Version Changes
Revised. Amendments from Version 1
In the revised manuscript, we added new results showing that CFB1C's F-box does not cause growth defects in KKT3-YFP cells, that expression of deGradFP that lacks an NLS does not cause growth defects in KKT3-YFP cells, and that NLS-deGradFP did not work on YFP-KKT18. We also made changes to respond to referee comments.
Abstract
Targeted protein degradation is an invaluable tool in studying the function of proteins. Such a tool was not available in Trypanosoma brucei, an evolutionarily divergent eukaryote that causes human African trypanosomiasis. Here, we have adapted deGradFP (degrade green fluorescent protein [GFP]), a protein degradation system based on the SCF E3 ubiquitin ligase complex and anti-GFP nanobody, in T. brucei. As a proof of principle, we targeted a kinetoplastid kinetochore protein (KKT3) that constitutively localizes at kinetochores in the nucleus. Induction of deGradFP in a cell line that had both alleles of KKT3 tagged with yellow fluorescent protein (YFP) caused a more severe growth defect than RNAi in procyclic (insect form) cells. deGradFP also worked on a cytoplasmic protein (COPII subunit, SEC31). Given the ease in making GFP fusion cell lines in T. brucei, deGradFP can serve as a powerful tool to rapidly deplete proteins of interest, especially those with low turnover rates.
Keywords: Trypanosoma brucei, targeted protein degradation, deGradFP, degron, kinetoplastid, kinetochore
Introduction
Kinetoplastids are a group of unicellular flagellated eukaryotes found in diverse environmental conditions ( d’Avila-Levy et al., 2015). They belong to the phylum Euglenozoa (Discoba/Excavata) and are evolutionarily distant from commonly studied model eukaryotes such as yeasts, worms, flies, and humans (Opisthokonta) ( Cavalier-Smith, 2010; Keeling & Burki, 2019). Understanding their biology could therefore provide insights into the extent of conservation/divergence among eukaryotes and lead to a deeper understanding of biological systems and evolution of eukaryotes. Importantly, three neglected tropical diseases are caused by parasitic kinetoplastids: African trypanosomiasis, Chagas disease, and leishmaniasis ( Horn, 2022; Rao et al., 2019). Human African trypanosomiasis (sleeping sickness) is caused by Trypanosoma brucei, which also causes the cattle disease, nagana, that leads to weight loss and anemia in livestock and imposes a huge burden on economic development in affected regions. Understanding the biology of kinetoplastids could facilitate the design of new drugs against kinetoplastid parasites.
Inducible depletion of a target protein is an essential tool in biology ( Prozzillo et al., 2020). In Trypanosoma brucei, this can be achieved by RNAi ( Alsford et al., 2011; Ngô et al., 1998) and Tet-off system ( Merritt & Stuart, 2013) at the RNA level, as well as by conditional knockout at the gene level using Cre-LoxP ( Kim et al., 2013). Although powerful in many cases, these approaches are not efficient in reducing the level of proteins that have slow turnover rates. Targeted degradation tools could circumvent this problem and have been used in other organisms ( Damerow et al., 2015; Madeira da Silva et al., 2009; Nabet et al., 2018; Nishimura et al., 2009; Uhlmann et al., 2000; Wheeler et al., 2015). However, such tools were not available in Trypanosoma brucei, to our knowledge.
In this study, we have adapted the deGradFP (degrade green fluorescent protein) system which was originally established in Drosophila melanogaster ( Caussinus et al., 2011). It relies on the expression of VhhGFP4 fused with a truncated F-box protein. VhhGFP4 is an anti-GFP nanobody that recognizes GFP and some derivatives such as yellow fluorescent proteins (YFP) and Venus ( Saerens et al., 2005), while an F-box protein is a substrate-recognition subunit of the SKP1–CUL1–F-box (SCF) E3 ubiquitin ligase complex that catalyzes the ubiquitylation of target proteins ( Petroski & Deshaies, 2005). In deGradFP, a substrate-recognition domain of an F-box protein is replaced by VhhGFP4 so that GFP-fusion proteins are ubiquitylated by the SCF complex, leading to their degradation via the 26S proteasome pathway ( Caussinus & Affolter, 2016). deGradFP or modified versions have been used in mammalian cells, Caenorhabditis elegans, zebrafish, and plants ( Shin et al., 2015; Sorge et al., 2021; Wang et al., 2017; Yamaguchi et al., 2019). Here, we show that deGradFP successfully depletes a kinetochore protein and a COPII subunit in the procyclic form of T. brucei cells.
Results
To establish a targeted protein degradation method in T. brucei, we chose a protein that has a slow turnover rate. KKT3 is a kinetochore protein that constitutively localizes at kinetochores and does not show any obvious fluctuation in its abundance during the cell cycle, implying that it is a stable protein ( Akiyoshi & Gull, 2014). In fact, the half-life of KKT3 has been estimated to be much longer than transiently-localized kinetochore proteins ( Tinti et al., 2019). To apply deGradFP in T. brucei, we made a construct that expresses an F-box domain fused with a nuclear localization signal (NLS) and the anti-GFP nanobody VhhGFP4 ( Saerens et al., 2005) ( Figure 1A, B). The fusion protein was expressed from a derivative of pDEX777 that integrates at the 177 bp repeats on minichromosomes and allows doxycycline-inducible expression ( Kelly et al., 2007; Nerusheva & Akiyoshi, 2016). Putative F-boxes of Tb927.5.700 and Tb927.1.4580 (called cyclin-like F-box protein 1C, CFB1C ( Benz & Clayton, 2007)) were tested. When expressed in cells that have KKT3-YFP as the sole copy of KKT3 (KKT3-YFP/kkt3∆) ( Figure 1C), the construct containing Tb927.5.700 caused growth defects, implying that expression of Tb927.5.700 1-200-NLS-VhhGFP4 led to degradation of KKT3-YFP. In contrast, expression of CFB1C 1-200-NLS-VhhGFP4 did not cause strong growth defects. This means that expression of VhhGFP4 (at least when fused to the F-box of CFB1C) was not sufficient to disrupt the function of KKT3-YFP. We therefore used the F-box from Tb927.5.700 (named FBP75 herein for F-box protein 75 kDa) for subsequent experiments. Besides the construct with an NLS to target nuclear proteins (pBA2675: NLS-deGradFP), we also made another one without an NLS to target cytoplasmic proteins (pBA2705: deGradFP). Induction of these deGradFP systems in wild-type procyclic cells with 1 µg/mL doxycycline did not cause any growth defect ( Figure 1D), showing that expression of deGradFP itself does not cause growth defects.
Figure 1. deGradFP in Trypanosoma brucei.
( A) Schematic of TbFBP75 (Tb927.5.700), NLS-deGradFP, and deGradFP, highlighting the putative F-box domain, NLS, and GFP nanobody (vhhGFP4). ( B) deGradFP forms a complex with an endogenous ubiquitin ligase complex which transfers ubiquitins to the target protein tagged with GFP. Ubiquitylated target proteins are then degraded by the 26S proteasome. ( C) Growth curve for KKT3-YFP/kkt3∆ with induction of Tb927.5.700 (FBP75) 1-200-NLS-VhhGFP4 (left) and Tb927.1.4580 (CFB1C) 1-200-NLS-VhhGFP4 (right). N=2. Representative growth curves are shown. Cell line: BAP2398, BAP2399 ( D) Growth curve for wild-type procyclic cells with NLS-deGradFP (left) or deGradFP (right). N=3. Error bars are SEM. Cell line: BAP2395, BAP2511. For all growth curves, deGradFP was induced with 1 μg/ml doxycycline and cultures were diluted at day 2. Gray lines are uninduced controls. Green dashed lines are doxycycline-treated cells. N=3. Error bars are SEM. Cell line: BAP2395, BAP2511.
We next used a cell line in which both alleles of KKT3 were C-terminally tagged with YFP using a PCR-based method in one transfection step ( Dean et al., 2015). We found that induction of NLS-deGradFP in this cell line caused more severe growth defects than RNAi ( Figure 2A and B) ( Marcianò et al., 2021). We did not observe severe growth defects with deGradFP without NLS in KKT3-YFP cells, showing the importance of NLS to target nuclear proteins in our system ( Figure 2C). Microscopy analysis confirmed that NLS-deGradFP caused more significant depletion of KKT3 at six hours than RNAi ( Figure 2D and E). The fact that induction of NLS-deGradFP in wild-type cells did not cause any growth defect ( Figure 1D) means that the observed growth defect was due to specific degradation of YFP-tagged KKT3. In the deGradFP system, YFP-tagged target proteins ubiquitylated by the SCF ubiquitin ligase complex are degraded by the proteasome system ( Caussinus & Affolter, 2016). Consistent with this possibility, addition of the proteasome inhibitor MG132 prevented degradation of KKT3-YFP ( Figure 2F), suggesting that our deGradFP system in T. brucei relies on the proteasome-dependent protein degradation pathway as expected. We note that NLS-deGradFP did not work well for another kinetochore protein KKT18 ( Figure 2G). In contrast, RNAi-mediated depletion of KKT18 caused growth defects and reduction of protein.
Figure 2. deGradFP depletes a nuclear protein KKT3 more efficiently than RNAi.
( A, B, C) Growth curves for KKT3 knockdown by RNAi ( A: N=4, cell line: BAP2512), KKT3-YFP depletion by deGradFP with NLS ( B: N=3, cell line: BAP2513) and KKT3-YFP with deGradFP without NLS ( C: N=3, cell line: BAP2514). Error bars are SEM. ( D, E) Images of KKT3 knockdown by RNAi ( D: cell line: BAP2512), and KKT3-YFP depletion by deGradFP with NLS ( E: cell line: BAP2513). (Left) Examples of cells at 0 h, 3 h, and 6 h after induction. YFP and DAPI images are maximum intensity projection. Bars, 10 µm. (Centre) Examples of cells from left images. (Right) Plot of total YFP signal inside the nucleus (>239 cells in each condition). Data were normalized with the mean value at 0 h. P-values were calculated by Welch two sample t-test. ( F) KKT3-YFP cells with NLS-deGradFP were incubated with either 1 µg/mL doxycycline or 10 µM MG132, or both for 6 hours. Control is untreated cells. KKT3-YFP was detected by immunoblot using anti-GFP antibody. PFR2 was used as a loading control. Cell line: BAP2513. ( G) Growth curve for YFP-KKT18 with NLS-deGradFP (left) and KKT18 RNAi (right). Representative growth curves are shown. N=2 (NLS-deGradFP) and 3 (RNAi). Cell lines: BAP2593, BAP2122. For all growth curves, RNAi or deGradFP was induced with 1 μg/ml doxycycline and cultures were diluted at day 2. Gray lines are uninduced controls. Green dashed lines are doxycycline-treated cells.
We next targeted a cytoplasmic protein SEC31 using a deGradFP construct that lacks an NLS. SEC31 is a subunit of COPII and localizes at the endoplasmic reticulum (ER) exit site ( Hu et al., 2016). Both alleles of SEC31 were C-terminally tagged in a CRISPR cell line ( Beneke et al., 2017). Induction of deGradFP caused a strong growth defect ( Figure 3A and B), which is apparently more severe than RNAi-mediated depletion of SEC31 reported in a previous study ( Hu et al., 2016). These results therefore show that deGradFP can efficiently deplete both nuclear and cytoplasmic proteins in T. brucei.
Figure 3. Depletion of a cytoplasmic protein SEC31 by deGradFP.
( A) Growth curve for SEC31-YFP with deGradFP. N=4. Error bars are SEM. ( B) Examples of cells at 0 h, 3 h, and 6 h after induction. YFP and DAPI images are maximum intensity projection. Bar, 10 µm. Cell line: BAP2518. For all growth curves, RNAi or deGradFP was induced with 1 μg/ml doxycycline and cultures were diluted at day 2. Gray lines are uninduced controls. Green dashed lines are doxycycline-treated cells.
Discussion
In T. brucei, it is easy to tag genes at the endogenous locus using plasmid- or PCR-based methods ( Beneke et al., 2017; Dean et al., 2015; Kelly et al., 2007; Kovářová et al., 2022). Taking advantage of the inducible expression system ( Poon et al., 2012; Wirtz & Clayton, 1995), we have shown that deGradFP can induce targeted protein degradation in T. brucei. The depletion kinetics is faster than the RNAi-mediated depletion method, at least for KKT3. Our results therefore show that deGradFP can be a powerful tool in characterizing depletion phenotypes in T. brucei. It is, however, important to note that deGradFP has some limitations. For example, it has been suggested that deGradFP does not work if GFP is not accessible ( Caussinus et al., 2011; Caussinus & Affolter, 2016). It is also essential that target proteins have lysines that can be ubiquitylated by deGradFP. Furthermore, it is critical that GFP-fusion proteins retain enough functionality to support cell growth because the deGradFP system utilizes the VhhGFP4 nanobody that recognizes GFP or its derivatives. If necessary, this system could be modified to use nanobodies against other epitope tags or even the protein of interest itself to induce degradation of the target ( Aguilar et al., 2019).
The function of the F-box protein used in this study (FBP75) remains unknown. We also do not know which SKP1 or cullin proteins interact with FBP75 and whether those proteins are expressed in other life stages. It therefore remains unknown whether FBP75-based deGradFP works in bloodstream form cells. If it does not work, other F-box proteins could be utilized to deplete proteins of interest in bloodstream form cells ( Benz & Clayton, 2007; Rojas et al., 2017). In any case, it is our hope that deGradFP will prove to be a useful protein degradation tool to facilitate studies of Trypanosoma brucei.
Methods
Plasmids
All plasmids used in this study are listed in Table 1. To make pBA2675 (inducible expression of FBP75 1–200-NLS-VhhGFP4: NLS-deGradFP for nuclear proteins) and pBA2676 (inducible expression of CFB1C 1–200-NLS-VhhGFP4), synthetic DNA BAG181 (pBA2675) and BAG182 (pBA2676) (GeneArt, Thermo Fisher) were digested with HindIII/BamHI and subcloned into pBA310 cut with the same enzymes. The NLS sequence was derived from the La protein ( Marchetti et al., 2000). To make pBA2705 (Inducible expression of FBP75 1–200-VhhGFP4: deGradFP for cytoplasmic proteins), NLS was removed from pBA2675 by PCR with BA3647/BA3648. 12.5 µL of 2x PrimeSTAR MAX (Takara), 1 µL of 3 ng/µL pBA2675 plasmid, 1 µL each of 10 µM forward and reverse primers, and 11 µL of MilliQ water were mixed (30 cycles of 98°C 10 s, 55°C 15 s, 72°C 35 s). The PCR reaction was incubated with 1 µL of DpnI (NEB) at 37°C for 1 hr and was transformed into NEB 5-alpha competent E. coli (NEB). To make pBA871 (hairpin RNAi targeting 49–518 bp of KKT18 coding sequence) and pBA1061 (hairpin RNAi targeting 2562–3072 bp of the KKT3 coding sequence), synthetic DNA BAG34 (KKT18) and BAG55 (KKT3) (GeneArt, Thermo Fisher) were digested with HindIII/BamHI and subcloned into pBA310 cut with the same enzymes.
Table 1. Plasmids used in this study.
| Name | Description |
|---|---|
| pPOTv7 (eYFP, Hyg) | PCR-based eYFP-tagging vector, hygromycin marker ( Dean et al., 2015) |
| pPOTv7 (eYFP, G418) | PCR-based eYFP-tagging vector, G418 marker ( Dean et al., 2015) |
| pBA101 | YFP-KKT18 tagging at endogenous KKT18 locus, hygromycin ( Akiyoshi & Gull, 2014) |
| pBA871 | Inducible expression of KKT18 hairpin RNAi (targeting 49–518 bp of KKT18
coding sequence), integrate at 177 bp, phleomycin marker |
| pBA310 | Inducible expression vector, integrate at 177 bp, phleomycin marker
( Nerusheva & Akiyoshi, 2016) |
| pBA1061 | Inducible expression of KKT3 hairpin RNAi (targeting 2562–3072 bp of KKT3
coding sequence), integrate at 177 bp, phleomycin marker |
| pBA2675 | Inducible expression of FBP75
1–200-NLS-VhhGFP4, integrate at 177 bp,
phleomycin marker (NLS-deGradFP for nuclear proteins) |
| pBA2676 | Inducible expression of CFB1C
1–200-NLS-VhhGFP4, integrate at 177 bp,
phleomycin marker |
| pBA2705 | Inducible expression of FBP75
1–200-VhhGFP4, integrate at 177 bp, phleomycin
marker (deGradFP for cytoplasmic proteins) |
Trypanosome cells
All cell lines used in this study were derived from the TREU 927 procyclic form cells and are listed in Table 2. SmOxP927 expresses Tet repressor and T7 RNA polymerase ( Poon et al., 2012), while PCF 1339 expresses Tet repressor, T7 RNA polymerase, and the Cas9 nuclease ( Beneke et al., 2017). Cells were grown at 28°C in SDM-79 medium (Life Technologies, Thermo Fisher) supplemented with 10% heat-inactivated fetal calf serum (Sigma) and 7.5 µg/mL hemin, as well as puromycin (Sigma) and appropriate drugs ( Brun & Schönenberger, 1979).
Table 2. Trypanosome cell lines used in this study.
| Name | Description |
|---|---|
| SmOxP927 | TREU927 procyclic cells that expresses TetR and T7 RNAP ( Poon et al., 2012) |
| PCF 1339 | TREU927 procyclic cells that expresses TetR, T7 RNAP, and Cas9 ( Alves et al., 2020) |
| BAP167 | YFP-KKT18 ( Akiyoshi & Gull, 2014) |
| BAP2122 | YFP-KKT18, KKT18 RNAi |
| BAP1123 | KKT3-YFP/kkt3∆ ( Nerusheva et al., 2019) |
| BAP2398 | KKT3-YFP/kkt3∆, FBP75 1–200-NLS-VhhGFP4 |
| BAP2399 | KKT3-YFP/kkt3∆, CFB1C 1–200-NLS-VhhGFP4 |
| BAP2395 | FBP75 1–200-NLS-VhhGFP4 |
| BAP2511 | FBP75 1–200-VhhGFP4 |
| BAP2464 | KKT3-YFP/KKT3-YFP |
| BAP2512 | KKT3-YFP/KKT3-YFP, KKT3 RNAi |
| BAP2513 | KKT3-YFP/KKT3-YFP, FBP75 1–200-NLS-VhhGFP4 |
| BAP2514 | KKT3-YFP/KKT3-YFP, FBP75 1–200-VhhGFP4 |
| BAP2466 | SEC31-YFP/SEC31-YFP |
| BAP2518 | SEC31-YFP/SEC31-YFP, FBP75 1–200-VhhGFP4 |
| BAP2567 | YFP-KKT18/YFP-KKT18 |
| BAP2593 | YFP-KKT18/YFP-KKT18, FBP75 1–200-NLS-VhhGFP4 |
To make the homozygous KKT3-YFP cell line, two YFP-tagging cassettes were amplified from pPOTv7 (YFP, Hyg) or pPOTv7 (YFP, G418) ( Dean et al., 2015) by PCR using BA1821/BA1822 ( Table 3). 25 µL of 2x PrimeSTAR MAX (Takara), 1 µL of 30 ng/µL template pPOT plasmid, 1 µL each of 10 µM forward and reverse primers, and 22 µL of MilliQ water were mixed (30 cycles of 98°C 10 s, 55°C 15 s, 72°C 1 min). 50 µL of PCR products were transfected into SmOxP927 ( Poon et al., 2012) by electroporation. Transfected cells were selected by addition of 50 μg/mL hygromycin (Sigma) and 30 μg/mL G418 (Sigma) and cloned by dispensing dilutions into 96-well plates. Clones were screened by diagnostic PCR of genomic DNA using BA523/BA2352.
Table 3. Sequence of primers and synthetic DNA used in this study.
| Name | Description |
|---|---|
| BA3647 | CACCTGCTCCACCGTCCTCCATGTGCGGCA |
| BA3648 | GGAGGACGGTGGAGCAGGTGGAGCAGGTGT |
| BA1821 | GTAATGGAGTTTGTGAGGTGCTTGATGAGGAAAAATTCCCCCTTTCGGAGGAACTCAACCAGATGCTCTACGGTGGCGTGGGTTCTGGTAGTGGTTCC |
| BA1822 | GAAATGCGACAGCAGACGGAAACGGAAAAAAAAATAAAAAAAAAGAGAGGGCTATCTGTAATTCTTTACGTACATCACTTCCAATTTGAGAGACCTGTGC |
| BA523 | TATGTCTGTTTATTGCCCAC |
| BA2352 | GATCGATC GCGGCCGC TTTTCAGTTGCTATAGGCCT |
| BA3633 | GCTCAAGGGAAATGTGGAAAGAGCTCGCCACTAAGCACTTTTCGGCAATTCAACATATTAATAACCTCAAGTTTCTGCAGGGTTCTGGTAGTGGTTCCGG |
| BA3634 | ATATATGCAACCCGGCGACAAACAAACACCGCACAGGTGCAAAGGCACACAAACATGTTTTCCTTTGAGTGCCATGTGTGCCAATTTGAGAGACCTGTGC |
| BA3635 | GAAATTAATACGACTCACTATAGGGGCGTGGCTCGCTCACGAGCGTTTTAGAGCTAGAAATAGC |
| G00 (BA2931) | AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATT TCTAGCTCTAAAAC |
| BA3638 | TTGTTTAGGATCACAACGCT |
| BA3639 | GTACAGACACGTCCGTACAA |
| BA3376 | CACTTTATCCTTGGGAGGGGTTTGCCAACCGCGTGCCTGTGGTCTTCAGCCGTGCATTTCTTTCCTCTTTCTTCAGCCTCGTATAATGCAGACCTGCTGC |
| BA3377 | ACCTCTACATCAGAAAGGGGAAACACACAAGCGCGCACCTCGTCCGTTGGAAGCTGCAACAACTCTTTTACGCAGGTCATACTACCCGATCCTGATCCAG |
| BA3378 | GAAATTAATACGACTCACTATAGGATCGTTGTAGGGCGCTGACCGTTTTAGAGCTAGAAATAGC |
| BA385 | GATCGATC GCGGCCGC ATGATTGGCTGTTATGCAAC |
| BA384 | GATCGATC GCGGCCGC GCTGGCCCTCTTTACATGAA |
| BAG34 | GATCGATCGATC AAGCTT
GCTTGTGTGTTTCCCCTTTCTGATGTAGAGGTTACTTTAGTCCTCTGTGAATTGGGAAAACTTCTGCAGAGATGGCTTTACGCCACGCGCTACAAGTTGG TTTCCTCATTCGAGGTATTTCTTCATTTATTTGTGCACGTAGCGGACAGAGAACCGAAAAGGATAGCCAACGCTTTCCTCGGTTCATGTAAAGAGGGCCA GCACCTGTCGTTGCTGGCAGATGTATGTGAAACCCTCTTCTCACCATCCCGGATTTCCCTTCTTGCTGAAGTGGACGTAGAGCTTTTCTTAACATTCTTA AAGTTCCTCTGTGACATTCCTGTATTGAAGGATCGGCTCGGTAATGTTCTGGTGAAGATTCTCCTGGAATTCCTCTCCGCTGCGGTGGAGCGCGATGGGG ACTACCGTCAACCCCGAGCATGTGCAAGCGTGCTCATCACCCTCACACGTGGGTCAAAGGCAAACAAAGAAAAGGCGGACCCTCATTTCTAAGTACGGTC AGGTGTCGTAGCACTGCATTGAATTCGATTGCCATTCTCCGAGTGTTTTAGCGTGACGGCCGCAGGGGTCCCATAATCTTTGTTTGCCTTTGACCCACGT GTGAGGGTGATGAGCACGCTTGCACATGCTCGGGGTTGACGGTAGTCCCCATCGCGCTCCACCGCAGCGGAGAGGAATTCCAGGAGAATCTTCACCAGAA CATTACCGAGCCGATCCTTCAATACAGGAATGTCACAGAGGAACTTTAAGAATGTTAAGAAAAGCTCTACGTCCACTTCAGCAAGAAGGGAAATCCGGGA TGGTGAGAAGAGGGTTTCACATACATCTGCCAGCAACGACAGGTGCTGGCCCTCTTTACATGAACCGAGGAAAGCGTTGGCTATCCTTTTCGGTTCTCTG TCCGCTACGTGCACAAATAAATGAAGAAATACCTCGAATGAGGAAACCAACTTGTAGCGCGTGGCGTAAAGCCATCTCTGCAGAAGTTTTCCCAATTCAC AGAGGACTAAAGTAACCTCTACATCAGAAAGGGGAAACACACAAGC GGATCC GATCGATCGATC ( KKT18 hairpin) |
| BAG55 | GATCGATCGATC AAGCTT
ACGTCACATGCTGCTTAACGGTGATTGGATACGCTACTACCACTTTTATCCTATGGAGGAAGAAGGAGGCGACTCAGTCGCTGTCACATATCATATTCAG CCGGGACGTACTGGTGTTACATTTTTCAACCATAGTTTTTCTGTGCACTCAGCTGTGCTGTCAGTGTTGGAACACATCGTATACGTCGTAGATCGTGTTG ATATCGAGGAAGATAATGACGTGGCGCGTATCTTGTCGTTGGCACAAGCATTGAATGAGGAGAAGAAGATCTACGATGTCCTTCAATTGGTCGAAACCCA CGACACACATATGTTAAAACAGCGGCGGTCTCCCGGTATTATGTCTGTTTATTGCCCACCACAAACAGCATTTCAATGCAATGGTGATCCCTTTGTATTT GTTCGCTGGTACCGCTTCCATATGGAAAACTCTATGAGTGGCTTTATGCTCTCCAACGGGGCTGTGCAGGTGTTTGTAGGCGGGAAATACGAGTTACGGT GGCTGGATGACAAAGGCGGACCCTCATTTCTAAGTACGGTCAGGTGTCGTAGCACTGCATTGAATTCGATTGCCATTCTCCGAGTGTTTTAGCGTGACGG CCGCAGGGGTCCCATAAGTCATCCAGCCACCGTAACTCGTATTTCCCGCCTACAAACACCTGCACAGCCCCGTTGGAGAGCATAAAGCCACTCATAGAGT TTTCCATATGGAAGCGGTACCAGCGAACAAATACAAAGGGATCACCATTGCATTGAAATGCTGTTTGTGGTGGGCAATAAACAGACATAATACCGGGAGA CCGCCGCTGTTTTAACATATGTGTGTCGTGGGTTTCGACCAATTGAAGGACATCGTAGATCTTCTTCTCCTCATTCAATGCTTGTGCCAACGACAAGATA CGCGCCACGTCATTATCTTCCTCGATATCAACACGATCTACGACGTATACGATGTGTTCCAACACTGACAGCACAGCTGAGTGCACAGAAAAACTATGGT TGAAAAATGTAACACCAGTACGTCCCGGCTGAATATGATATGTGACAGCGACTGAGTCGCCTCCTTCTTCCTCCATAGGATAAAAGTGGTAGTAGCGTATCCA ATCACCGTTAAGCAGCATGTGACGT GGATCC GATCGATCGATC ( KKT3 hairpin) |
| BAG181 | GATCGATC AAGCTT
ATGGGTGGTGGAGCAGCGGTGTCGTCTGGTGACGACAGCGCCGCGGCATCTTCGGGTAACGACACCACCACAACGGATGGTAATCATGGCGGGAGGTACG
CCTGGGAATGCGTTGACGACGTCGGGGGCGCTTTCAACGGTTCCATGAATGGCAACACCTCCCTGCCAAAAGGTTCAAACATCTGTGAGACTCACGGGTG TTGGAGTAAGCAAATACTCCGAAGGGACATTTGCTGCGAGCGGAGCTACGTTCACCCTGTCAGCGCTGCTTGGCGTTGCAGCAGCGTTCTTTCACTTCCA GTGTCACTCCTTGACGAGGTGTTCACTTTTTTGCATCCCGAGGATCTCTGCAGGGTATTGGAAGTATGCCGGTTTTTCTTCTCTGCCGCTGTAAGGTCCG ATCGTACCGCCTGGAGGTCCGTATGCCTTTCGCTATGGAAAAACAAGCAGGGGCTCTCGCGCGTGGTGCGTGAATGGCCGTCTGTGGAGGAGGTATGCCG ACAGGAAGACTTGGAGTCGATTTGTGTGCAACAAGCGTTTGCACATGAATATTTCAGCTGGGGAACCATTAACAACATGGTGCCGCACATGGAGGACGGT ACCGGTCGAGGACACAAGCGGTCACGTGAACAA GGAGCAGGTGGAGCAGGT GTCCAACTGGTGGAGTCTGGTGGCGCTTTGGTGCAGCCAGGTGGCTCTCTGCGTTTGTCCTGTGCCGCTTCTGGCTTCCCAGTGAACCGCTATTCCATGC GCTGGTATCGCCAGGCTCCAGGCAAAGAGCGTGAGTGGGTAGCCGGTATGTCCAGCGCGGGTGATCGTAGCTCCTATGAAGACTCCGTGAAGGGCCGTTT CACCATCAGCCGTGACGATGCCCGTAACACGGTGTATCTGCAAATGAACAGCTTGAAACCTGAAGATACGGCCGTGTATTACTGTAATGTGAACGTGGGCTTC GAGTATTGGGGCCAAGGCACCCAGGTCACCGTCTCCAGCTAA GGATCC GATCGATC ( FBP75's first 600 bp, NLS, GlyAlaGly linker x2, VhhGFP4) |
| BAG182 | GATCGATC AAGCTT ATGTTTTTGAAGGAGGGAAACAGTGAAATGCGGTTGAGCGGAGCTACGTTCTTGAAGGGCGCTGTTGATGATTTCAATGCATGTGAGTCCCCTGTTTTAT
CATCCGGAAGCAGTTTGGTTCTCACAAGTCCTGCTCTGAGCACCTCAGACACGTGCCGATCTGCGATGCGTGAAACCATCCCTTCCGTTTGTGCTGGCGC AGGCCTCAGCAGTCGCTGCTCAACTGATTGCACTGTGCTGAAGTGTGTGAACCCGCTGCATGTTAAGTTCCAGGAGCCGTCAGGGTTGTCAGGGGCTGAT TCAGTGGACTCGTTTGACTCGTTGGGTGACCTTTCCGAGTTGCATGAGGAACATCAACATGTTTCTTCTGTTGCCTCTGAAAAGCCTTTGACCCTTCACG ATGTGCCGGAATCCGTCCTGTATGGTGCCATTCCATACCTTTCCCTTCCAGACGTCATTGCCTTATCACGGACATGTAAGAAGTTTCACAAACTGGTGCA GGGATACTTTGCAGTGAATGAGCATGGCGTGATGAGCATCCCCGCCTTTGACACCCGCAGCTTCATGCAGTACCGTCCAGAGAGGAAACCTCCGGTAACG ACCGGTCGAGGACACAAGCGGTCACGTGAACAA GGAGCAGGTGGAGCAGGT GTCCAACTGGTGGAGTCTGGTGGCGCTTTGGTGCAGCCAGGTGGCTCTCTGCGTTTGTCCTGTGCCGCTTCTGGCTTCCCAGTGAACCGCTATTCCATGC GCTGGTATCGCCAGGCTCCAGGCAAAGAGCGTGAGTGGGTAGCCGGTATGTCCAGCGCGGGTGATCGTAGCTCCTATGAAGACTCCGTGAAGGGCCGTTT CACCATCAGCCGTGACGATGCCCGTAACACGGTGTATCTGCAAATGAACAGCTTGAAACCTGAAGATACGGCCGTGTATTACTGTAATGTGAACGTGGGC TTCGAGTATTGGGGCCAAGGCACCCAGGTCACCGTCTCCAGCTAA GGATCC GATCGATC |
To make the homozygous SEC31-YFP and YFP-KKT18 cell lines, donor DNA templates were amplified from pPOTv7 (YFP, Hyg) or pPOTv7 (YFP, G418) ( Dean et al., 2015) with BA3633/BA3634 (SEC31) or BA3376/3377 (KKT18). 25 µL of 2x PrimeSTAR MAX (Takara), 1 µL of 30 ng/µL template pPOT plasmid, 1 µL each of 10 µM forward and reverse primers, and 22 µL of MilliQ water were mixed (30 cycles of 98°C 10 s, 55°C 15 s, 72°C 1 min). sgRNA template amplified with BA3635/G00 (SEC31) and BA3378/G00 (KKT18) using 12.5 µL of 2x PrimeSTAR MAX (Takara), 4 µL of 10 µM G00 primer, 4 µL of 10 µM target specific forward primer, 4.5 µL MilliQ water (35 cycles of 98°C 10 s, 60°C 30 s, 72°C 15 s). All the PCR products were mixed and purified using a QIAquick PCR purification kit (QIAGEN), eluted with 50 µL of MilliQ water, and then co-transfected into PCF 1339 ( Alves et al., 2020; Beneke et al., 2017) by electroporation. Transfected cells were selected by addition of 50 μg/mL hygromycin (Sigma) and 30 μg/mL G418 (Sigma) and cloned by dispensing dilutions into 96-well plates. Clones were screened by diagnostic PCR of genomic DNA using BA3638/BA3639 (SEC31) and BA385/BA384 (KKT18). 5 µg of RNAi and deGradFP constructs were linearized by NotI-HF (NEB) and transfected into YFP-tagged cell lines (3 clones each for KKT3-YFP, SEC31-YFP, and YFP-KKT18) or SmOxP927 by electroporation and selected by addition of 5 µg/mL phleomycin (Sigma). For induction of deGradFP or RNAi, doxycycline (Sigma) was added to the medium to a final concentration of 1 μg/mL. Cell growth was monitored using a CASY cell counter (Roche) and plotted with ggplot in R.
Fluorescence microscopy
Cells were harvested by centrifugation at 800 g for 5 min, washed in PBS, settled onto glass slides for 5 min, and fixed with 4% paraformaldehyde for 5 min. Following three washes in PBS (5 min each), cells were permeabilized with 0.1% NP-40 in PBS for 5 min, washed three times in PBS (5 min each), and embedded in mounting media (1% 1,4-Diazabicyclo [2.2.2]octane (DABCO), 90% glycerol, and 50 mM sodium phosphate pH 8.0) containing 100 ng/mL DAPI. Images were captured at room temperature on a Zeiss Axioimager.Z2 microscope (Zeiss) installed with ZEN using a Hamamatsu ORCA-Flash4.0 camera with 63x objective lenses (1.40 NA). 22 optical slices spaced 0.24 μm apart were collected. Images were processed in ImageJ/Fiji ( Schneider et al., 2012). Maximum intensity projection images were generated by Fiji software ( Schneider et al., 2012). Total YFP intensity in the nucleus was measured using 3D Objects Counter with default settings in Fiji as follows. DAPI images were first used to segment the nucleus by removing regions that have top 0.2% intensity (that correspond to kDNA signals) and then by selecting objects that have the size of nuclei (5.3–40 µm 3). YFP total intensity inside the nucleus was measured using a redirect function in 3D Objects Counter. 3D Plots were made with ggplot in R.
Immunoblots
Cells were harvested by centrifugation (800 g, 5 min) and washed with 1 ml PBS. Then cells were resuspended in 2× LDS sample buffer (Thermo Fisher) with 0.1 M DTT. Denaturation of proteins was performed for 5 min at 95°C. SDS-PAGE and immunoblots were performed by standard methods using the following antibodies: anti-GFP (OriGene, rabbit TP401, 1:2000) for YFP-tagged proteins and L8C4 (anti-PFR2, 1:1500) ( Kohl et al., 1999) for a loading control. Bands were visualized by horseradish-peroxidase-conjugated sheep anti-mouse-IgG antibodies (GE Healthcare) on an ODYSSEY Fc Imaging System (LI-COR).
Acknowledgments
We thank Markus Affolter for advice. We also thank Jack Sunter, Sam Dean, and Tom Beneke for sharing reagents. pBA2675 (NLS-deGradFP for nuclear proteins) and pBA2705 (deGradFP for cytoplasmic proteins) and their plasmid maps have been deposited into Addgene (ID 189997 and 189998).
Funding Statement
This work was supported by Wellcome (210622/Z/18/Z ; a Senior Research Fellowship to BA); the European Molecular Biology Organization Young Investigator Program.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
[version 2; peer review: 4 approved]
Data availability
Underlying data
Figshare: Extended Data for "Targeted protein degradation using deGradFP in Trypanosoma brucei", https://doi.org/10.6084/m9.figshare.19960244 ( Ishii & Akiyoshi, 2022)
This project contains the following underlying data:
- Fig1_1.csv (raw data for growth curve of NLS-deGradFP in wild-type cells, BAP2395)
- Fig1_2.csv (raw data for growth curve of deGradFP in wild-type cells, BAP2511)
- Fig1_3.csv (raw data for growth curve of NLS-deGradFP in KKT3-YFP/kkt3∆, BAP2398)
- Fig1_4.csv (raw data for growth curve of Tb927.1.4580 1-200-NLS-VhhGFP4 in KKT3-YFP/kkt3∆, BAP2399)
- Fig2_1.csv (raw data for growth curve of KKT3-YFP/KKT3-YFP with KKT3 RNAi, BAP2512)
- Fig2_2.csv (raw data for YFP intensity of KKT3-YFP/KKT3-YFP with KKT3 RNAi, BAP2512)
- Fig2_3.czi (raw microscopy image, 0h control, KKT3-YFP/KKT3-YFP with KKT3 RNAi, BAP2512)
- Fig2_4.czi (raw microscopy image, 3h, KKT3-YFP/KKT3-YFP with KKT3 RNAi, BAP2512)
- Fig2_5.czi (raw microscopy image, 6h, KKT3-YFP/KKT3-YFP with KKT3 RNAi, BAP2512)
- Fig2_6.csv (raw data for growth curve of KKT3-YFP/KKT3-YFP with NLS-deGradFP, BAP2513)
- Fig2_7.csv (raw data for YFP intensity of KKT3-YFP/KKT3-YFP with NLS-deGradFP, BAP2513)
- Fig2_8.czi (raw microscopy image, 0h control, KKT3-YFP/KKT3-YFP with NLS-deGradFP, BAP2513)
- Fig2_9.czi (raw microscopy image, 3h, KKT3-YFP/KKT3-YFP with NLS-deGradFP, BAP2513)
- Fig2_10.czi (raw microscopy image, 6h, KKT3-YFP/KKT3-YFP with NLS-deGradFP, BAP2513)
- Fig2_11.csv (raw data for growth curve of KKT3-YFP/KKT3-YFP with deGradFP, BAP2514)
- Fig2_12.csv (raw data for growth curve of YFP-KKT18 with KKT18 RNAi, BAP2122)
- Fig2_13.csv (raw data for growth curve of YFP-KKT18 with NLS-deGradFP, BAP2593)
- Fig2_14.tif (raw immunoblot data for KKT3-YFP, GFP antibody)
- Fig2_15.tif (raw immunoblot data for PFR2 loading control, L8C4 antibody)
- Fig3_1.csv (raw data for growth curve of SEC31-YFP/SEC31-YFP with deGradFP, BAP2518)
- Fig3_2.csv (raw microscopy image, 0h control, SEC31-YFP/SEC31-YFP with deGradFP, BAP2518)
- Fig3_3.csv (raw microscopy image, 3h, SEC31-YFP/SEC31-YFP with deGradFP, BAP2518)
- Fig3_4.csv (raw microscopy image, 6h, SEC31-YFP/SEC31-YFP with deGradFP, BAP2518)
- Table3.csv (Sequence for primers, synthetic DNA, and plasmids)
Data are available under the terms of the Creative Commons Zero “No rights reserved” data waiver (CC0 1.0 Public domain dedication).
References
- Aguilar G, Vigano MA, Affolter M, et al. : Reflections on the use of protein binders to study protein function in developmental biology. Wiley Interdiscip Rev Dev Biol. 2019;8(6):e356. 10.1002/wdev.356 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Akiyoshi B, Gull K: Discovery of unconventional kinetochores in kinetoplastids. Cell. 2014;156(6):1247–1258. 10.1016/j.cell.2014.01.049 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Alsford S, Turner DJ, Obado SO, et al. : High-throughput phenotyping using parallel sequencing of RNA interference targets in the African trypanosome. Genome Res. 2011;21(6):915–924. 10.1101/gr.115089.110 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Alves AA, Gabriel HB, Bezerra MJR, et al. : Control of assembly of extra-axonemal structures: the paraflagellar rod of trypanosomes. J Cell Sci. 2020;133(10):jcs242271. 10.1242/jcs.242271 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Beneke T, Madden R, Makin L, et al. : A CRISPR Cas9 high-throughput genome editing toolkit for kinetoplastids. R Soc Open Sci. 2017;4(5):170095. 10.1098/rsos.170095 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Benz C, Clayton CE: The F-box protein CFB2 is required for cytokinesis of bloodstream-form Trypanosoma brucei. Mol Biochem Parasitol. 2007;156(2):217–224. 10.1016/j.molbiopara.2007.08.005 [DOI] [PubMed] [Google Scholar]
- Brun R, Schönenberger: Cultivation and in vitro cloning or procyclic culture forms of Trypanosoma brucei in a semi-defined medium. Short communication. Acta Trop. 1979;36(3):289–292. 10.5169/seals-312533 [DOI] [PubMed] [Google Scholar]
- Caussinus E, Affolter M: deGradFP: A System to Knockdown GFP-Tagged Proteins. Methods Mol Biol. 2016;1478:177–187. 10.1007/978-1-4939-6371-3_9 [DOI] [PubMed] [Google Scholar]
- Caussinus E, Kanca O, Affolter M: Fluorescent fusion protein knockout mediated by anti-GFP nanobody. Nat Struct Mol Biol. 2011;19(1):117–121. 10.1038/nsmb.2180 [DOI] [PubMed] [Google Scholar]
- Cavalier-Smith T: Kingdoms Protozoa and Chromista and the eozoan root of the eukaryotic tree. Biol Lett. 2010;6(3):342–345. 10.1098/rsbl.2009.0948 [DOI] [PMC free article] [PubMed] [Google Scholar]
- d’Avila-Levy CM, Boucinha C, Kostygov A, et al. : Exploring the environmental diversity of kinetoplastid flagellates in the high-throughput DNA sequencing era. Mem Inst Oswaldo Cruz. 2015;110(8):956–965. 10.1590/0074-02760150253 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Damerow S, Hoppe C, Bandini G, et al. : Depletion of UDP-Glucose and UDP-Galactose Using a Degron System Leads to Growth Cessation of Leishmania major. PLoS Negl Trop Dis. 2015;9(11):e0004205. 10.1371/journal.pntd.0004205 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dean S, Sunter J, Wheeler RJ, et al. : A toolkit enabling efficient, scalable and reproducible gene tagging in trypanosomatids. Open Biol. 2015;5(1):140197. 10.1098/rsob.140197 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Horn D: A profile of research on the parasitic trypanosomatids and the diseases they cause. PLoS Negl Trop Dis. 2022;16(1):e0010040. 10.1371/journal.pntd.0010040 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu H, Gourguechon S, Wang CC, et al. : The G 1 Cyclin-dependent Kinase CRK1 in Trypanosoma brucei Regulates Anterograde Protein Transport by Phosphorylating the COPII Subunit Sec31. J Biol Chem. 2016;291(30):15527–15539. 10.1074/jbc.M116.715185 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ishii M, Akiyoshi B: Extended Data for "Targeted protein degradation using deGradFP in Trypanosoma brucei". figshare. Dataset.2022. 10.6084/m9.figshare.19960244.v1 [DOI] [PMC free article] [PubMed]
- Keeling PJ, Burki F: Progress towards the Tree of Eukaryotes. Curr Biol. 2019;29(16):R808–R817. 10.1016/j.cub.2019.07.031 [DOI] [PubMed] [Google Scholar]
- Kelly S, Reed J, Kramer S, et al. : Functional genomics in Trypanosoma brucei: a collection of vectors for the expression of tagged proteins from endogenous and ectopic gene loci. Mol Biochem Parasitol. 2007;154(1):103–109. 10.1016/j.molbiopara.2007.03.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim HS, Li Z, Boothroyd C, et al. : Strategies to construct null and conditional null Trypanosoma brucei mutants using Cre-recombinase and loxP. Mol Biochem Parasitol. 2013;191(1):16–19. 10.1016/j.molbiopara.2013.08.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kohl L, Sherwin T, Gull K: Assembly of the paraflagellar rod and the flagellum attachment zone complex during the Trypanosoma brucei cell cycle. J Eukaryot Microbiol. 1999;46(2):105–9. 10.1111/j.1550-7408.1999.tb04592.x [DOI] [PubMed] [Google Scholar]
- Kovářová J, Novotná M, Faria J, et al. : CRISPR/Cas9-based precision tagging of essential genes in bloodstream form African trypanosomes. Mol Biochem Parasitol. 2022;249:111476. 10.1016/j.molbiopara.2022.111476 [DOI] [PubMed] [Google Scholar]
- Madeira da Silva L, Owens KL, Murta SMF, et al. : Regulated expression of the Leishmania major surface virulence factor lipophosphoglycan using conditionally destabilized fusion proteins. Proc Natl Acad Sci U S A. 2009;106(18):7583–7588. 10.1073/pnas.0901698106 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marchetti MA, Tschudi C, Kwon H, et al. : Import of proteins into the trypanosome nucleus and their distribution at karyokinesis. J Cell Sci. 2000;113(Pt 5):899–906. 10.1242/jcs.113.5.899 [DOI] [PubMed] [Google Scholar]
- Marcianò G, Ishii M, Nerusheva OO, et al. : Kinetoplastid kinetochore proteins KKT2 and KKT3 have unique centromere localization domains. J Cell Biol. 2021;220(8):e202101022. 10.1083/jcb.202101022 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Merritt C, Stuart K: Identification of essential and non-essential protein kinases by a fusion PCR method for efficient production of transgenic Trypanosoma brucei. Mol Biochem Parasitol. 2013;190(1):44–49. 10.1016/j.molbiopara.2013.05.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nabet B, Roberts JM, Buckley DL, et al. : The dTAG system for immediate and target-specific protein degradation. Nat Chem Biol. 2018;14(5):431–441. 10.1038/s41589-018-0021-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nerusheva OO, Akiyoshi B: Divergent polo box domains underpin the unique kinetoplastid kinetochore. Open Biol. 2016;6(3):150206. 10.1098/rsob.150206 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nerusheva OO, Ludzia P, Akiyoshi B: Identification of four unconventional kinetoplastid kinetochore proteins KKT22–25 in Trypanosoma brucei. Open Biol. 2019;9(12):190236. 10.1098/rsob.190236 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ngô H, Tschudi C, Gull K, et al. : Double-stranded RNA induces mRNA degradation in Trypanosoma brucei. Proc Natl Acad Sci U S A. 1998;95(25):14687–14692. 10.1073/pnas.95.25.14687 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nishimura K, Fukagawa T, Takisawa H, et al. : An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nat Methods. 2009;6(12):917–922. 10.1038/nmeth.1401 [DOI] [PubMed] [Google Scholar]
- Petroski MD, Deshaies RJ: Function and regulation of cullin-RING ubiquitin ligases. Nat Rev Mol Cell Biol. 2005;6(1):9–20. 10.1038/nrm1547 [DOI] [PubMed] [Google Scholar]
- Poon SK, Peacock L, Gibson W, et al. : A modular and optimized single marker system for generating Trypanosoma brucei cell lines expressing T7 RNA polymerase and the tetracycline repressor. Open Biol. 2012;2(2):110037. 10.1098/rsob.110037 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Prozzillo Y, Fattorini G, Santopietro MV, et al. : Targeted Protein Degradation Tools: Overview and Future Perspectives. Biology (Basel). 2020;9(12):E421. 10.3390/biology9120421 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rao SPS, Barrett MP, Dranoff G, et al. : Drug Discovery for Kinetoplastid Diseases: Future Directions. ACS Infect Dis. 2019;5(2):152–157. 10.1021/acsinfecdis.8b00298 [DOI] [PubMed] [Google Scholar]
- Rojas F, Koszela J, Búa J, et al. : The ubiquitin-conjugating enzyme CDC34 is essential for cytokinesis in contrast to putative subunits of a SCF complex in Trypanosoma brucei. PLoS Negl Trop Dis. 2017;11(6):e0005626. 10.1371/journal.pntd.0005626 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Saerens D, Pellis M, Loris R, et al. : Identification of a universal VHH framework to graft non-canonical antigen-binding loops of camel single-domain antibodies. J Mol Biol. 2005;352(3):597–607. 10.1016/j.jmb.2005.07.038 [DOI] [PubMed] [Google Scholar]
- Schneider CA, Rasband WS, Eliceiri KW: NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9(7):671–675. 10.1038/nmeth.2089 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shin YJ, Park SK, Jung YJ, et al. : Nanobody-targeted E3-ubiquitin ligase complex degrades nuclear proteins. Sci Rep. 2015;5:14269. 10.1038/srep14269 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sorge E, Demidov D, Lermontova I, et al. : Engineered degradation of EYFP-tagged CENH3 via the 26S proteasome pathway in plants. PLoS One. 2021;16(2):e0247015. 10.1371/journal.pone.0247015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tinti M, Güther MLS, Crozier TWM, et al. : Proteome turnover in the bloodstream and procyclic forms of Trypanosoma brucei measured by quantitative proteomics [version 1; peer review: 3 approved]. Wellcome Open Res. 2019;4:152. 10.12688/wellcomeopenres.15421.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Uhlmann F, Wernic D, Poupart MA, et al. : Cleavage of cohesin by the CD clan protease separin triggers anaphase in yeast. Cell. 2000;103(3):375–386. 10.1016/s0092-8674(00)00130-6 [DOI] [PubMed] [Google Scholar]
- Wang S, Tang NH, Lara-Gonzalez P, et al. : A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Development. 2017;144(14):2694–2701. 10.1242/dev.150094 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wheeler RJ, Gluenz E, Gull K: Basal body multipotency and axonemal remodelling are two pathways to a 9+0 flagellum. Nat Commun. 2015;6:8964. 10.1038/ncomms9964 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wirtz E, Clayton C: Inducible gene expression in trypanosomes mediated by a prokaryotic repressor. Science. 1995;268(5214):1179–1183. 10.1126/science.7761835 [DOI] [PubMed] [Google Scholar]
- Yamaguchi N, Colak-Champollion T, Knaut H: zGrad is a nanobody-based degron system that inactivates proteins in zebrafish. eLife. 2019;8:e43125. 10.7554/eLife.43125 [DOI] [PMC free article] [PubMed] [Google Scholar]