Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Jul 7.
Published in final edited form as: J Mol Endocrinol. 2022 Jun 14;69(2):329–341. doi: 10.1530/JME-22-0011

The Chd4 subunit of the NuRD complex regulates Pdx1-controlled genes involved in β-cell function

Rebecca K Davidson 1,2,3, Staci A Weaver 1,2,3, Nolan Casey 1,2,3, Sukrati Kanojia 1,2,3, Elise Hogarth 3, Rebecca Schneider Aguirre 2,3,4, Emily K Sims 1,2,3,5, Carmella Evans-Molina 1,2,3,5,6, Jason M Spaeth 1,2,3,5,*
PMCID: PMC9260723  NIHMSID: NIHMS1817523  PMID: 35521759

Abstract

Type 2 diabetes (T2D) is associated with loss of transcription factors (TFs) from a subset of failing β-cells. Among these TFs is Pdx1, which controls the expression of numerous genes involved in maintaining β-cell function and identity. Pdx1 activity is modulated by transcriptional coregulators and has recently been shown, through an unbiased screen, to interact with the Chd4 ATPase subunit of the Nucleosome Remodeling and Deacetylase complex. Chd4 contributes to the maintenance of cellular identity and functional status of numerous different cell types. Here, we demonstrate Pdx1 dynamically interacts with Chd4 under physiological and stimulatory conditions within islet β-cells. We establish a fundamental role for Chd4 in regulating insulin secretion and modulating numerous Pdx1 bound genes in vitro, including the MafA TF, where we discovered Chd4 is bound at the MafA Region 3 enhancer. Furthermore, we found that Pdx1:Chd4 interactions are significantly compromised in islet β-cells under metabolically-induced stress in vivo and in human donor tissues with T2D. Our findings establish a fundamental role for Chd4 in regulating insulin secretion and modulating Pdx1-bound genes in vitro, and disruption of Pdx1:Chd4 interactions coincides with β-cell dysfunction associated with T2D.

Keywords: Coregulator, Chd4, Transcription Factor, Insulin Secretion, Beta Cell, Type 2 Diabetes

1. Introduction

Diabetes is a heterogeneous, complex metabolic disease characterized by progressive hyperglycemia and glucose intolerance. Both type 1 diabetes (T1D) and type 2 diabetes (T2D) are partly characterized by failing pancreatic β-cells, which are responsible for maintaining blood glucose homeostasis through the regulated secretion of the hormone insulin. Under physiological conditions, β-cells utilize glucose for ATP production, leading to an increase in the intracellular ATP/ADP ratio, closure of ATP-sensitive potassium (KATP) channels, and subsequent cascade of electrophysiological events that allow entry of Ca2+ into the cytoplasm, triggering insulin exocytosis. This process, known as glucose-stimulated insulin secretion (GSIS), requires tightly controlled expression of protein-coding genes, which is predominantly mediated by islet-enriched transcription factors (TFs) and their associated coregulators.

Among the essential TFs in the pancreas is pancreatic and duodenal homeobox 1 (Pdx1), which plays an integral role in maintaining β-cell function through the regulation of genes essential for GSIS such as MafA (Raum et al., 2006), Slc2a2 (Waeber et al., 1996), and insulin (Ohlsson et al., 1993), as well as genes important in mitochondrial function (e.g. Tfam (Gauthier et al., 2004)) and calcium signaling (e.g. Atp2a2 (Johnson et al., 2014)). In addition to playing a critical role in controlling β-cell function, Pdx1 also maintains cellular identity through active repression of α-cell-enriched genes Gcg and MafB (Gao et al., 2014). Notably, heterozygous PDX1 null mutations lead to a monogenic form of diabetes known as Maturity Onset Diabetes of the Young (MODY4) (Sachdeva et al., 2009), and PDX1 levels are reduced in human donor islets with T2D (Guo et al., 2013). These findings highlight the possibility that loss of PDX1 transcriptional activity plays a critical role in diabetes pathogenesis.

Like other TFs, Pdx1 requires a secondary level of regulation governed by the recruitment of transcriptional coregulators that facilitate fine-tuning of gene expression signatures. Numerous Pdx1-interacting proteins have been identified, including the Ruvbl1/2 DNA helicase, the chromodomain helicase DNA-binding 4 (Chd4) ATPase subunit of the Nucleosome Remodeling and Deacetylase (NuRD) complex, and the ATP-dependent Swi/Snf chromatin remodeling complex (McKenna et al., 2015). Interactions between Pdx1 and one of the essential Swi/Snf ATPase subunits, Brg1, have been shown to increase under acute high glucose stimulation, and are reduced in T2D donor tissue, implicating the necessity of these interactions for proper β-cell function (McKenna et al., 2015). Furthermore, a β-cell-specific conditional murine knockout of Brg1 and the alternate Swi/Snf ATPase subunit, Brm, exhibited impaired whole-body glucose tolerance, driven by a reduction of Pdx1 binding to the insulin gene promoter that contributed to a severe loss of insulin from the β-cell (Spaeth et al., 2019). While Swi/Snf has a major impact on Pdx1 transcriptional activity in the mature β-cell, it does not account for all activity, suggesting other coregulators are responsible for additional programs modulated by Pdx1 in the β-cell.

The Chd4 ATP-dependent helicase subunit of the NuRD complex is a logical candidate for interrogation, as its chromatin remodeling actions modulate the presentation of DNA to other coregulators and TFs, providing a fundamental level of gene expression control that is critical for cell cycle progression, mitochondrial function, and maintenance of cellular identity in a variety of tissues (Arends et al., 2019; Davidson et al., 2021; Gómez-del Arco et al., 2016; Polo et al., 2010; Sims and Wade, 2011; Xu et al., 2020; Zhao et al., 2017). For example, Chd4 has been reported to activate genes during T cell development, where Chd4 recruits the p300 histone acetyltransferase to the CD4 enhancer to allow for gene transcription (Williams and Naito, 2004). Moreover, in T helper 2 (Th2) cells, Chd4 recruits either p300 or NuRD-associated Hdac2 to activate genes related to Th2 cell fate or repress genes related to Th1 cell activity, respectively (Hosokawa et al., 2013). In vivo, conditional removal of Chd4 from skeletal muscle induces expression of cardiac muscle genes, and conditional removal of Chd4 in cardiac muscle induces upregulation of a skeletal muscle program that is lethal to the mutant mice (Gómez-del Arco et al., 2016).

Here, we aimed to identify how Chd4 regulates a subset of Pdx1-dependent gene targets in the β-cell and determine the consequences of reduced Chd4 action. Using proximity ligation assay (PLA), we identified the dynamic interactions between Pdx1:Chd4 robustly increase under physiological stimuli, and are severely disrupted under diabetogenic stress conditions in a high fat diet mouse model and T2D human donor tissues. RNAi-mediated knockdown of Chd4 led to impairment of GSIS in rodent β-cell lines, and dysregulation of various β-cell-enriched Pdx1 target genes. Furthermore, Chd4 was found to directly regulate the Pdx1-bound gene MafA, where we found Chd4 is recruited to the MafA Region 3 enhancer. Taken together, these data suggest that Chd4 directly regulates a subset of Pdx1-bound genes important for β-cell function, and that loss of PDX1:CHD4 interactions is associated with T2D pathophysiology.

2. Materials and Methods

2.1. Cell culture

Mouse βTC3 cells (Efrat et al., 1988) were cultured in DMEM with 10% FBS and 1% Penicillin-Streptomycin-Amphotericin B (PSA) at 70–80% confluency and passage numbers between 60–80 passages. Mouse MIN6 cells (Ishihara et al., 1993, p. 6; Miyazaki et al., 1990) were cultured in DMEM with 10% FBS, 1% PSA, and 71 μM 2-mercaptoethanol at 70–80% confluency and passage numbers between 60–80 passages. Rat INS-1 832/13 cells (Hohmeier et al., 2000) were cultured in RPMI1640 with 10% FBS, 1% PSA, 2 mM glutamine, 10 mM HEPES, 1 mM sodium pyruvate, and 57 μM 2-mercaptoethanol with passage numbers ranging from 60–75 passages. Human EndoC-βH1 cells (Ravassard et al., 2011) were cultured in low glucose (1 g/L) DMEM, 2% Albumin from bovine serum fraction V, 50 μM 2-mercaptoethanol, 10 mM nicotinamide, 5.5 μg/mL transferrin, 6.7 ng/mL sodium selenite, and 1% PSA with passage numbers ranging between 85–95. All cell lines were cultured at 37°C in 5% CO2.

2.2. Animals and tissue preparation

In vivo GSIS was performed by fasting 12-week-old C57BL/6J male mice (Jackson Laboratories) for 16 hours and administering an intraperitoneal injection of glucose (2 g/kg body weight). Subsets of mice were sacrificed after fasting and 30 minutes after glucose for downstream experiments. Generation of normal diet (ND) and high-fat diet (HFD) mice was performed by continuously feeding 8-week-old C57BL/6J male mice chow containing 18% kCal and 60% kCal fat (Fisher Scientific, F3282), respectively, for 4 weeks. Glucose tolerance tests were performed on ND and HFD mice by fasting for 6 hours and administering intraperitoneal injections of glucose (2 g/kg body weight). Blood glucose measurements were taken from the tail tip using an AimStrip Plus glucometer. Whole mouse pancreata were isolated and fixed for 4 hours in 4% (v/v) Paraformaldehyde/PBS, washed, and embedded in O.C.T. embedding medium (Fisher Scientific, 23-730-571). Cryosections were generated at 6 μm thickness on Leica Cryostat. Human pancreatic tissue sections were obtained from the Network for Pancreatic Organ Donors with Diabetes (nPOD) (Table 3).

Table 3:

nPOD donor information

nPOD Case #: RRID Diabetes Status Age (years) Sex Race BMI (kg/m2) T2D Duration
6487 SAMN15879540 No Diabetes 27.1 Male African Am 27.8 N/A
6254 SAMN15879310 No Diabetes 38.0 Male Caucasian 30.5 N/A
6104 SAMN15879161 No Diabetes 41.0 Male Caucasian 20.5 N/A
6290 SAMN15879344 No Diabetes 58.0 Male Caucasian 22.5 N/A
6186 SAMN15879242 T2D 68.4 Male Caucasian 20.9 5 Years
6194 SAMN15879250 T2D 47.4 Male Caucasian 23.7 13 Years
6028 SAMN15879085 T2D 33.2 Male African Am 30.2 17 Years
6259 SAMN15879314 T2D 57.0 Male Caucasian 32.3 10 Years
Open in a new tab

2.3. Co-immunoprecipitation and western blotting

For co-immunoprecipitation experiments, 100 μg of βTC3 nuclear extract was incubated with either rabbit α-Chd4 (Abcam, ab72418; 2 μg) antibody or species-matched IgG overnight at 4°C. The following day, Protein A/G PLUS-agarose (Santa Cruz, sc-2003) was added for 2 hours at 4°C. Complexes were washed 5 times with PBS and boiled with SDS loading dye. Immunoprecipitates were fractionated by SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes, blocked with Blocking Buffer (LI-COR, 927-70001) and probed with the following primary antibodies: goat α-Pdx1 (Abcam, AB47383; 1:20000) and rabbit α-Chd4 (Abcam, ab72418, 1:500). Immunoblots were incubated with LI-COR IRDye secondary antibodies, and fluorometric scanning was performed with an Odyssey CLx Imager. Band intensity was quantitated using ImageJ software.

2.4. Proximity ligation assay and immunofluorescence

MIN6 or EndoC-βH1 cells were fixed 24 hours after seeding at a density of 1×105 per well with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 prior to blocking and adding primary antibodies. For mouse cryosections, pancreatic tissue sections were washed and subjected to 1% SDS-mediated antigen retrieval prior to blocking and adding primary antibodies. Paraffin-embedded human pancreatic sections from nPOD donors were rehydrated and subjected to antigen retrieval (Vector Laboratories, H-3300-250) prior to blocking and addition of primary antibodies. Proximity ligation assays were performed following the manufacturer protocol (Sigma-Aldrich, DUO92105) with goat α-Pdx1 (Abcam, AB47383; 1:10000) and rabbit α-Chd4 (Bethyl, A700-066; 1:1000) antibodies. For tissue sections, guinea pig α-insulin (Dako, A0564;1:100) was added and detected using Cy2 donkey α-guinea pig IgG (H+L) (Jackson Laboratories, AB_2340467; 1:2000). Immunofluorescence Z-Stack images were acquired on a Zeiss LSM 800 confocal laser scanning scope and processed using ImageJ software. For counting of PLA signals in mouse and human tissue sections, PLA signals were manually counted from individual Z-stack images and plotted, relative to total β-cell nuclei within the islet.

2.5. Chromatin immunoprecipitation

MIN6 cells (~3×107) were fixed in 1% formaldehyde in MIN6 medium for 10 minutes, with the reaction stopped by the addition of glycine (0.125 M) for 5 minutes. Nuclei were isolated in 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% NP-40 buffer and resuspended in 1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8.0), and protease inhibitors. Sonication was performed using a Bioruptor (Diagenode) to shear chromatin into 200–600bp fragments. Sheared chromatin containing 25 μg of DNA was incubated with mouse α-Chd4 (Abcam, ab70469; 5 μg) or mouse IgG and precipitated with Magna ChIP Protein G Magnetic Beads (Millipore). Beads were washed consecutively with low salt, high salt, RIPA, LiCl, and TE buffers (buffer compositions available from Abcam X-ChIP protocol) and subsequently eluted with elution buffer (100 mM NaHCO3, 1% SDS). DNA was purified using phenol:chloroform extraction and utilized for qPCR analysis with primers listed in Table 1.

Table 1:

Primer list for RT-qPCR and ChIP-qPCR analyses

Gene Forward Primer Reverse Primer
RT-qPCR primers
18s AGTCCCTGCCCTTTGTACACA GATCCGAGGGCCTCACTAAAC
Chd4 GAAATTGCTGCGGCACCATTA AGCCATCATTGTAGTTGACCTG
Ins2 CCACCCAGGCTTTTGTCAAA CCCAGCTCCAGTTGTTCCAC
preIns2 GGGGAGCGTGGCTTCTTCTA GGGGACAGAATTCAGTGGCA
Ins1 CACTTCCTACCCCTGCTGG ACCACAAAGATGCTGTTTGACA
G6pc2 CCCTGATGGTGGTGGCTCTA GTCTGTGGGTGGAGCAGGAC
Slc2a2 CAGTTCGGCTATGACATCGGT GTTAATGGCAGCTTTCCGGTC
Pcsk2 AGAGAGACCCCAGGATAAAGATG CTTGCCCAGTGTTGAACAGGT
Gck TGAGCCGGATGCAGAAGGA GCAACATCTTTACACTGGCCT
Slc30a8 AGCTTCCTGTGTTTCCTAGGCCAT AATCTATTCCGACGGCTGCCTCAT
Pdx1 CGGCTGAGCAAGCTAAGGTT TGGAAGAAGCGCTCTCTTTGA
Pax6 TGGCAAACAACCTGCCTATG TGCACGAGTATGAGGAGGTCT
Nkx6.1 CCTCTGGCCCGAACTCTGA GCTGCCACCGCTCGATT
Isl1 GCAACCCAACGACAAAACTAA CCATCATGTCTCTCCGGACT
MafA CCTGTAGAGGAAGCCGAGGAA CCTCCCCCAGTCGAGTATAGC
Chd3 GCAGAAGGAAAACAAGCCAGGC GGTGCTTCCTTCTTCGTTTCCG
Chd5 AGCCCGTGAGTCTTCCCAA TGTCTGACATCTCGTCATTGC
Neurog3 CAGGGTTTCTGAGCTTCTCC GGGAAGGGTAACGACTTGAA
Ldha TGTCTCCAGCAAAGACTACTGT GACTGTACTTGACAATGTTGGGA
Hk1 GTGGACGGGACGCTCTAC TTCACTGTTTGGTGCATGATT
Gcg CATTCACCAGCGACTACAGCAA TCATCAACCACTGCACAAAATCT
MafB AACGCGTCCAGCAGAAACA AGCTGCTCCACCTGCTGAAT
Arx1 CAGCATTTGGCAGGCTCT AGGATGTTGAGCTGCGTGAG
Sst AACGCAAAGCTGGCTGCAAGAA TCAGAGGTCTGGCTAGGACAACAA
Hhex CGGACGGTGAACGACTACAC CGTTGGAGAACCTCACTTGAC
Ghrelin AGCCCAGCAGAGAAAGGAATC GGGAGCATTGAACCTGATCTC
Ppy TTGCAGCCTCTCTTGTCTTCA TAGTTTGCAAGGGAGCAGGTT
Atp5h GCTGGGCGTAAACTTGCTCTA CAGACAGACTAGCCAACCTGG
Mipep GAAGCTGGCTGTTGTTCATG CTGATAGCTGCCATCTTCCT
Pgc1a GAAAGGGCCAAACAGAGAGA GTAAATCACACGGCGCTCTT
Sirt5 CACCCAGAACATTGACGAGT CTGCTAAAGCTGGGCAGAT
Tfam GGAATGTGGAGCGTGCTAAAA ACAAGACTGATAGACGAGGGG
Ucp2 GAAGCTTGACCTTGGAGGC TACCTCCCAGAAGATGGAGA
ChIP-qPCR primers
Gapdh ACTGAGCAAGAGAGGCCCTA TATGGGGGTCTGGGATGGAA
Ins2 CCCCTGGACTTTGCTGTTT GCTGTGAACTGGTTCATCAGGC
MafA promoter ATGACCTCCTCCTTGCTGAA ATCATCACTCTGCCCACCAT
MafA Region 3 CACCCCAGCGAGGGCTGATTTAAT AGCAAGCACTTCAGTGTGCTCAGTG
Open in a new tab

2.6. Lentivirus production and infection

HEK293T cells were transfected with packaging plasmids pVSV-G (Addgene, #138479) and psPAX2 (Addgene, #12260), and lentiviral packaging plasmids containing either blasticidin-resistant Cas9 (Addgene, #52962) or puromycin-resistant single guide (g)RNA constructs (Addgene, #52963 used as backbone for cloning gRNAs) or tandem gRNAs (from VectorBuilder) (Table 2) in Opti-MEM using Lipofectamine 2000 (Invitrogen, 11668027). Viral media was collected 96 and 120 hours after transfection. For generation of clonal MIN6-Cas9 cell lines, MIN6 cells were infected with Cas9-containing virus and selected with Blasticidin. Surviving cells were seeded at single cell density, expanded, and screened for Cas9 production by western blot. To generate stable Chd4 knockout cell lines, lentivirus containing Chd4 gRNA was used to infect MIN6-Cas9 cells which were subsequently selected with Puromycin. One week later, surviving cells were seeded at single cell density, expanded, and screened for Chd4 by western blot analyses. In total, 48 single cell colonies were screened with all retaining Chd4 protein. A similar approach for CRISPR/Cas9 gene-editing in INS-1 832/13 cells was performed by the Genome Engineering and iPSC Center at Washington University.

Table 2:

List of transfer vectors used to create lentivirus

lentiGuide-Puro sgRNA
gRNAControl_Chd4_Intron AATCCAGCTGCGGGCCCAATGGG
gRNA1_Chd4_Exon15 GCCGGAGTATCTGGATGCGACGG
gRNA2_Chd4_Exon3 GAGCAAGCGCCAAAAAAAGGAGG
gRNA #1416_Chd4_Exon 9 ACACATTTAGTGGTACGGCC
gRNA #2807_Chd4_Exon 23 GACAGAGCCATTCGCCGTTT
Open in a new tab

2.7. RNAi-mediated Chd4 knockdown in β-cell lines

Small interfering (si)RNA knockdown in βTC3 and INS-1 832/13 was achieved using ON-TARGETplus siRNAs of mouse Chd4 (Dharmacon, #L-052142-00). Targeting siRNA or a nontargeting control (Dharmacon, #D-001810-10) were diluted in Opti-MEM and incubated with Lipofectamine RNAiMAX (Invitrogen, LMRNA015) at 1:3 ratio for 5 minutes. Cells suspended in Opti-MEM were combined with siRNA/Lipo mixture at a density of 2 × 106 cells per 500 μL, incubated for 3–4 minutes and seeded in 6-well dish. RNA and nuclear extract were collected 48 hours (INS-1 832/13) or 72 hours (βTC3) after transfection. Nuclear extracts were fractionated as described and PVDF membranes were probed with rabbit α-Chd4 (Abcam, ab72418; 1:500), rabbit α-MafA (Cell Signaling, D2Z6N; 1:1000), and mouse α-β-actin (Santa Cruz, sc-47778; 1:1000). LI-COR secondary antibodies were utilized, and fluorometric scanning was performed with an Odyssey CLx Imager. Experiments were performed at least three times and quantitated using ImageJ software.

2.8. Quantitative PCR

RNA was purified from siRNA-treated βTC3 cells per manufacturer’s instructions (Zymo Research, D7001). cDNA was prepared from RNA per manufacturer instructions (Applied Biosystems, 4368814). The quantitative (q)PCR reactions were performed with the gene primers listed in Table 1 on a QuantStudio™ 3 Real-Time PCR System (Applied Biosystems, A28567). Relative gene expression changes were analyzed with the 2−ΔΔCT method (Livak and Schmittgen, 2001) using 18s for normalization.

2.9. Glucose-stimulated insulin secretion

siControl and siChd4-treated INS-1 832/13 cells were seeded at 2×106 cells per well in a 6-well plate. Forty-eight hours later, cells were treated with baseline glucose solution at 1 mM glucose for one hour. Solution was aspirated and cells were treated with either 2.8 mM glucose (low) or 16.7 mM glucose (high) for one hour. Secretion media was collected, and cells were treated with acid/ethanol solution and content samples were collected. Human insulin ELISA was utilized for measurements of INS-1 832/13 secretion media, as these cells contain a human insulin expression cassette, and was performed by the Translation Core at Indiana University School of Medicine. All secretion samples were normalized to insulin content.

2.10. Mitochondrial respiration

Seahorse Extracellular Flux Analyzer XFe96 (Agilent Technologies) and Mito Stress Test (Agilent Technologies, 103015) were utilized to measure mitochondrial respiration in INS-1 832/13 cells treated with siRNA as described. Cells were plated at 5 × 103 cells per well in 80 μl growth media and cultured at 37°C and 5% CO2 for 48 hrs. Cells were then incubated in pre-warmed RPMI assay media, pH 7.4 (Agilent Technologies, 103576-100) supplemented with 11 mM of glucose, 2 mM of L-glutamine, and 1 mM pyruvate in a non-CO2 37°C incubator one hour. Mito Stress Test assay compounds Oligomycin (2.0 μM), FCCP [Carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone] (4.0 μM), and Rotenone/Antimycin (1.0 μM) were diluted in assay media and sequentially added to the cells at ~15 minutes, ~34 minutes, and ~54 minutes, respectively. Oxygen consumption readings were taken every 6.5 minutes for ~160 minutes for 3 readings prior to and after each injection of compound. Oxygen consumption was normalized by cell count per well using phase-contrast and cell masking on an Incucyte S3 live-cell analysis system. One image per well was taken using a 10X objective and autofocus capability. Cells in each image were counted and total cell count per well was extrapolated using the image counts and multiplying by the ratio of well dimension (10.326 mm2) to the image size (2.275 mm2) (*~4.5).

2.11. Statistical analysis

Statistical significance was determined using the two-tailed Student’s t-test. Data are presented as the mean ± SEM. A threshold of P < 0.05 was used to indicate significant differences between groups. Each experiment was conducted a minimum of three times.

2.12. Study approval

All animal studies were reviewed and approved by the Indiana University Institutional Animal Care and Use Committee. Mice were housed and cared for according to the Indiana University Laboratory Animal Resource Center and the Institutional Animal Care and Use Committee/Office of Animal Welfare Assurance standards and guidelines.

3. Results

3.1. Pdx1 and Chd4 interact in mouse and human β-cells

To confirm the previously reported Pdx1:Chd4 interactions identified by the Re-CLIP/MS approach (McKenna et al., 2015), we performed co-immunoprecipitation (Co-IP) of non-crosslinked nuclear extracts from mouse βTC3 and MIN6 cells with Chd4 antibody and immunoblotting for Chd4 and Pdx1. The presence of Pdx1 protein was enriched in the Chd4 pull-down lane compared to the IgG control lane, confirming these proteins interact (Figure 1A). To further support the presence of the Pdx1:Chd4 interactions in β-cell nuclei, proximity ligation assays (PLA) were performed using α-Chd4 and α-Pdx1-specific antibodies in MIN6 cells (Figure 1B), 12-week-old C57BL/6J mouse pancreatic tissue (Figure 1C), the human EndoC-βH1 β-cell line (Figure 1D), and pancreatic tissue from a non-diabetic human donor (Figure 1E; nPOD donor: 6254). The PLA produces a fluorescent puncta if the target proteins are within 30–40 nm of each other, indicative of protein-protein interactions (Bagchi et al., 2015). In both mouse and human β-cell nuclei we observed PLA signals, confirming the presence of Pdx1:Chd4 interactions in primary β-cells. Moreover, we observed no Pdx1:Chd4 PLA signals within the nuclei of non-Insulin+ cells present throughout the islet in both mouse and non-diabetic human pancreata (arrowheads in Figure 1C and 1E).

Figure 1: Pdx1 and Chd4 interact in mouse and human β-cell lines and primary tissues.

Figure 1:

Open in a new tab

(A) Co-immunoprecipitation of Chd4, followed by western blotting for Pdx1 in βTC3 and MIN6 nuclear extracts. Proximity ligation assays (PLA) were performed on (B) MIN6 cells, (C) 12-week mouse C57BL/6J pancreatic tissues, (D) human EndoC-βH1 β-cells, and (E) 38-year-old human donor tissue. The images on the right in B-E are magnified regions outlined in the yellow box. The white fluorescent foci from the PLA represent Pdx1:Chd4 interactions, while the orange arrowheads in C and E indicate insulin-negative cells with no Pdx1:Chd4 PLA signaling (scale bar = 10 μm).

3.2. Glucose stimulation enhances Pdx1:Chd4 interactions in mouse β-cells in vivo

A fundamental feature of β-cell function is the ability to respond to glucose stimulation with insulin secretion. Along these lines, a previous study demonstrated that acute in vivo glucose stimulation in mice leads to increased interactions between Pdx1 and the Swi/Snf subunit, Brg1 (McKenna et al., 2015). To determine whether Pdx1:Chd4 interactions are regulated by glucose stimuli in vivo, we compared the number of PLA signals produced with Pdx1 and Chd4 antibodies from pancreatic tissue sections collected from 12-week-old mice after fasting or following intraperitoneal injection of glucose (2g/kg body weight). Remarkably, in comparison to fasted mice, glucose administration robustly increased the number of PLA signals/β-cell nuclei, with more β-cell nuclei containing multiple PLA signals and fewer nuclei completely lacking signals in the glucose-stimulated tissue (Figure 2A and 2B). These data demonstrate a positive correlation between acute high glucose stimulation and an increase in Pdx1:Chd4 interactions in vivo.

Figure 2: Glucose stimulation enhances Pdx1:Chd4 interactions in mouse β-cells.

Figure 2:

Open in a new tab

(A) Representative PLA images of 16-hour fasted and glucose-stimulated tissue from 12-week old C57BL/6J mice. (B) Quantitation of PLA signals in each group stratified by number of signals per nucleus. (n = 3). ns = not significant; *p < 0.05. (scale bar = 10 μm).

3.3. Glucose-stimulated insulin secretion is impaired in Chd4-depleted rat β-cells

To generate tools for differential gene expression analyses and functional studies, CRISPR/Cas9 gene-editing was used to delete Chd4 from MIN6 and INS-1 823/13 cells. We first derived a clonal cell line that constitutively produced the Cas9 protein (Supplemental Figure 1A). These blasticidin-resistant MIN6-Cas9 cells were infected with lentivirus containing gRNAs targeting various coding regions or a non-coding region (used as control) of Chd4 (Table 2). Following puromycin selection, the heterogeneous population of infected cells were subjected to western blot to roughly evaluate the loss of Chd4. Remarkably, reduced levels of Chd4 were observed in the heterogenous gRNA pool targeting Chd4 exon 15, in comparison to the control gRNA targeting Chd4 intron (Supplemental Figure 1B). Based on this observation, we seeded individual cells and expanded these single-cell derived colonies to generate clonal Chd4 knockout MIN6 cells; however, of the 48 clonal lines screened from gRNAs targeting Chd4 coding regions, all retained the Chd4 protein (Supplemental Figure 1D).

The Genome Engineering and iPSC Center at Washington University utilized similar methods to generate a Chd4 knockout INS-1 832/13 cell line. Next-generation sequencing of a heterogeneous pool of cells after introduction of the Chd4 viral media demonstrated that 99% of cells incurred an insertion or deletion, indicating the presence of Chd4 knockout clones in the population (Supplemental Figure 1E). Single cells from this population, as well as wild type INS-1 832/13 cells, were seeded in 96-well plates. Nearly 25% of the wild-type cells expanded whereas only 4–5% of the Chd4 CRISPR/Cas9 cells expanded (Supplemental Figure 1F). Of the 4–5% that initially expanded, all eventually failed to thrive. These data support the conclusion that Chd4 is required for the survival and expansion of murine and rat β-cell lines.

As total loss of Chd4 from either MIN6 or INS-1 832/13 cells could not be achieved, siRNA-mediated knockdown of Chd4 was utilized for downstream experiments. Since Pdx1:Chd4 complex formation is partially dependent on fluctuations in glucose concentration, we assessed how reduction of Chd4 levels would impact the ability of the β-cell to respond to glucose. To this end, GSIS was performed on the glucose-responsive INS-1 832/13 rat β-cell line after transfection with either scramble siRNA (siControl) or Chd4 siRNA (siChd4), which achieved 71.8 ± 8.2% knockdown (Figure 3A). In response to high glucose challenge, secreted insulin levels in the siChd4 knockdown cells were significantly lower than siControl cells (Figure 3B). Insulin content remained unchanged in siChd4 cells suggesting Chd4 is not critical for insulin production (Figure 3C).

Figure 3: Reduction in Chd4 negatively influences glucose-stimulated insulin secretion.

Figure 3:

Open in a new tab

(A) Western blot of control and siRNA knockdown of Chd4 in INS-1 832/13 cells depicting 71.8 ± 8.2% knockdown efficiency. (B) Glucose-stimulated insulin secretion in siChd4 cells is blunted in comparison to siControl cells. (C) Insulin content is unchanged between siRNA groups. (n = 4). ns = not significant; *p < 0.05.

3.4. Chd4 regulates genes controlled by Pdx1 in murine β-cell lines

Loss of Pdx1 from developing or mature β-cells leads to impaired β-cell function (Ahlgren et al., 1998; Gannon et al., 2008) and loss of cellular identity, which is largely driven by loss of expression of β-cell-specific genes and de-repression of α-cell-specific genes (Gao et al., 2014). To determine the impact of Chd4 on modulating the expression of Pdx1-bound genes, siRNA knockdown of Chd4 was performed in the mouse βTC3 cell line followed by RT-qPCR screening. Reduced expression of Chd4 led to decreased expression of the essential β-cell functional gene, MafA, which was also reduced at the protein level (Figure 4A–D). Consistent with total insulin protein, no changes in Ins1 or Ins2 were observed supporting the notion that Chd4 is not a critical modulator of insulin production. Furthermore, Chd4 knockdown did not result in upregulation of α-cell-specific genes or other genes associated with loss of cellular identity (Supplemental Figure 2). Interestingly, we observed an increase in expression of Chd3 and Chd5, alternate Chd isoforms, following RNAi-mediated depletion of Chd4, suggesting loss of Chd4 impacts their expression in β-cells (Supplemental Figure 2C).

Figure 4: Reduction of Chd4 negatively impacts expression of sensitive Pdx1 target genes.

Figure 4:

Open in a new tab

(A) Western blot of nuclear extracts from siControl and siChd4 knockdown βTC3 cells. (B) Quantitation of western blot from (A) using densitometry analysis in ImageJ software. (C) RT-qPCR of β-cell functional genes and (D) β-cell-enriched TFs. (n = 6–12). (E) Chd4 ChIP-qPCR of MafA promoter region (pr), MafA Region 3 (r3), and Ins2 demonstrates Chd4 occupies MafA Region 3. (n = 3). ns = not significant; *p < 0.05; **p < 0.01; ***p < 0.001.

Pdx1 has been shown to specifically bind and regulate the MafA gene at a highly-conserved regulatory sequence, termed Region 3 (Raum et al., 2006). To determine whether Chd4 directly regulates MafA, we performed chromatin immunoprecipitation (ChIP) for Chd4 in MIN6 cells. We found that, similar to Pdx1 (Raum et al., 2006), Chd4 occupies MafA Region 3, but not the promoter region of MafA (Figure 4E). As expected, Chd4 does not occupy the Ins2 gene, a potent target of Pdx1.

3.5. Reduced expression of Chd4 does not impact mitochondrial function

While the observed reduction in MafA could be a primary driver of impaired GSIS following Chd4 knockdown in INS-1 832/13 cells, defects in other cellular processes such as mitochondrial function could also be contributing. Pdx1 has been reported to control mitochondrial morphology and function, partly through direct regulation of the essential nuclear-encoded mitochondrial TF Tfam (Brissova et al., 2002; Soleimanpour et al., 2015; Mohan et al., 2021; Gauthier et al., 2004; Gauthier et al., 2009). Furthermore, Chd4 was recently shown to directly regulate genes involved in mitochondrial function in striated muscle cells (Gómez-del Arco et al., 2016). To evaluate the role of Chd4 on mitochondrial function in the β-cell, siRNA knockdown of Chd4 was performed in βTC3 cells followed by RT-qPCR screening of various genes involved in mitochondrial function. Interestingly, a significant reduction in both Tfam and Mipep was observed following Chd4 knockdown (Supplemental Figure 3A). However, upon reducing Chd4 levels in INS-1 832/13 cells, no significant impairments in Oxygen Consumption Rate (OCR) or any parameters derived from the OCR trace were observed during a Seahorse Mito Stress Test (Supplemental Figure 3B–H), indicating Chd4 does not profoundly impact mitochondrial function in the β-cell.

3.6. Pdx1:Chd4 interactions are reduced in pathophysiological settings of T2D

Interactions between PDX1 and the coregulator BRG1 have been shown to be reduced in T2D β-cells (McKenna et al., 2015), indicating an important role for the PDX1:BRG1 complex in maintaining β-cell function. To determine whether Pdx1:Chd4 interactions are also altered in a model of diabetes pathogenesis, 8-week-old male mice were fed a normal diet (ND) or high fat diet (HFD) for 4 weeks. This model of diet-induced obesity leads to metabolic dysfunction, impaired glucose tolerance, and β-cell dysfunction similar to those associated with human T2D (Winzell and Ahrén, 2004). As expected, HFD mice were glucose intolerant and had reduced levels of MafA after 4 weeks of HFD-induced metabolic stress (Supplemental Figure 4A and B). PLA for Pdx1 and Chd4 was performed on pancreatic tissue sections and revealed that HFD mice had significantly more β-cell nuclei devoid of PLA signals compared to ND mice, and fewer cells that contained 2 or more signals (Figure 5A–B), independent of any observable alterations in levels of Pdx1 or Chd4 protein (Supplemental Figure 4B). Next, we performed PLA on non-diabetic and T2D human donor tissue sections procured from the Network for Pancreatic Organ Donors (nPOD) (Donor information in Table 3, n = 4). Once again, a greater number of nuclei were devoid of PLA signals and fewer nuclei contained 2 or more signals in T2D donor tissue compared to non-diabetic donor tissue (Figure 5C–D). Interestingly, we confirmed loss of MAFA in these nPOD T2D donor tissues, with no apparent change in CHD4 or PDX1 protein levels (Supplemental Figure 4C–D). These data support the profound importance of PDX1:CHD4 interactions in maintaining optimal β-cell functional status, and that disruption of their interactions is associated with β-cell dysfunction present in T2D pathophysiology.

Figure 5: Pdx1:Chd4 interactions are reduced in pathophysiological settings of T2D.

Figure 5:

Open in a new tab

(A) Representative PLA images of 4-week ND and 4-week HFD wild-type C57BL/6J mice. (B) White fluorescent PLA foci in ND and HFD sections were manually quantitated from β-cell nuclei and plotted. The percent of nuclei with 0 PLA signals/β-cell nuclei were significantly higher in 4W HFD fed mice in comparison to ND. (n = 3). (C) Representative PLA images acquired from pancreatic tissues sections from healthy human donor (nPOD case #: 6290: 58 year old male, BMI = 22.5) and T2D donor (nPOD case#: 6186: 68 year old male, BMI = 20.9, 5 years T2D). (D) Quantitation of human PLA signals in each group stratified by number of signals per nucleus. The images below in A and C are magnified regions outlined in the yellow box above. (n = 4). ns = not significant; *p < 0.05; **p < 0.01. (scale bar = 10 μm).

4. Discussion

The present study highlights the importance of how one of the several Pdx1-recruited coregulators modulates Pdx1 transcriptional activity, β-cell gene expression, and β-cell function. Given the ubiquitous expression of Chd4 throughout nearly all mammalian tissues (Human Protein Atlas, proteinatlas.org), our findings support that Chd4 activity controls a subset of β-cell functional genes, in part through its recruitment by Pdx1.

Our discovery that Pdx1:Chd4 interactions increase under acute glucose stimuli in vivo (Figure 2) highly suggests their importance in modulating genes critical for GSIS. In this regard, we demonstrate that Chd4 has a prominent role in regulating the MafA gene, which is critical for insulin secretion (Figures 3–4). While these findings are of significant interest to the field of islet biology, our current study is limited by the use of immortalized cell lines where Chd4 was only transiently reduced. Future efforts should focus on determining if Chd4 plays a critical role in maintaining β-cell function and whole-body glucose homeostasis in vivo. In addition, as we found that highly proliferative β-cell lines require Chd4 to thrive (Supplemental Figure 1), it would be of significant interest to investigate the role of Chd4 in modulating Pdx1 transcriptional activity during pancreas formation, a highly proliferative developmental window that is dependent on Pdx1 activity (Jonsson et al., 1994; Offield et al., 1996; Stoffers et al., 1997).

Conditional deletion of Pdx1 from mature β-cells (RIP-CreERT) leads to decreased expression of β-cell TFs Nkx6.1, Ins1, Slc2a2, and MafA and increased expression of α-cell genes Gcg and MafB, supporting the role of Pdx1 in maintaining cell identity by controlling transcriptional status of β-cell genes and repression of non-β-cell genes (Gao et al., 2014). Given the role of Chd4 in maintaining fate and identity of other cell types (embryonic stem cells, T cells, muscle cells), we suspected Chd4 would play an important role in maintaining identity in the β-cell. However, that appears not to be the case, as MafB, Gcg, Neurog3, Sst, and Ppy, are all unchanged in siChd4 rodent β-cells (Supplemental Figure 2). Since Chd4 does not appear to modulate transcription programs involved in maintaining β-cell identity, other coregulators are likely responsible for modulating this portion of Pdx1 activity in the β-cell.

We found that RNAi-mediated reduction of Chd4 leads to upregulation of Chd3 and Chd5 (Supplemental Figure 2). Our findings are consistent with a recent publication that demonstrated satellite cell-specific deletion of Chd4 leads to upregulation of both alternate Chd isoforms and that Chd4 directly binds to the Chd3 and Chd5 genes (Sreenivasan et al., 2021). This supports the idea that these actions of Chd4 are likely independent of Pdx1, as Pdx1 is not expressed in satellite cells and, additionally, has not been shown to bind to these loci in the β-cell (Khoo et al., 2012; Perelis et al., 2015). Whether Chd3 or Chd5 expression is increased as a compensatory mechanism for the reduction of Chd4, or whether Chd4 directly represses these gene targets in the β-cell is currently unknown.

Pdx1 recruits numerous transcriptional coregulators in the β-cell with various coregulatory functions. Interestingly, we found that Chd4 is recruited to MafA Region 3, a principal control sequence occupied and regulated by numerous TFs (i.e. Pdx1, Nkx2.2, Foxa2, Pax6, Nkx6.1, NeuroD1 (Raum et al., 2010, 2006). In contrast to Swi/Snf, whose activity is essential for insulin production and for Pdx1 to maintain occupancy on the Ins2 genomic locus (Spaeth et al., 2019), Chd4 does not localized the Ins2 locus (Figure 4E). This finding highlights the ability of Pdx1 to recruit different coregulators to distinct loci to control its transcriptional activity. The mechanism(s) driving the selective recruitment of coregulators to Pdx1 on specific genomic loci is not known. Post-translational modifications (PTMs) of Pdx1 could influence its interactions with specific coregulators under physiological settings, as Pdx1 has been shown to become phosphorylated in the developing endoderm (Frogne et al., 2012); however, whether Pdx1 PTMs in the β-cell facilitate the recruitment of specific coregulators to distinct genomic loci to facilitate gene expression remains to be established.

T2D pathogenesis is complex and often results from combinations of peripheral insulin resistance and islet β-cell dysfunction. After an initial augmentation of increased β-cell mass and function during metabolic demand, persistent and chronic insults imposed on the β-cell are linked to deleterious effects on the landscape of the islet β-cell genome (Parker et al., 2013; Pasquali et al., 2014; Stitzel et al., 2010) and expression of β-cell functional gene programs critical to maintain glucose homeostasis. In this regard, expression of key islet-enriched TFs like MAFA, MAFB, PDX1, and NKX6.1 are found to be reduced in models of T2D and human T2D donor β-cells (Guo et al., 2013). It is imperative to identify how mechanisms that control the genomic landscape and gene expression programs of the β-cell falter in settings of T2D. In this regard, it was previously established that interactions between PDX1 and the BRG1 subunit of the SWI/SNF complex are reduced in T2D β-cells (McKenna et al., 2015). Here we demonstrate loss of interactions between PDX1 and CHD4 in T2D human donor β-cells (Figure 5), despite unchanged levels of PDX1 and CHD4 protein (Supplemental Figure 4). As with the majority of studies using T2D donor tissues, the design of our study allows us to interrogate a snapshot of time of the disease after diagnosis. It will be of future interest to investigate whether PDX1:CHD4 interactions are compromised early in human disease progression (i.e. pre-diabetic, impaired glucose tolerant human donors), prior to frank diabetes. Findings from our HFD studies, however, provide potential insight into this, where we found interactions between Pdx1 with Chd4 are reduced in β-cells from animals on HFD for 4 weeks, mimicking early insults to the β-cell leading to impaired glucose tolerance, prior to frank diabetes (Figure 5). The observation that Pdx1:Chd4 interactions increase in response to acute glucose challenge in vivo (Figure 2) could be indicative of an attempt by the β-cell to compensate for acute stress, but under the chronic insults imposed by 4 weeks of HFD feeding, Pdx1:Chd4 interactions break down and coincide with reduced MafA levels and impaired glucose tolerance.

Overall, our results demonstrate a prominent role of Chd4 in controlling insulin secretion and modulating a subset of Pdx1 transcriptional activity in the β-cell. We have discovered that Pdx1 interactions with Chd4 are tightly regulated by acute glucose stimulation in vivo and are negatively impacted in pathophysiological settings of T2D. These findings are the first to demonstrate that Chd4 plays an essential role in maintaining β-cell function and provide evidence that loss of Pdx1:Chd4 interactions is a significant feature of diabetes pathophysiology.

Supplementary Material

01

Supplemental Figure 1: CRISPR/Cas9-mediated Chd4 knockout β-cell lines fail to thrive. (A) Presence of Cas9 protein detected in virally-infected clonal MIN6 cells. (B) Reduction in Chd4 protein after infection of MIN6-Cas9 cells with gRNA viral media. (C) Cell colonies expanded from single cells isolated from cellular pool from (B). (D) Next generation single-cell sequencing of INS-1 832/13 pool of cells infected with Chd4-directed gRNA. (E) Outgrowth of wild-type and Chd4 gRNA-infected cells.

02

Supplemental Figure 2: Reduction of Chd4 leads to increased expression of Chd3 and Chd5 and does not alter gene associated with cell identity of maturation. RT-qPCR of non-β-cell gene targets (A), disallowed gene targets (B), and alternate Chd subunits (C) following Chd4 knockdown in βTC3 cells. (n = 3–4). ns = not significant; *p < 0.05.

03

Supplemental Figure 3: Chd4 reduction has no impact on mitochondrial function. (A) RT-qPCR of mitochondrial functional genes following knockdown of Chd4 in βTC3 cells. (B) Trace of OCR/5,000 cells over time with injections of Oligomycin (ATP synthase inhibitor), FCCP (uncoupler), and Antimycin A and Rotenone (Complex III and I inhibitors), (C) ATP production calculated as basal respiration minus proton leak, (D) Basal respiration calculated as final measurement before first injection minus non-mitochondrial respiration rate, (E) Maximal respiration calculated as maximal respiration rate after FCCP injection minus non-mitochondrial respiration rate, (F) Proton leak calculated as minimum respiration rate after Oligomycin injection minus non-mitochondrial respiration rate, (G) Coupling efficiency calculated as ATP production rate divided by basal respiration rate as percentage, and (H) Spare respiratory capacity calculated as maximal respiration minus basal respiration. (n = 3). ns = not significant; *p < 0.05.

04

Supplemental Figure 4: Loss of MafA and glucose intolerance is observed in mice 4 weeks on HFD and levels of CHD4 are unchanged in T2D donors. (A) Glucose tolerance test in 4-week ND and 4-week HFD mice. Area Under Curve (AUC) analyses of GTT is placed in top right corner (n = 7–8). (B) Immunostaining of MafA, Pdx1, and Chd4 in ND and HFD islets. Immunostaining of (C) PDX1 and CHD4 and (D) MAFA in non-diabetic and T2D donor sections. (scale bar = 10 μm). *p < 0.05; ***p < 0.001.

Acknowledgements

The authors thank Lori Sussel and Dylan Sarbaugh for critically reading the manuscript. The authors acknowledge the support of the Islet and Physiology and Translation Cores of the Indiana Diabetes Research Center (P30-DK097512) and the Genome Engineering and iPSC Center at Washington University.

Funding

This work was supported by grants from the National Institutes of Health National Institute of Diabetes and Digestive and Kidney Diseases (K01-DK115633 to J.M.S., F31-DK128918 to R.K.D., R01-DK121929 to E.K.S., R01-DK093954, R01-DK127236, and R01-DK127308-01 to C.E.-M.), a TL1 fellowship from the National Institute of Health, National Center for Advancing Translational Sciences, Clinical and Translational Sciences Award (UL1TR002529 to S.A.W.), the U.S. Department of Veterans Affairs Merit Award (I01-BX001733 to C.E.-M.), and an award from the Ralph W. and Grace M. Showalter Research Trust and the Indiana University School of Medicine (J.M.S). The content is solely the responsibility of the authors and does not necessarily represent the official views of the Showalter Research Trust or the Indiana University School of Medicine.

Footnotes

Conflict of Interest

No potential conflicts of interest relevant to this article are reported.

References

  1. Ahlgren U, Simu K, Edlund H 1998. β-Cell-specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the β-cell phenotype and maturity onset diabetes. Genes & Development 12 1763–1768. ( 10.1101/gad.12.12.1763) [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Arends T, Dege C, Bortnick A, Danhorn T, Knapp JR, Jia H, Harmacek L, Fleenor CJ, Straign D, Walton K, et al. 2019. CHD4 is essential for transcriptional repression and lineage progression in B lymphopoiesis. Proceedings of the National Academy of Sciences 116 10927. ( 10.1073/pnas.1821301116) [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bagchi S, Fredriksson R, Wallén-Mackenzie Å, 2015. In Situ Proximity Ligation Assay (PLA). In Hnasko R (Ed.), ELISA, Methods in Molecular Biology, pp. 149–159. New York: Springer. ( 10.1007/978-1-4939-2742-5_15) [DOI] [PubMed] [Google Scholar]
  4. Brissova M, Shiota M, Nicholson WE, Gannon M, Knobel SM, Piston DW, Wright CVE, Powers AC 2002. Reduction in Pancreatic Transcription Factor PDX-1 Impairs Glucose-stimulated Insulin Secretion. Journal of Biological Chemistry 277 11225–11232. ( 10.1074/jbc.M111272200) [DOI] [PubMed] [Google Scholar]
  5. Davidson RK, Kanojia S, Spaeth JM 2021. The Contribution of Transcriptional Coregulators in the Maintenance of β-cell Function and Identity. Endocrinology 162 ( 10.1210/endocr/bqaa213) [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Efrat S, Linde S, Kofod H, Spector D, Delannoy M, Grant S, Hanahan D, Baekkeskov S 1988. Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene. Proceedings of the National Academy of Sciences 85 9037–9041. ( 10.1073/pnas.85.23.9037) [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Frogne T, Sylvestersen KB, Kubicek S, Nielsen ML, Hecksher-Sørensen J 2012. Pdx1 Is Post-Translationally Modified In vivo and Serine 61 Is the Principal Site of Phosphorylation. PLoS One 7 e35233. ( 10.1371/journal.pone.0035233) [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Gannon M, Tweedie Ables E, Crawford L, Lowe D, Offield MF, Magnuson MA, Wright CVE 2008. pdx-1 function is specifically required in embryonic β cells to generate appropriate numbers of endocrine cell types and maintain glucose homeostasis. Developmental Biology 314 406–417. ( 10.1016/j.ydbio.2007.10.038) [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Gao T, McKenna B, Li C, Reichert M, Nguyen J, Singh T, Yang C, Pannikar A, Doliba N, Zhang T, et al. 2014. Pdx1 Maintains β Cell Identity and Function by Repressing an α Cell Program. Cell Metabolism 19 259–271. ( 10.1016/j.cmet.2013.12.002) [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gauthier BR, Brun T, Sarret EJ, Ishihara H, Schaad O, Descombes P, Wollheim CB 2004. Oligonucleotide Microarray Analysis Reveals PDX1 as an Essential Regulator of Mitochondrial Metabolism in Rat Islets. Journal of Biological Chemistry 279 31121–31130. ( 10.1074/jbc.M405030200) [DOI] [PubMed] [Google Scholar]
  11. Gauthier BR, Wiederkehr A, Baquié M, Dai C, Powers AC, Kerr-Conte J, Pattou F, MacDonald RJ, Ferrer J, Wollheim CB 2009. PDX1 deficiency causes mitochondrial dysfunction and defective insulin secretion through TFAM suppression. Cell Metabolism 10 110–118. (doi: 10.1016/j.cmet.2009.07.002) [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gómez-del Arco P, Perdiguero E, Yunes-Leites PS, Acín-Pérez R, Zeini M, Garcia-Gomez A, Sreenivasan K, Jiménez-Alcázar M, Segalés J, López-Maderuelo D, et al. 2016. The Chromatin Remodeling Complex Chd4/NuRD Controls Striated Muscle Identity and Metabolic Homeostasis. Cell Metabolism 23 881–892. ( 10.1016/j.cmet.2016.04.008) [DOI] [PubMed] [Google Scholar]
  13. Guo S, Dai C, Guo M, Taylor B, Harmon JS, Sander M, Robertson RP, Powers AC, Stein R 2013. Inactivation of specific β cell transcription factors in type 2 diabetes. The Journal of Clinical Investigation 123 3305–3316. ( 10.1172/JCI65390) [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hohmeier HE, Mulder H, Chen G, Henkel-Rieger R, Prentki M, Newgard CB 2000. Isolation of INS-1-derived cell lines with robust ATP-sensitive K+ channel-dependent and -independent glucose-stimulated insulin secretion. Diabetes 49 424–430. ( 10.2337/diabetes.49.3.424) [DOI] [PubMed] [Google Scholar]
  15. Hosokawa H, Tanaka T, Suzuki Y, Iwamura C, Ohkubo S, Endoh K, Kato M, Endo Y, Onodera A, Tumes DJ et al. 2013. Functionally distinct Gata3/Chd4 complexes coordinately establish T helper 2 (Th2) cell identity. Proceedings of the National Academy of Sciences 110 4691–4696. ( 10.1073/pnas.1220865110) [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ishihara H, Asano T, Tsukuda K, Katagiri H, Inukai K, Anai M, Kikuchi M, Yazaki Y, Miyazaki J-I, Oka Y 1993. Pancreatic beta cell line MIN6 exhibits characteristics of glucose metabolism and glucose-stimulated insulin secretion similar to those of normal islets. Diabetologia 36 1139–1145. ( 10.1007/BF00401058) [DOI] [PubMed] [Google Scholar]
  17. Johnson JS, Kono T, Tong X, Yamamoto WR, Zarain-Herzberg A, Merrins MJ, Satin LS, Gilon P, Evans-Molina C 2014. Pancreatic and Duodenal Homeobox Protein 1 (Pdx-1) Maintains Endoplasmic Reticulum Calcium Levels through Transcriptional Regulation of Sarco-endoplasmic Reticulum Calcium ATPase 2b (SERCA2b) in the Islet β Cell. Journal of Biological Chemistry 289, 32798–32810. ( 10.1074/jbc.M114.575191) [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jonsson J, Carlsson L, Edlund T, Edlund H 1994. Insulin-promoter-factor 1 is required for pancreas development in mice. Nature 371 606–609. ( 10.1038/371606a0) [DOI] [PubMed] [Google Scholar]
  19. Khoo C, Yang J, Weinrott SA, Kaestner KH, Naji A, Schug J, Stoffers DA 2012. Research resource: the pdx1 cistrome of pancreatic islets. Molecular Endocrinology 26 521–533. ( 10.1210/me.2011-1231) [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Livak KJ, Schmittgen TD 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 25 402–408. ( 10.1006/meth.2001.1262) [DOI] [PubMed] [Google Scholar]
  21. McKenna B, Guo M, Reynolds A, Hara M, Stein R 2015. Dynamic Recruitment of Functionally Distinct Swi/Snf Chromatin Remodeling Complexes Modulates Pdx1 Activity in Islet β Cells. Cell Reports 10 2032–2042. ( 10.1016/j.celrep.2015.02.054) [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Miyazaki J-I, Araki K, Yamato E, Ikegami H, Asano T, Shibasaki Y, Oka Y, Yamamura K-I 1990. Establishment of a Pancreatic β Cell Line That Retains Glucose-Inducible Insulin Secretion: Special Reference to Expression of Glucose Transporter Isoforms*. Endocrinology 127 126–132. ( 10.1210/endo-127-1-126) [DOI] [PubMed] [Google Scholar]
  23. Mohan R, Jo S, Lockridge A, Ferrington DA, Murray K, Eschenlauer A, Bernal-Mizrachi E, Fujitani Y, Alehandro EU 2021. OGT Regulates Mitochondrial Biogenesis and Function via Diabetes Susceptibility Gene Pdx1. Diabetes 70 2608–2625. ( 10.2337/db21-0468) [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Offield MF, Jetton TL, Labosky PA, Ray M, Stein RW, Magnuson MA, Hogan BLM, Wright CVE 1996. PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122 983–995. ( 10.1242/dev.122.3.983) [DOI] [PubMed] [Google Scholar]
  25. Ohlsson H, Karlsson K, Edlund T 1993. IPF1, a homeodomain-containing transactivator of the insulin gene. The EMBO Journal 12 4251–4259. ( 10.1002/j.1460-2075.1993.tb06109.x) [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Parker SCJ, Stitzel ML, Taylor DL, Orozco JM, Erdos MR, Akiyama JA, van Bueren KL, Chines PS, Narisu N, NISC Comparative Sequencing Program, et al. 2013. Chromatin stretch enhancer states drive cell-specific gene regulation and harbor human disease risk variants. Proceedings of the National Academy of Sciences 110 17921–17926. ( 10.1073/pnas.1317023110) [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Pasquali L, Gaulton KJ, Rodríguez-Seguí SA, Miguel-Escalada I, Gómez-Marín C, van de Bunt M, Ponsa-Cobas J, Castro N, Nammo T, Cebola I, et al. 2014. Pancreatic islet enhancer clusters enriched in type 2 diabetes risk–associated variants. Nature Genetics 46 136–143. ( 10.1038/ng.2870) [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Perelis M, Marcheva B, Moynihan Ramsey K, Schipma MJ, Hutchison AL, Taguchi A, Peek CB, Hong H, Huang W, Omura C, et al. 2015. Pancreatic cell enhancers regulate rhythmic transcription of genes controlling insulin secretion. Science 350 aac4250–aac4250. ( 10.1126/science.aac4250) [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Polo SE, Kaidi A, Baskcomb L, Galanty Y, Jackson SP 2010. Regulation of DNA-damage responses and cell-cycle progression by the chromatin remodelling factor CHD4. The EMBO Journal 29 3130–3139. ( 10.1038/emboj.2010.188) [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Raum JC, Gerrish K, Artner I, Henderson E, Guo M, Sussel L, Schisler JC, Newgard CB, Stein R 2006. FoxA2, Nkx2.2, and PDX-1 Regulate Islet β-Cell-Specific mafA Expression through Conserved Sequences Located between Base Pairs −8118 and −7750 Upstream from the Transcription Start Site. Molecular and Cellular Biology 26 5735–5743. ( 10.1128/MCB.00249-06) [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Raum JC, Hunter CS, Artner I, Henderson E, Guo M, Elghazi L, Sosa-Pineda B, Ogihara T, Mirmira RG, Sussel L et al. 2010. Islet β-Cell-Specific MafA Transcription Requires the 5′-Flanking Conserved Region 3 Control Domain. Molecular and Cellular Biology 30 4234–4244. ( 10.1128/MCB.01396-09) [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ravassard P, Hazhouz Y, Pechberty S, Bricout-Neveu E, Armanet M, Czernichow P, Scharfmann R 2011. A genetically engineered human pancreatic β cell line exhibiting glucose-inducible insulin secretion. The Journal of Clinical Investigation 121 3589–3597. ( 10.1172/JCI58447) [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Sachdeva MM, Claiborn KC, Khoo C, Yang J, Groff DN, Mirmira RG, Stoffers DA 2009. Pdx1 (MODY4) regulates pancreatic beta cell susceptibility to ER stress. Proceedings of the National Academy of Sciences 106 19090–19095. ( 10.1073/pnas.0904849106) [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Sims JK, Wade PA 2011. Mi-2/NuRD complex function is required for normal S phase progression and assembly of pericentric heterochromatin. Molecular Biology of the Cell 22 3094–3102. ( 10.1091/mbc.e11-03-0258) [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Soleimanpour S, Ferrari AM, Raum JC, Groff DN, Yang J, Kaufman BA, Stoffers DA 2015. Diabetes Susceptibility Genes Pdx1 and Clec16a Function in a Pathway Regulating Mitophagy in β-Cells. Diabetes 64 3475–3484. ( 10.2337/db15-0376) [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Spaeth JM, Liu J-H, Peters D, Guo M, Osipovich AB, Mohammadi F, Roy N, Bhushan A, Magnuson MA, Hebrok M, et al. 2019. The Pdx1 Bound Swi/Snf Chromatin Remodeling Complex Regulates Pancreatic Progenitor Cell Proliferation and Mature Islet β Cell Function. Diabetes 1806–1818. ( 10.2337/db19-0349) [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sreenivasan K, Rodríguez-delaRosa A, Kim J, Mesquita D, Segalés J, Arco PG, Espejo I, Ianni A, Di Croce L, Relaix F, et al. 2021. CHD4 ensures stem cell lineage fidelity during skeletal muscle regeneration. Stem Cell Reports 16 2089–2098. ( 10.1016/j.stemcr.2021.07.022) [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Stitzel ML, Sethupathy P, Pearson DS, Chines PS, Song L, Erdos MR, Welch R, Parker SCJ, Boyle AP, Scott LJ, et al. 2010. Global Epigenomic Analysis of Primary Human Pancreatic Islets Provides Insights into Type 2 Diabetes Susceptibility Loci. Cell Metabolism 12 443–455. ( 10.1016/j.cmet.2010.09.012) [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Stoffers DA, Zinkin NT, Stanojevic V, Clarke WL, Habener JF 1997. Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence. Nature Genetics 15 106–110. ( 10.1038/ng0197-106) [DOI] [PubMed] [Google Scholar]
  40. Waeber G, Thompson N, Nicod P, Bonny C 1996. Transcriptional activation of the GLUT2 gene by the IPF-1/STF-1/IDX-1 homeobox factor. Molecular Endocrinology 10 1327–1334. ( 10.1210/mend.10.11.8923459) [DOI] [PubMed] [Google Scholar]
  41. Williams CJ, Naito T 2004. The Chromatin Remodeler Mi-β Is Required for CD4 Expression and T Cell Development. Immunity 20 719–733. ( 10.1016/j.immuni.2004.05.005) [DOI] [PubMed] [Google Scholar]
  42. Winzell MS, Ahrén B 2004. The High-Fat Diet–Fed Mouse: A Model for Studying Mechanisms and Treatment of Impaired Glucose Tolerance and Type 2 Diabetes. Diabetes 53 S215–S219. ( 10.2337/diabetes.53.suppl_3.S215) [DOI] [PubMed] [Google Scholar]
  43. Xu N, Liu F, Wu S, Ye M, Ge H, Zhang M, Song Y, Tong L, Zhou J, Bai C 2020. CHD4 mediates proliferation and migration of non-small cell lung cancer via the RhoA/ROCK pathway by regulating PHF5A. BMC Cancer 20 262. ( 10.1186/s12885-020-06762-z) [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zhao H, Han Z, Liu X, Gu J, Tang F, Wei G, Jin Y 2017. The chromatin remodeler Chd4 maintains embryonic stem cell identity by controlling pluripotency- and differentiation-associated genes. Journal of Biological Chemistry 292 8507–8519. ( 10.1074/jbc.M116.770248) [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01

Supplemental Figure 1: CRISPR/Cas9-mediated Chd4 knockout β-cell lines fail to thrive. (A) Presence of Cas9 protein detected in virally-infected clonal MIN6 cells. (B) Reduction in Chd4 protein after infection of MIN6-Cas9 cells with gRNA viral media. (C) Cell colonies expanded from single cells isolated from cellular pool from (B). (D) Next generation single-cell sequencing of INS-1 832/13 pool of cells infected with Chd4-directed gRNA. (E) Outgrowth of wild-type and Chd4 gRNA-infected cells.

NIHMS1817523-supplement-01.pdf (171.4KB, pdf)
02

Supplemental Figure 2: Reduction of Chd4 leads to increased expression of Chd3 and Chd5 and does not alter gene associated with cell identity of maturation. RT-qPCR of non-β-cell gene targets (A), disallowed gene targets (B), and alternate Chd subunits (C) following Chd4 knockdown in βTC3 cells. (n = 3–4). ns = not significant; *p < 0.05.

NIHMS1817523-supplement-02.pdf (205.5KB, pdf)
03

Supplemental Figure 3: Chd4 reduction has no impact on mitochondrial function. (A) RT-qPCR of mitochondrial functional genes following knockdown of Chd4 in βTC3 cells. (B) Trace of OCR/5,000 cells over time with injections of Oligomycin (ATP synthase inhibitor), FCCP (uncoupler), and Antimycin A and Rotenone (Complex III and I inhibitors), (C) ATP production calculated as basal respiration minus proton leak, (D) Basal respiration calculated as final measurement before first injection minus non-mitochondrial respiration rate, (E) Maximal respiration calculated as maximal respiration rate after FCCP injection minus non-mitochondrial respiration rate, (F) Proton leak calculated as minimum respiration rate after Oligomycin injection minus non-mitochondrial respiration rate, (G) Coupling efficiency calculated as ATP production rate divided by basal respiration rate as percentage, and (H) Spare respiratory capacity calculated as maximal respiration minus basal respiration. (n = 3). ns = not significant; *p < 0.05.

NIHMS1817523-supplement-03.pdf (235.1KB, pdf)
04

Supplemental Figure 4: Loss of MafA and glucose intolerance is observed in mice 4 weeks on HFD and levels of CHD4 are unchanged in T2D donors. (A) Glucose tolerance test in 4-week ND and 4-week HFD mice. Area Under Curve (AUC) analyses of GTT is placed in top right corner (n = 7–8). (B) Immunostaining of MafA, Pdx1, and Chd4 in ND and HFD islets. Immunostaining of (C) PDX1 and CHD4 and (D) MAFA in non-diabetic and T2D donor sections. (scale bar = 10 μm). *p < 0.05; ***p < 0.001.

NIHMS1817523-supplement-04.pdf (313.3KB, pdf)

RESOURCES