] [Google Scholar]
  24. Rotwein, P. 2019. Quantifying promoter-specific Insulin-like Growth Factor 1 gene expression by interrogating public databases. Physiol. Rep. 7:e13970. doi: 10.14814/phy2.13970 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Schneider, H. J., Pagotto U., and Stalla G. K.. . 2003. Central effects of the somatotropic system. Eur. J. Endocrinol. 149:377–392. doi: 10.1530/eje.0.1490377 [DOI] [PubMed] [Google Scholar]
  26. Shimasaki, S., and Ling N.. . 1991. Identification and molecular characterization of insulin-like growth factor binding proteins (IGFBP-1, -2, -3, -4, -5 and -6). Progress Growth Factor Res. 3:243–266. doi: 10.1016/0955-2235(91)90003-m [DOI] [PubMed] [Google Scholar]
  27. Takahashi, A., Kasagi S., Murakami N., Furufuji S., Kikuchi S., Mizusawa K., . et al. 2016. Chronic effects of light irradiated from LED on the growth performance and endocrine properties of barfin flounder Verasper moseri. Gen. Comp. Endocrinol. 232:101–108. doi: 10.1016/j.ygcen.2016.01.008 [DOI] [PubMed] [Google Scholar]
  28. Wang, X., Lu Z., Gomez A., Hon G. C., Yue Y., Han D., . et al. 2014. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 505:117–120. doi: 10.1038/nature12730 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Xiao, Y., Wang Y., Tang Q., Wei L., Zhang X., and Jia G.. . 2018. An elongation- and ligation-based qPCR amplification method for the radiolabeling-free detection of locus-specific N(6)-methyladenosine modification. Angew. Chem. 57:15995–16000. doi: 10.1002/anie.201807942 [DOI] [PubMed] [Google Scholar]
  30. Yakar, S., Wu Y., Setser J., and Rosen C. J.. . 2002. The role of circulating IGF-I: lessons from human and animal models. Endocrine 19:239–248. doi: 10.1385/ENDO:19:3:239 [DOI] [PubMed] [Google Scholar]
  31. Yang, Y., Cong W., Liu J., Zhao M., Xu P., Han W., Wang D., and Zhao R.. . 2022. Constant light in early life induces fear-related behavior in chickens with suppressed melatonin secretion and disrupted hippocampal expression of clock- and BDNF-associated genes. J. Anim. Sci. Biotechnol. doi: 10.1186/s40104-022-00720-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Yang, Y., Feng Y., Hu Y., Liu J., Shi H., and Zhao R.. . 2021. Exposure to constant light impairs cognition with FTO inhibition and m(6)A-dependent TrkappaB repression in mouse hippocampus. Environ. Pollut. 283:117037. doi: 10.1016/j.envpol.2021.117037 [DOI] [PubMed] [Google Scholar]
  33. Yang, Y., Zong Y., Sun Q., Jia Y., and Zhao R.. . 2017. White light emitting diode suppresses proliferation and induces apoptosis in hippocampal neuron cells through mitochondrial cytochrome c oxydase-mediated IGF-1 and TNF-alpha pathways. Free Radical Biol. Med. 113:413–423. doi: 10.1016/j.freeradbiomed.2017.10.382 [DOI] [PubMed] [Google Scholar]
  34. Zheng, L., Ma Y. E., Gu L. Y., Yuan D., Shi M. L., Guo X. Y., . et al. 2013. Growth performance, antioxidant status, and nonspecific immunity in broilers under different lighting regimens. J. Appl. Poultry Res. 22:798–807. doi: 10.3382/japr.2012-00713 [DOI] [Google Scholar]

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES