Molecular Screening of Enterococcus Virulence Determinants and Potential for Genetic Exchange between Food and Medical Isolates

Tracy J Eaton; Michael J Gasson

doi:10.1128/AEM.67.4.1628-1635.2001

. 2001 Apr;67(4):1628–1635. doi: 10.1128/AEM.67.4.1628-1635.2001

Molecular Screening of Enterococcus Virulence Determinants and Potential for Genetic Exchange between Food and Medical Isolates

Tracy J Eaton ^1,^*, Michael J Gasson ¹

PMCID: PMC92779 PMID: 11282615

Abstract

Enterococci are used as starter and probiotic cultures in foods, and they occur as natural food contaminants. The genus Enterococcus is of increased significance as a cause of nosocomial infections, and this trend is exacerbated by the development of antibiotic resistance. In this study, we investigated the incidence of known virulence determinants in starter, food, and medical strains of Enterococcus faecalis, E. faecium, and E. durans. PCR and gene probe strategies were used to screen enterococcal isolates from both food and medical sources. Different and distinct patterns of incidence of virulence determinants were found for the E. faecalis and E. faecium strains. Medical E. faecalis strains had more virulence determinants than did food strains, which, in turn, had more than did starter strains. All of the E. faecalis strains tested possessed multiple determinants (between 6 and 11). E. faecium strains were generally free of virulence determinants, with notable exceptions. Significantly, esp and gelE determinants were identified in E. faecium medical strains. These virulence determinants have not previously been identified in E. faecium strains and may result from regional differences or the evolution of pathogenic E. faecium. Phenotypic testing revealed the existence of apparently silent gelE and cyl genes. In E. faecalis, the trend in these silent genes mirrors that of the expressed determinants. The potential for starter strains to acquire virulence determinants by natural conjugation mechanisms was investigated. Transconjugation in which starter strains acquired additional virulence determinants from medical strains was demonstrated. In addition, multiple pheromone-encoding genes were identified in both food and starter strains, indicating their potential to acquire other sex pheromone plasmids. These results suggest that the use of Enterococcus spp. in foods requires careful safety evaluation.

There is an expanding range of bacterial cultures being used in food products and increased interest in probiotics and health benefits. A major issue of concern is the safety of cultures that can be consumed live and in large quantities. Several species of lactic acid bacteria are used for this purpose (1, 15), and the most controversial are the enterococci. Enterococci are used as probiotics to improve the microbial balance of the intestine and to treat gastroenteritis in humans and animals (2, 27). They are found as a component of the natural flora of certain foods, where they may have beneficial effects. In certain cheeses, they are significant in ripening and the development of flavor (3, 41, 42). Some enterococci also produce bacteriocins which may have anti-Listeria activity (17). Enterococci occur as food contaminants and may be implicated in food-borne illnesses. The implications of enterococci for food safety has recently been reviewed (13).

The genus Enterococcus is of particular medical relevance because of its increased incidence as a cause of disease, notably in nosocomial infections, and because the available antibiotic therapies are being compromised by evolving antibiotic resistance (22, 37). Enterococcal cultures have featured in dairy fermentations for decades, and isolates with histories of safe use are being promoted as probiotic cultures. These bacteria probably represent the largest risk to human health of any species currently used in this way.

The differences between an enterococcal pathogen and an apparently safe food use strain is unclear, and the potential for the latter to acquire virulence factors by gene transfer has not been investigated. It is already established that the molecular taxonomy of enterococci does not lead to a distinction between these two types of strains. Our knowledge of virulence in enterococci is incomplete, in part due to the fact that they are normal human commensals and, as such, have subtle virulence traits that are not easily identified. Virulence traits include adherence to host tissue, invasion and abscess formation, modulation of host inflammatory responses, and secretion of toxic products. Several genes for virulence factors in Enterococcus faecalis have been characterized (see Table 2), and their effects have been demonstrated in animal models (4, 19, 21, 23, 34) and cultured cells (25, 31). In this study, the incidence of known virulence factors in medical, food, and dairy starter Enterococcus strains was investigated.

TABLE 2.

Enterococcus virulence factors identified

Gene(s)	Role of product in virulence	Reference(s)
agg	Aggregation protein involved in adherence to eukaryotic cells; cell aggregation and conjugation	14, 44
gelE	Toxin; extracellular metalloendopeptidase, hydrolyzes gelatin, collagen, hemoglobin, and other bioactive compounds	39
cylL_v cylL_s	Cytolysin (hemolysin-bacteriocin) precursor; expression of cylL_v-L_s, -M, -B, and -A is required for production of active cytolysin which lyses a broad range of eukaryotic and gram-positive cells	16
cylM	Posttranslational modification of cytolysin	16
cylB	Transport of cytolysin	16
cylA	Activation of cytolysin	16
esp	Cell wall-associated protein involved in immune evasion; may be associated with cyl genes on a pathogenicity island	35, 36
efaAfs; efaAfm	Cell wall adhesins expressed in serum by E. faecalis and E. faecium, respectively	29, 38
cpd, cob, ccf, cad	Sex pheromones, chemotactic for human leukocytes; facilitate conjugation	7, 11

Open in a new tab

Enterococci are noted for their capacity to exchange genetic information by conjugation (5), and these processes are known to take place in the gastrointestinal tract (19). As well as transmissible antibiotic resistance plasmids, virulence factors such as hemolysin-cytolysin production and the capacity for adhesion are known to be transmissible by highly efficient gene transfer mechanisms (4, 16, 25, 43). Thus, this study also investigated the possibility that apparently safe starter or probiotic cultures might acquire virulence factors by conjugation. In addition, the potential for conjugation to take place was investigated by screening for the presence of newly identified pheromone-encoding genes whose products are involved in initiating characterized conjugation processes (7; The Institute for Genomic Research E. faecalis genome database [http://www.tigr.org/tdb/mdb/mdb.hmtl]). Sex pheromones are also thought to be involved in eliciting an inflammatory response. These pheromones are chemotactic for human and rat polymorphonuclear leukocytes in vitro and induce superoxide production and secretion of lysosomal enzymes (11, 24, 33). They may therefore be considered virulence factors.

MATERIALS AND METHODS

Bacterial strains and media.

Escherichia coli JM109 was obtained from Promega. L broth (26) was used for growth of E. coli at 37°C and was supplemented with ampicillin at 100 μg ml⁻¹ when appropriate. The enterococcal strains and plasmids used in this study are listed in Table 1. Enterococcal strains were grown in brain heart infusion (BHI) broth and agar (Oxoid) at 37°C. For enterococcal mating experiments, the medium was supplemented with erythromycin at 50 μg ml⁻¹, kanamycin at 500 μg ml⁻¹, streptomycin at 1,000 μg ml⁻¹, tetracycline at 10 μg ml⁻¹, rifampin at 25 μg ml⁻¹, and fusidic acid at 25 μg ml⁻¹ when appropriate.

TABLE 1.

Enterococcal strains and plasmids used in this study

Strain or plasmid	Relevant marker(s)^a	Comment and/or reference
E. faecalis strains
OG1s	str gelE⁺	20
DS16	tet cylMBA⁺agg⁺	Medical isolate containing pAD1 and pAD2; 40
FA2-2	rif fus	Plasmid-free recipient strain used in mating experiments; 9
JA2-2	rif fus	Plasmid-free recipient strain used as positive control strain for sex pheromone determinants
EBH1	efaAfs⁺	29
Ec2594	esp⁺	Medical isolate from blood (Oxford)
FI9575	rif fus ery cylMBA⁺agg⁺	Transconjugant starter strain; this study
FI9530	rif fus ery	Transconjugant starter strain; this study
FI9574	tet ery cylMBA⁺agg⁺	Transconjugant starter strain; this study
Plasmids
pAD1	Hem-Bac	Conjugative plasmid from E. faecalis DS16
pAD2	ery str kan	Plasmid from E. faecalis DS16; Tn917 carries ery determinant
pAM714	ery Hem-Bac	pAD1::Tn917 wild-type transfer; 20

Open in a new tab

ery, erythromycin; rif, rifampin; fus, fusidic acid; str, streptomycin; kan, kanamycin; gelE⁺ extracellular metalloendopeptidase; efaAfc⁺, cell wall adhesin EfaA; esp, gene for cell wall-associated protein Esp; agg, gene for aggregation protein; Hem-Bac, hemolysin-bacteriocin.

Enterococcal isolates.

Enterococcus isolates were collected from National collections and various companies and educational establishments, including the American Type Culture Collection, the Deutsche Sammlung von Mikroorganismen, the National Collections of Industrial and Marine Bacteria, CIT INIA Spain, the Danish Veterinary Laboratory, the University of Bath, the University of Michigan, and the Public Health Laboratories, Collindale. Strains were identified to the species level with API ID32-STREP kits (bioMerieux Vitek Inc., Hazelwood, Mo.). One starter strain (F41) was isolated from a Danish fermented-milk product by diluting the culture in one-quarter-strength Ringer solution and plating dilutions onto BHI agar. Isolated colonies were then subjected to 16S rRNA sequence analysis and biochemical testing. The results indicated that this was an E. faecalis strain. Forty-nine strains were used for testing and comprised panel A. Panel A consisted of 9 dairy starter, 22 food, and 18 medical strains representing different source groups (milk, cheese, meat, blood, pus, urine, feces, hospital environment).

Control strains used in PCR experiments and for probe generation were E. faecalis strains EBH1 (efaAfs⁺), OG1S (gelE⁺), and DS16 (cylM⁺ cylB⁺ cylA⁺ agg⁺) and E. faecium Ec2594 (esp⁺ efaAfm⁺) (Tables 1 and 2).

Isolation of enterococcal DNA.

Total DNA was extracted from overnight Enterococcus cultures by the method of Lewington et al. (28).

DNA manipulations.

DNA manipulations, including restriction endonuclease digestion and Southern blotting, were carried out using standard methods (31). Southern hybridizations were carried out using the ECL direct nucleic acid labeling and detection system (Amersham) under standard-stringency conditions, except that 0.25 M NaCl was used in the hybridization buffer. For Southern hybridizations using the efaA probe, high-stringency conditions were used, with the primary wash buffer containing 0.1× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). Restriction enzymes, 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-Gal), and isopropyl-β-d-thiogalactopyranoside (IPTG) were purchased from Promega and used in accordance with the manufacturer's instructions. Plasmid DNA from E. coli used for sequence analysis was purified using a QIAprep spin miniprep kit (QIAGEN). Sequencing was performed with an Applied Biosystems 373A automated sequencer and a BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems) in accordance with the manufacturer's instructions.

Oligonucleotide primers for PCR were produced using an Applied Biosystems 392 DNA/RNA synthesizer (Table 3). PCR amplifications were performed in 50-μl reaction mixtures using 5 μg of DNA, 15 mM MgCl₂, 20 pmol of each primer, and 1 U of AmpliTaq DNA polymerase (Perkin-Elmer Corp., Foster City, Calif.). Samples were overlaid with 40 μl of mineral oil and subjected to an initial cycle of denaturation (94°C for 2 min), annealing (at an appropriate temperature for 2 min; Table 3), and elongation (72°C for 2 min), followed by 29 cycles of denaturation (92°C for 15 s), annealing (at an appropriate temperature for 15 s), and elongation (72°C for 15 s). PCR-generated fragments were purified using a QIAquickPCR Purification Kit (QIAGEN) before cloning into pGEM-T vectors using the pGEM-T Easy Vector system (Promega) or probe labeling. Degenerate primers were supplied by Sigma-Genosys (Cambridge, England) and used with the ECL 3′ oligolabeling and detection systems (Amersham). Total genomic DNA was isolated from enterococcal strains, and all samples were repeatedly screened by both PCR and Southern hybridization using the primers and probes described above. Consistent data on the presence of the target virulence genes are presented in Table 4.

TABLE 3.

PCR primers and products for detection virulence determinants

Gene and primer	Sequence (5′ to 3′)	Product size (bp)
agg
TE3	AAGAAAAAGAAGTAGACCAAC	1,553
TE4	AAACGGCAAGACAAGTAAATA
gelE
TE9	ACCCCGTATCATTGGTTT	419
TE10	ACGCATTGCTTTTCCATC
cylM
TE13	CTGATGGAAAGAAGATAGTAT	742
TE14	TGAGTTGGTCTGATTACATTT
cylB
TE15	ATTCCTACCTATGTTCTGTTA	843
TE16	AATAAACTCTTCTTTTCCAAC
cylA
TE17	TGGATGATAGTGATAGGAAGT	517
TE18	TCTACAGTAAATCTTTCGTCA
esp
TE34	TTGCTAATGCTAGTCCACGACC	933
TE36	GCGTCAACACTTGCATTGCCGAA
efaAfs
TE5	GACAGACCCTCACGAATA	705
TE6	AGTTCATCATGCTGTAGTA
efaAfm
TE37	AACAGATCCGCATGAATA	735
TE38	CATTTCATCATCTGATAGTA
cpd
TE51	TGGTGGGTTATTTTTCAATTC	782
TE52	TACGGCTCTGGCTTACTA
cob
TE49	AACATTCAGCAAACAAAGC	1,405
TE50	TTGTCATAAAGAGTGGTCAT
ccf
TE53	GGGAATTGAGTAGTGAAGAAG	543
TE54	AGCCGCTAAAATCGGTAAAAT
cad, TE41	TTATTTWSWTTAGTWTTAGCWGGW

Open in a new tab

TABLE 4.

Summary of PCR, Southern hybridization, and phenotypic screening results for panel A isolates

Strain	Species	Source(s)	Genotype	Relevant phenotype
Starters
F12	E. faecium	Cheese starter, dried milk	efaAfm⁺
F13	E. faecium	Cheese starter, dried milk	efaAfm⁺
F20	E. faecium	Commercial milk product starter	efaAfm⁺
F21	E. faecium	Commercial milk product starter	efaAfm⁺
F22	E. faecium	Spanish sausage starter	efaAfm⁺
F23	E. faecium	Spanish sausage starter (including homemade)	efaAfm⁺
F25	E. durans	Cheddar cheese starter
F27	E. faecalis	Spanish Manchego cheese starter	efaAfs⁺agg⁺cpd⁺cob⁺ccf⁺cad⁺
F41	E. faecalis	Commercial milk product starter	efaAfs⁺gelE⁺agg⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁻
Food
F1	E. faecalis	Sour milk	efaAfs⁺gelE⁺agg⁺cylMBA⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁻ Hyl⁺
F2	E. faecalis	Danish blue cheese	efaAfs⁺agg⁺cylMBA⁺cpd⁺cob⁺ccf⁺cad⁺	Hyl⁺
F3	E. faecalis	Danish blue cheese	efaAfs⁺agg⁺cylMBA⁺cpd⁺cob⁺ccf⁺cad⁺	Hyl⁺
F4	E. faecalis	Stilton cheese	efaAfs⁺gelE⁺agg⁺cylMBA⁺esp⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁻ Hyl⁺
F5	E. faecalis	Milk	efaAfs⁺gelE⁺esp⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁺
F6	E. faecalis	Dairy cheese	gelE⁺agg⁺esp⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁺
F7	E. faecalis	Raw milk	efaAfs⁺gelE⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁺
F8	E. faecalis	Raw milk	efaAfs⁺gelE⁺agg⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁺
F9	E. faecium	Cheese	efaAfm⁺ (efaAfs⁺)
F10	E. faecium	Cheese	efaAfm⁺
F11	E. faecium	Fermented-food waste	efaAfm⁺ (efaAfs⁺)
F14	E. faecium	Commercial milk	efaAfm⁺ (efaAfs⁺)
F15	E. faecium	Cheddar cheese	efaAfm⁺
F16	E. faecium	Cheddar cheese	efaAfm⁺ (efaAfs⁺)
F17	E. faecium	Canned ham	efaAfm⁺ (efaAfs⁺)
F19	E. faecium	Uncooked sausage	efaAfm⁺ (efaAfs⁺)
F24	E. durans	Cheddar cheese	efaAfm⁺ (efaAfs⁺)
F26	E. durans	Pasteurized milk	efaAfs⁺
F28	E. faecium	Slaughterhouse broiler
F29	E. faecium	Retail broiler
F31	E. faecium	Retail pork	efaAfm⁺ (efaAfs⁺)
F32	E. faecalis	Retail pork	efaAfm⁺efaAfs⁺gelE⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁺
Medical
P1	E. faecalis	Endocarditis (efaAfs⁺ control)	efaAfs⁺gelE⁺agg⁺cpd⁺ cob⁺ ccf⁺ cad⁺	GelE⁺
P3	E. faecalis	Human mouth (gelE⁺ control)	efaAfs⁺gelE⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁺
P4	E. faecalis	Endocarditis (cylMBA⁺agg⁺ control)	efaAfs⁺gelE⁺agg⁺ cylMBA⁺ cpd⁺ cob⁺ ccf⁺ cad⁺	GelE⁺ Hyl⁺
P11	E. faecium	Blood (Oxford) (esp⁺efaAfm⁺ control)	efaAfm⁺ (efaAfs⁺) esp⁺
P13	E. faecium	Pus (Yeovil)	efaAfm⁺ (efaAfs⁺)
P14	E. faecalis	Blood (Newcastle)	efaAfs⁺gelE⁺agg⁺cylMBA⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁺ > GelE⁻ Hyl⁺
P20	E. faecium	Perineum (Plymouth)	efaAfm⁺ (efaAfs⁺) gelE⁺esp⁺	GelE⁺ > GelE⁻
P21	E. faecalis	Wound swab (St. Helier hospital)	efaAfs⁺gelE⁺agg⁺cylMB⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁻ Hyl⁻
P26	E. faecalis	Feces (Glasgow)	efaAfs⁺gelE⁺agg⁺cylMBA⁺esp⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁻ Hyl⁺
P31	E. faecalis	Urine (N.E. Lincs.)	efaAfs⁺gelE⁺agg⁺esp⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁻
P36	E. faecalis	Blood (Plymouth)	efaAfs⁺gelE⁺agg⁺cylMBA⁺esp⁺cpd⁺cob⁺ccf⁺cad⁺	GelE⁻ Hyl⁻
P41	E. faecalis	Blood, endocarditis (Salisbury)	efaAfs⁺esp⁺cpd⁺cob⁺ccf⁺cad⁺
P46	E. faecium	Wound swab (Cardiff)	efaAfm⁺ (efaAfs⁺)
P51	E. faecium	Feces (Harrow)	efaAfm⁺ (efaAfs⁺) esp⁺
P56	E. faecium	Urine (Cheltenham)	efaAfm⁺ (efaAfs⁺) esp⁺
P61	E. faecium	Blood (Stafford)	efaAfm⁺ (efaAfs⁺) esp⁺
P66	E. faecium	Blood, endocarditis (Dyfed)	efaAfm⁺ (efaAfs⁺) esp⁺
P71	E. faecium	Environment (Bristol)	efaAfm⁺ (efaAfs⁺) esp⁺

Open in a new tab

GelE⁺ > GelE⁻ is loss of gelatinase activity. Hly is cytolysin activity. efaAfm⁺efaAfs⁺ indicate that a signal was obtained with efaA E. faecium- and E. faecalis-specific probes, respectively. Parentheses indicate that a weak signal was obtained under standard-stringency conditions. cpd⁺, cob⁺, ccf⁺, and cad⁺ indicate the presence of the corresponding pheromone-encoding genes.

Generation of primers and probes.

PCR primers for the efaA, gelE, cyl, and agg virulence genes described in Table 2 were designed on the basis of published sequences and EMBL database sequences. PCR primers for esp were originally developed on the basis of primer sequences supplied by V. Shankar (University of Oklahoma), and those for sex pheromone determinants were based on sequences in the E. faecalis genome database at The Institute for Genomic Research. A degenerate primer was designed for the cAD1 sex pheromone determinant on the basis of the amino acid sequence and enterococcal codon bias. The Wisconsin Genetics Computer Group sequence analysis software package, version 8, was used for sequence analysis and comparisons. Multiple-sequence alignments using sex pheromone plasmids pAD1, pPD1, and pCF10 were performed, and regions of high conservation were used to generate primers for aggregation substance (agg). Strain P4 containing pAD1 was used to generate the agg-specific probe. No suitable primers were produced for the structural cytolysin genes (cylL_L and cylL_S) due to the extensive sequence homology between the two genes. All PCR-generated fragments were cloned into pGEM-T vectors and sequenced to confirm identity (data not shown). The target DNA fragments amplified by PCR served as the DNA probes for Southern hybridization experiments.

Production of gelatinase and hemolysin.

Production of gelatinase was determined on Todd-Hewitt agar containing 30 g of gelatin (Difco) per liter. Single colonies were streaked onto plates, grown overnight at 37°C, and placed at 4°C for 5 h before examination for zones of turbidity around the colonies, indicating hydrolysis. For investigation of hemolysin production, strains were streaked onto layered fresh horse blood agar plates and grown for 1 to 2 days at 37°C. Zones of clearing around colonies indicated hemolysin production (Table 4).

Generation of transconjugants.

Broth matings were carried out by the method of Clewell et al. (8) using overnight cultures and overnight matings. Filter matings were performed using a 1:1 donor-recipient mixture. Briefly, 0.5 ml of each overnight culture was mixed and harvested using 0.45 μm-pore-size filters and incubated on BHI agar plates at 37°C overnight. Cells were harvested and diluted in BHI broth and grown for 2 days at 37°C on BHI agar plates.

For selection of transconjugants, it was necessary to identify suitable phenotypes for both the transmissible plasmid and the recipient strains. E. faecalis DS16 plasmid pAD2 carries an erythromycin resistance transposon (Tn917) that is known to transpose at high frequency onto the pAD1 plasmid, and this phenomenon was used to provide positive selection for the presence of pAD1, based on erythromycin resistance. E. faecalis F41 was found to be naturally resistant to rifampin and fusidic acid, and this provided counterselective markers for direct selection of pAD1 transfer from E. faecalis DS16. Filter mating was used to obtain transconjugants (Table 1).

No counterselective phenotypes were identified in the other starter strains, and thus, pAD1 was transferred, using broth mating, into a new background strain based on laboratory strain E. faecalis FA2-2. This provided a new strain, F19530, that was sensitive to tetracycline and carried the transmissible virulence plasmid pAD1 marked with the erythromycin resistance gene of Tn917. From this donor strain, it was possible to introduce pAD1 into E. faecalis F27 by filter mating.

E. faecalis FI9530 was used directly in matings with starter strain E. faecium F12 using lacZ selection. E. faecalis FI9530 is white on X-Gal–BHI agar plates, whereas the E. faecium starter strains are blue.

RESULTS

Three different groups of enterococcal isolates were screened for the presence of characterized virulence determinants. These groups were intentionally added starter strains, strains found to occur naturally in food, and strains isolated from human clinical infections.

Distribution of virulence determinants in food and medical isolates.

PCR amplifications and Southern hybridizations of enterococcal DNA with the specific primers and probes for each gene described (Tables 2 and 4) revealed distinct trends in the occurrence of virulence determinants in the food and medical strains. A summary of the pattern of virulence gene incidence in E. faecalis and E. faecium strains in the three groups is presented in Table 5.

TABLE 5.

Percent incidence of virulence determinants efaA (efaAfs and/or efaAfm), gelE, agg, cylM, cylB, cylA, esp, cpd, cob, ccf, and cad among food and medical isolates of E. faecalis and E. faecium

Category and organism	% Incidence of Determinant^a
Category and organism	efaA	gelE	agg	cylM	cylB	cylA	esp	cpd^b
Starter
E. faecalis	100	50 (0)	100	0 (0)	0	0	0	100
E. faecium	100	0 (0)	0	0 (0)	0	0	0	0
Food
E. faecalis	89	78 (56)	67	44 (44)	44	44	33	100
E. faecium	82	0 (0)	0	0 (0)	0	0	0	0
Medical
E. faecalis	100	89 (56–33)	78	56 (33)	56	44	44	100
E. faecium	100	11 (0)	0	0 (0)	0	0	78	0

Open in a new tab

Values in parentheses are phenotypic frequencies of gelatinase and hemolytic activity.

Values for cpd, cob, ccf, and cad are identical.

(i) E. faecalis.

E. faecalis strains harbor significantly more virulence determinants than do E. faecium strains, and a distinct trend occurs within the three groups. All of the E. faecalis strains tested, including the two starter strains, possessed multiple virulence determinants (between 6 and 11). Three E. faecalis strains (two medical strains and one food strain) possessed all of the virulence genes. The sex pheromone determinants were detected exclusively in the E. faecalis strains. They occurred in all of the strains tested, sometimes with and sometimes without the agg determinant. The agg virulence determinant was always associated with the presence of pheromone determinants. No other pairs of determinants occurred together exclusively. The majority of strains (>89%) possessed the efaAfs determinant. For the gelE, cylMBA, and esp determinants, a distinct trend was evident. Starter strains had fewer virulence determinants than did food strains (10 Versus 49%), which, in turn, had fewer than medical strains (58%).

(ii) E. faecium and E. durans.

A significantly different pattern was seen in the E. faecium strains. All of the strains were clear of the agg, cylMBA, and sex pheromone determinants. All of the E. faecium starter strains were clear of virulence determinants, except for efaAfm. For some food and medical E. faecium strains, weakly hybridizing bands were obtained under standard conditions which were absent under high-stringency conditions, using the efaAfs-specific probe. PCR amplification products were obtained using the efaAfs-specific primers for these strains. However, for E. faecium starter strains, no signal was obtained with the efaAfs probe in Southern hybridizations and no products were obtained using the efaAfs-specific primers. Of the three E. durans strains tested, starter strain F25 did not hybridize with either of the efaA probes or produce amplification products with the efaAfs-or efaAfm-specific primers. The E. durans F24 and F26 food strains produced the most strongly hybridizing bands with efaAfm-and efaAfs-specific probes, respectively (data not shown).

The gelE gene was identified in one E. faecium medical strain, P20, but no gelatinase activity could be detected in this strain (see below). Interestingly, the esp gene was identified at high frequency in medical strains (78%) and is exclusive to this group; the esp determinant was not found in any of the starter or food strains. This frequency is also considerably higher than that found in the E. faecalis strains.

Three strains (two of E. faecium and one of E. durans) did not harbor any of the virulence genes.

Silent genes are present in starter, food, and medical strains.

Silent gelE genes occurred in E. faecalis strains from all groups. Gelatinase activity could not be detected in E. faecalis F41, F1, F4, P21, P26, P31, and P36, although these strains carried the gelE gene. One silent gene was identified in an E. faecium strain, P20. In medical strains E. faecalis P14 and E. faecium P20, gelatinase activity was lost during subculture from the original stock and no gelatinase activity was detected. Two other medical strains. E. faecalis P21 and P36, appeared to have no hemolytic activity but carried cyl genes. A trend was observed in which starters had fewer silent genes than did food strains, which, in turn, had fewer than did medical strains.

Transfer of virulence plasmids from medical strains into food starter strains by conjugation.

Transfer of pAD1 into E. faecalis F41 by filter mating was achieved at a frequency of 2.1 × 10⁻⁶ per donor. Broth matings used to generate FI9530 allowed transfer of pAD1 into E. faecalis FA2-2 at a frequency of 3.6 × 10⁻⁵. From this donor, pAD1 was introduced into E. faecalis F27 by filter mating at a frequency of 5.7 × 10⁻³. E. faecalis FI9530 was used directly in matings with starter strain E. faecium F12 using lacZ selection. Several attempts at both broth and filter matings using various donor-recipient ratios (data not shown) did not result in the generation of any transconjugants.

DISCUSSION

Enterococci are known to cause serious disease in humans and are becoming a major and increasing problem in nosocomial infections due to the acquisition of antibiotic resistance determinants. Acquired antibiotic resistance, combined with natural resistance to several major classes of antibiotic and the natural resistance of these organisms to low pH, high salt concentrations, and high temperatures, contributes to their survival. Enterococci are found in foods as contaminants, and they are intentionally added to foods as starter cultures. Enterococci are opportunistic pathogens, and the immune status of the host is a factor in their ability to cause disease. Despite their significance, little is known about the enterococcal virulence mechanisms that contribute to pathogenesis; however, several factors have been implicated as potential virulence determinants. By using a DNA screening approach to compare the incidence of these virulence determinants in starter, food, and medical strains, we have identified distinct trends in the occurrence of these determinants.

E. faecalis and E. faecium strains show significantly different patterns in the incidence of virulence determinants. The E. faecalis strains tested all harbor multiple virulence determinants. The incidence is greater in medical strains than in food or starter strains. All E. faecium strains are generally clear of virulence determinants, but there are notable exceptions. In this study, although all of the E. faecium strains tested lacked the cylMBA and agg determinants, one medical strain had gelE and the majority of the E. faecium strains and the E. faecium medical strains had the efaAfm and esp determinants, respectively. This contrasts with other work in which gelE and esp were found exclusively in E. faecalis strains and not in any of the E. faecium strains tested (10, 35). Regional variation may account for these differences. Alternatively, the emergence of esp⁺ E. faecium strains capable of producing this novel cell wall protein may be related to the increasing occurrence of pathogenic E. faecium strains. Further work is in progress to investigate these possibilities.

An efaA determinant is found at similar frequencies in the E. faecalis and E. faecium strains and appears in all three groups. However, differing degrees of homology among efaA genes in the different enterococcal species were demonstrated in the Southern blots. The E. faecium starter strain efaA gene appears to be less similar than the E. faecium food or medical strain efaA gene to the E. faecalis efaA gene. This may indicate significant sequence divergence among the E. faecium starter strains. E. durans strains produced variable or no bands on Southern blots using the efaA probes. Assuming that E. durans contains efaA homologues, then this could indicate further sequence divergence. So far, only the efaAfs gene has been shown to influence pathogenicity in animal models (38). The role of efaAfm has not yet been demonstrated. Significant sequence variation in the E. faecium and E. durans strains may result in functional differences in the EfaA adhesin that affect pathogenicity. Alternatively, in these strains, other virulence factors may be required in conjunction with EfaA. PCR amplification products were obtained using the efaAfs-specific primers for some E. faecium food and medical strains. The sequence analysis of these fragments should be useful in discerning the presence of the adhesin in these strains.

Several strains, including a starter strain, contained apparently silent gelE and cyl determinants. In the case of E. faecalis P21, the lack of hemolytic activity is explained by the absence of cylA, which is required for activation of cylL_L/S. For the other strains, the lack of phenotypic activity may be explained by low levels or down regulation of gene expression or an inactive gene product. Environmental factors are known to influence gene expression (12), and conditions used for phenotypic testing are different from those found in the human body. Silent genes may also become activated by temporal factors, such as conditions found in the gastro-intestinal tract, the balance of organisms in the intestinal flora, and effects of bacterial synergism, as well as the presence and persistence of large numbers of viable enterococci. Recently, a pheromone-mediated quorum-sensing system has been described. (J. Nakayama, Y. Cao, A. D. L. Akkermans, W. M. DeVos, and H. Nagasawa, Abstr. 1st Int. ASM Conf. Enterococci: Pathog. Biol. Antibiot. Resist. abstr. 21, p. 30). In this system, the gelE gene is part of the same operon as the pheromone-responsive histidine kinase genes. Expression of gelE is triggered in late exponential phase, at high cell densities, when this may be an advantage. There was a higher incidence of silent genes in the medical strains than in the food and starter strains. This would correlate with a higher potential for pathogenic effects in these strains. Thus, the presence of apparently silent genes in both food and starter strains is relevant to their safe use in foods.

Until recently, the majority of infection-derived isolates were E. faecalis strains and it is therefore regarded as the most pathogenic enterococcal species. The role of a number of virulence factors in pathogenesis, including gelE, esp, and originally efaA, was supported by the fact that these determinants were only found in E. faecalis strains. In this study, the majority of characterized virulence determinants were found in E. faecalis strains, providing further supporting evidence for their role in pathogenesis. However, the incidence of E. faecium-derived infections is increasing (B. Murray, Abstr. 1st Int. ASM Conf. Enterococci: Pathog. Biol. Antibiot. Resist. abstr. 516, p. 16). E. faecium strains containing these virulence determinants may be involved in the evolution of pathogenic E. faecium strains.

Enterococci possess highly effective gene transfer mechanisms, including conjugation and conjugative transposition. Virulence genes are known to be associated with some highly transmissible plasmids. Thus, there is a risk that a safe strain that lacks genes for known virulence factors could acquire such genes by conjugation. In the context of starter and probiotic strains, it is possible that very large numbers of viable bacteria might be consumed. This would provide a large recipient population into which transmissible plasmids carrying virulence genes might spread. The possibility of such an event was investigated using starter strains E. faecium F12 and E. faecalis F27 and F41. The potential for transfer of virulence genes into the starter strains was tested using the pheromone-inducible conjugation system of E. faecalis DS16.

Transfer of virulence determinants from E. faecalis DS16 via sex pheromone plasmid pAD1 into the E. faecalis starter strains was achieved at frequencies similar to those obtained in broth matings using plasmid-free recipient strains (40). Thus, it was possible to demonstrate that starter strains can acquire known virulence genes by the natural-conjugation gene transfer process. It will be interesting to determine whether the acquisition of pAD1 by E. faecalis strains F27 and F41 increases their virulence. Animal challenge tests to address this question are being planned.

The process of conjugation used by plasmids, such as pAD1, is highly evolved and involves a sophisticated signaling process. Potential recipient strains secrete small peptide signal molecules, known as sex pheromones. These pheromones induce genes leading to the production of aggregation substance in potential donor cells, resulting in a cell clumping phenotype. This process enhances the transfer frequency of the sex pheromone plasmid into plasmid-free recipient cells. Each sex pheromone plasmid responds specifically to a corresponding sex pheromone determinant. The pAD1 sex pheromone plasmid is found exclusively in E. faecalis strains (6) and responds specifically to the cAD1 sex pheromone. E. faecium F12 does not contain the cad sex pheromone determinant, and so, filter matings were used in an attempt to enhance the transfer frequency in the absence of induced cell clumping. Despite repeated attempts to transfer pAD1 into the E. faecium F12 starter strain via matings with E. faecalis FI9530, no transfer was achieved.

The cpd, cob, ccf, and cad sex pheromone determinants were found in all of the E. faecalis strains tested. In some of these strains, the agg gene was also present. This situation corresponds to recipient strains that have acquired a sex pheromone plasmid. The strains with the sex pheromone determinants have the potential to acquire the respective sex pheromone plasmids and, hence, the associated virulence determinants. In this study, all of the E. faecalis food strains tested had the ability to acquire several sex pheromone plasmids. For E. faecium, the lack of sex pheromone genes may reflect sequence divergence rather than the absence of gene transfer pheromones. Indeed, sex pheromone cross talk between E. faecium and E. faecalis has been established (18).

Enterococcus gene transfer and pheromone-responsive systems are especially relevant to the problems associated with acquired glycopeptide resistance. Acquired glycopeptide resistance is associated mostly with the VanA phenotype and is located on large conjugative plasmids. Some VanA conjugative plasmids are also pheromone responsive (30). Glycopeptide-resistant enterococci have become a major health problem in intensive care units in Europe and the United States; where these antibiotics are used as reserve antibiotics against multiresistant gram-positive pathogens. Heaton et al. (18) showed that a clinical isolate of E. faecium contained a conjugative plasmid highly related to pCF10 from E. faecalis. This plasmid conferred high-level vancomycin resistance that could be transferred by conjugation to plasmid-free E. faecalis recipients. The linked virulence determinants agg and cyl may be cotransferred and will be selected for by antibiotic resistance. In addition, the presence of agg in these strains may lead to increased colonization ability. Thus, sex pheromone production by E. faecalis food strains may promote the acquisition of vancomycin resistance and other linked traits from E. faecium strains and lead to increased virulence.

In conclusion, we have identified patterns in the presence of both expressed and silent virulence genes in starter, food, and medical enterococcal strains. The presence of these virulence determinants in E. faecium strains may be significant in the evolution of pathogenic E. faecium strains. In addition, the transfer of virulence determinants to starter strains via natural conjugation mechanisms has been demonstrated. These results reinforce the concern expressed elsewhere about the safety of enterococcal strains used in foods. In particular, the introduction of food products or probiotics based on the use of new enterococcal strains merits careful premarket safety evaluation.

ACKNOWLEDGMENTS

This work was supported by MAFF-funded project FS0219.

We thank Wolfgang Hunger, Manuel Nunez, Frank Aarestrup, Antony Smith, Don Clewell, Polly Kaufmann, and Hazel Aucken for supplying many of the strains used in this study.

REFERENCES

1.Aguirre M, Collins M D. Lactic acid bacteria and human clinical infection. J Appl Bacteriol. 1993;75:95–107. doi: 10.1111/j.1365-2672.1993.tb02753.x. [DOI] [PubMed] [Google Scholar]
2.Bellomo G, Mangiagle A, Nicastro L, Frigerio L. A controlled double-blind study of SF68 strain as a new biological preparation for the treatment of diarrhoea in paediatrics. Curr Ther Res. 1980;28:927–934. [Google Scholar]
3.Centeno J A, Menendez S, Rodriguez-Otero J L. Main microbial flora present in natural starters in Cebreiro raw cow's-milk cheese, Northwest Spain. Int J Food Microbiol. 1996;33:307–313. doi: 10.1016/0168-1605(96)01165-8. [DOI] [PubMed] [Google Scholar]
4.Chow J W, Thai L A, Peri M B, Vazquez J A, Donabedian S M, Clewell D B, Zervos M Z. Plasmid-associated hemolysin and aggregation substance production contribute to virulence in experimental enterococcal endocarditis. Antimicrob Agents Chemother. 1994;37:2474–2477. doi: 10.1128/aac.37.11.2474. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Clewell D B. Movable genetic elements and antibiotic resistance in enterococci. Eur J Microbiol Infect Dis. 1990;9:90–102. doi: 10.1007/BF01963632. [DOI] [PubMed] [Google Scholar]
6.Clewell D B. Bacterial sex pheromone-induced plasmid transfer. Cell. 1993;73:9–12. doi: 10.1016/0092-8674(93)90153-h. [DOI] [PubMed] [Google Scholar]
7.Clewell D B, An F Y, Flannagan S E, Antiporta M, Dunny G M. Enterococcal sex pheromone precursors are part of signal sequences for surface lipoproteins. Mol Microbiol. 2000;35:246–247. doi: 10.1046/j.1365-2958.2000.01687.x. [DOI] [PubMed] [Google Scholar]
8.Clewell D B, An F Y, White B A, Gawron-Burke C. Streptococcus faecalis sex pheromone (cAM373) also produced by Staphylococcus aureus and identification of a conjugative transposon (Tn918) J Bacteriol. 1985;162:1212–1220. doi: 10.1128/jb.162.3.1212-1220.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Clewell D B, Tomich P K, Gawron-Burke M C, Franke A E, Yagi Y, An F Y. Mapping of Streptococcus faecalis plasmids pAD1 and pAD2 and studies relating to transposition of Tn917. J Bacteriol. 1982;152:1220–1230. doi: 10.1128/jb.152.3.1220-1230.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Coque T M, Patterson J E, Steckelberg J M, Murray B E. Incidence of hemolysin, gelatinase and aggregation substance among enterococci isolated from patients with endocarditis and other infections and from feces of hospitalised and community-based persons. J Infect Dis. 1995;171:1223–1229. doi: 10.1093/infdis/171.5.1223. [DOI] [PubMed] [Google Scholar]
11.Ember J A, Hugli T E. Characterisation of the human neutrophil response to sex pheromones from Streptococcus faecalis. Am J Pathol. 1989;134:797–805. [PMC free article] [PubMed] [Google Scholar]
12.Finlay B B, Falkow S. Common themes in bacterial pathogenesis revisited. Microbiol Mol Rev. 1997;61:136–169. doi: 10.1128/mmbr.61.2.136-169.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Franz C M A P, Holzapfel W H, Stiles M E. Enterococci at the crossroads of food safety. Int J Food Microbiol. 1999;47:1–24. doi: 10.1016/s0168-1605(99)00007-0. [DOI] [PubMed] [Google Scholar]
14.Galli D, Lottspeich F, Wirth R. Sequence analysis of Enterococcus faecalis aggregation substance encoded by the sex pheromone plasmid pAD1. Mol Microbiol. 1990;4:895–904. doi: 10.1111/j.1365-2958.1990.tb00662.x. [DOI] [PubMed] [Google Scholar]
15.Gasser F. Safety of lactic acid bacteria and their occurrence in human clinical infections. Bull Inst Pasteur. 1994;92:45–67. [Google Scholar]
16.Gilmore M S, Segarra R A, Booth M C, Bogie C P, Hall L R, Clewell D B. Genetic structure of the Enterococcus faecalis plasmid pAD1-encoded cytolytic toxin system and its relationship to lantibiotic determinants. J Bacteriol. 1994;176:7335–7344. doi: 10.1128/jb.176.23.7335-7344.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Giraffa G. Enterococcal bacteriocins: their potential as anti-Listeria factors in dairy technology. Food Microbiol. 1995;12:291–299. [Google Scholar]
18.Heaton M P, Discotto L F, Pucci M J, Handwerger S. Mobilization of vancomycin resistance by transposon-mediated fusion of a VanA plasmid with an Enterococcus faecium sex pheromone-response plasmid. Gene. 1996;171:9–17. doi: 10.1016/0378-1119(96)00022-4. [DOI] [PubMed] [Google Scholar]
19.Huycke M M, Gilmore M S, Jett B D, Booth J L. Transfer of pheromone-inducible plasmids between Enterococcus faecalis in the Syrian-hamster gastro-intestinal tract. J Infect Dis. 1992;166:1188–1191. doi: 10.1093/infdis/166.5.1188. [DOI] [PubMed] [Google Scholar]
20.Ike Y, Craig R C, White B A, Yagi Y, Clewell D B. Modification of Streptococcus faecalis sex pheromones after acquisition of plasmid DNA. Proc Natl Acad Sci USA. 1983;80:5369–5373. doi: 10.1073/pnas.80.17.5369. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Ike Y, Hashimoto H, Clewell D B. High incidence of hemolysin production by Enterococcus (Streptococcus) faecalis strains associated with human parenteral infections. J Clin Microbiol. 1987;25:1524–1528. doi: 10.1128/jcm.25.8.1524-1528.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Jett B D, Huycke M M, Gilmore M S. Virulence of enterococci. Clin Microbiol Rev. 1994;7:462–478. doi: 10.1128/cmr.7.4.462. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Jett B D, Jensen H G, Nordquist R E, Gilmore M S. Contribution of the pAD1-encoded cytolysin to the severity of experimental Enterococcus faecalis endophthalmitis. Infect Immun. 1992;60:2445–2452. doi: 10.1128/iai.60.6.2445-2452.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Johnson A P. The pathogenicity of enterococci. J Antimicrob Chemother. 1994;33:1083–1089. doi: 10.1093/jac/33.6.1083. [DOI] [PubMed] [Google Scholar]
25.Kreft B, Marre R, Schramm U, Wirth R. Aggregation substance of Enterococcus faecalis adhesion to cultured renal tubular cells. Infect Immun. 1992;60:25–30. doi: 10.1128/iai.60.1.25-30.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Lennox E S. Transduction of linked characters of the host bacteriophage P1. Virology. 1955;1:190–200. doi: 10.1016/0042-6822(55)90016-7. [DOI] [PubMed] [Google Scholar]
27.Lewenstein A, Frigero G, Moroni M. Biological properties of SF68, a new approach to the treatment of diarrhoeal diseases. Curr Ther Res. 1979;26:967–981. [Google Scholar]
28.Lewington J, Greenaway S D, Spillane B J. Rapid small scale preparation of bacterial genomic DNA suitable for cloning and hybridisation analysis. Lett Appl Microbiol. 1987;5:51–53. [Google Scholar]
29.Lowe A M, Lambert P A, Smith A W. Cloning of an Enterococcus faecalis endocarditis antigen: homology with adhesins from some oral streptococci. Infect Immun. 1995;63:703–706. doi: 10.1128/iai.63.2.703-706.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Noble W C, Virani Z, Cree R G A. Co-transfer of vancomycin and other resistance genes from Enterococcus faecalis NCTC 12201 to Staphylococcus aureus. FEMS Microbiol Lett. 1992;93:195–198. doi: 10.1016/0378-1097(92)90528-v. [DOI] [PubMed] [Google Scholar]
31.Olmsted S B, Dunny G M, Erlandsen S L, Wells C L. A plasmid-encoded surface protein on Enterococcus faecalis augments its internalisation by cultured intestinal epithelial cells. J Infect Dis. 1994;170:1549–1556. doi: 10.1093/infdis/170.6.1549. [DOI] [PubMed] [Google Scholar]
32.Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
33.Sannomiya P A, Craig R A, Clewell D B, Suzuki A, Fujino M, Till G O, Marasco W A. Characterisation of a class of nonformylated Enterococcus faecalis-derived neutrophil chemotactic peptides. The sex pheromones. Proc Natl Acad Sci USA. 1990;87:66–70. doi: 10.1073/pnas.87.1.66. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Schlievert P M, Gahr P J, Assimacopoulos A P, Dinges M M, Stoehr J A, Harmala J W, Hirt H, Dunny G M. Aggregation and binding substance enhance pathogenicity in rabbit models of Enterococcus faecalis endocarditis. Infect Immun. 1998;66:218–223. doi: 10.1128/iai.66.1.218-223.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Shankar V, Baghdayan A S, Huycke M M, Lindahl G, Gilmore M S. Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein. Infect Immun. 1999;67:193–200. doi: 10.1128/iai.67.1.193-200.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Shankar V, Gilmore M S. Characterisation of the Enterococcus faecalis alpha C protein homolog—evidence for the expression of alternate forms in commensals and infection derived isolates. Adv Exp Med Biol. 1997;418:1045–1048. [PubMed] [Google Scholar]
37.Simjee S, Gill M J. Gene transfer, gentamycin resistance and enterococci. J Hosp Infect. 1997;36:249–259. doi: 10.1016/s0195-6701(97)90051-7. [DOI] [PubMed] [Google Scholar]
38.Singh K V, Coque T M, Weinstock G M, Murray B E. In vivo testing of an Enterococcus faecalis efaA mutant and use of efaA homologs for species identification. FEMS Immunol Med Microbiol. 1998;21:323–331. doi: 10.1111/j.1574-695X.1998.tb01180.x. [DOI] [PubMed] [Google Scholar]
39.Su Y A, Sulavik M C, He P, Makinen K K, Makinen P-L, Fiedler S, Wirth R, Clewell D B. Nucleotide sequence of the gelatinase gene (gelE) from Enterococcus faecalis subsp. liquefaciens. Infect Immun. 1991;59:415–420. doi: 10.1128/iai.59.1.415-420.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Tomich P K, An F Y, Damle S P, Clewell D B. Plasmid-related transmissibility and multiple drug resistance in Streptococcus faecalis subsp. zymogenes strain DS16. Antimicrob Agents Chemother. 1979;15:828–830. doi: 10.1128/aac.15.6.828. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Trovatelli L D, Schiesser A. Identification and significance of enterococci in hard cheese made from raw cow and sheep milk. Milchwissenschaft. 1987;42:717–719. [Google Scholar]
42.Wessels D, Jooste P J, Mostert J F. Technologically important characteristics of Enterococcus isolates from milk and dairy products. Int J Food Microbiol. 1990;10:349–352. doi: 10.1016/0168-1605(90)90082-g. [DOI] [PubMed] [Google Scholar]
43.Wirth R. The sex pheromone system of Enterococcus faecalis—more than just a plasmid-collection mechanism. Eur J Biochem. 1994;222:235–246. doi: 10.1111/j.1432-1033.1994.tb18862.x. [DOI] [PubMed] [Google Scholar]
44.Yagi Y, Kessier R E, Shaw J H, Lopatin D E, An F, Clewell D B. Plasmid content of Streptococcus faecalis strain 39-5 and identification of pheromone (cPD1)-induced surface antigen. J Gen Microbiol. 1983;129:1207–1215. doi: 10.1099/00221287-129-4-1207. [DOI] [PubMed] [Google Scholar]

[B1] 1.Aguirre M, Collins M D. Lactic acid bacteria and human clinical infection. J Appl Bacteriol. 1993;75:95–107. doi: 10.1111/j.1365-2672.1993.tb02753.x. [DOI] [PubMed] [Google Scholar]

[B2] 2.Bellomo G, Mangiagle A, Nicastro L, Frigerio L. A controlled double-blind study of SF68 strain as a new biological preparation for the treatment of diarrhoea in paediatrics. Curr Ther Res. 1980;28:927–934. [Google Scholar]

[B3] 3.Centeno J A, Menendez S, Rodriguez-Otero J L. Main microbial flora present in natural starters in Cebreiro raw cow's-milk cheese, Northwest Spain. Int J Food Microbiol. 1996;33:307–313. doi: 10.1016/0168-1605(96)01165-8. [DOI] [PubMed] [Google Scholar]

[B4] 4.Chow J W, Thai L A, Peri M B, Vazquez J A, Donabedian S M, Clewell D B, Zervos M Z. Plasmid-associated hemolysin and aggregation substance production contribute to virulence in experimental enterococcal endocarditis. Antimicrob Agents Chemother. 1994;37:2474–2477. doi: 10.1128/aac.37.11.2474. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B5] 5.Clewell D B. Movable genetic elements and antibiotic resistance in enterococci. Eur J Microbiol Infect Dis. 1990;9:90–102. doi: 10.1007/BF01963632. [DOI] [PubMed] [Google Scholar]

[B6] 6.Clewell D B. Bacterial sex pheromone-induced plasmid transfer. Cell. 1993;73:9–12. doi: 10.1016/0092-8674(93)90153-h. [DOI] [PubMed] [Google Scholar]

[B7] 7.Clewell D B, An F Y, Flannagan S E, Antiporta M, Dunny G M. Enterococcal sex pheromone precursors are part of signal sequences for surface lipoproteins. Mol Microbiol. 2000;35:246–247. doi: 10.1046/j.1365-2958.2000.01687.x. [DOI] [PubMed] [Google Scholar]

[B8] 8.Clewell D B, An F Y, White B A, Gawron-Burke C. Streptococcus faecalis sex pheromone (cAM373) also produced by Staphylococcus aureus and identification of a conjugative transposon (Tn918) J Bacteriol. 1985;162:1212–1220. doi: 10.1128/jb.162.3.1212-1220.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] 9.Clewell D B, Tomich P K, Gawron-Burke M C, Franke A E, Yagi Y, An F Y. Mapping of Streptococcus faecalis plasmids pAD1 and pAD2 and studies relating to transposition of Tn917. J Bacteriol. 1982;152:1220–1230. doi: 10.1128/jb.152.3.1220-1230.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] 10.Coque T M, Patterson J E, Steckelberg J M, Murray B E. Incidence of hemolysin, gelatinase and aggregation substance among enterococci isolated from patients with endocarditis and other infections and from feces of hospitalised and community-based persons. J Infect Dis. 1995;171:1223–1229. doi: 10.1093/infdis/171.5.1223. [DOI] [PubMed] [Google Scholar]

[B11] 11.Ember J A, Hugli T E. Characterisation of the human neutrophil response to sex pheromones from Streptococcus faecalis. Am J Pathol. 1989;134:797–805. [PMC free article] [PubMed] [Google Scholar]

[B12] 12.Finlay B B, Falkow S. Common themes in bacterial pathogenesis revisited. Microbiol Mol Rev. 1997;61:136–169. doi: 10.1128/mmbr.61.2.136-169.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13.Franz C M A P, Holzapfel W H, Stiles M E. Enterococci at the crossroads of food safety. Int J Food Microbiol. 1999;47:1–24. doi: 10.1016/s0168-1605(99)00007-0. [DOI] [PubMed] [Google Scholar]

[B14] 14.Galli D, Lottspeich F, Wirth R. Sequence analysis of Enterococcus faecalis aggregation substance encoded by the sex pheromone plasmid pAD1. Mol Microbiol. 1990;4:895–904. doi: 10.1111/j.1365-2958.1990.tb00662.x. [DOI] [PubMed] [Google Scholar]

[B15] 15.Gasser F. Safety of lactic acid bacteria and their occurrence in human clinical infections. Bull Inst Pasteur. 1994;92:45–67. [Google Scholar]

[B16] 16.Gilmore M S, Segarra R A, Booth M C, Bogie C P, Hall L R, Clewell D B. Genetic structure of the Enterococcus faecalis plasmid pAD1-encoded cytolytic toxin system and its relationship to lantibiotic determinants. J Bacteriol. 1994;176:7335–7344. doi: 10.1128/jb.176.23.7335-7344.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] 17.Giraffa G. Enterococcal bacteriocins: their potential as anti-Listeria factors in dairy technology. Food Microbiol. 1995;12:291–299. [Google Scholar]

[B18] 18.Heaton M P, Discotto L F, Pucci M J, Handwerger S. Mobilization of vancomycin resistance by transposon-mediated fusion of a VanA plasmid with an Enterococcus faecium sex pheromone-response plasmid. Gene. 1996;171:9–17. doi: 10.1016/0378-1119(96)00022-4. [DOI] [PubMed] [Google Scholar]

[B19] 19.Huycke M M, Gilmore M S, Jett B D, Booth J L. Transfer of pheromone-inducible plasmids between Enterococcus faecalis in the Syrian-hamster gastro-intestinal tract. J Infect Dis. 1992;166:1188–1191. doi: 10.1093/infdis/166.5.1188. [DOI] [PubMed] [Google Scholar]

[B20] 20.Ike Y, Craig R C, White B A, Yagi Y, Clewell D B. Modification of Streptococcus faecalis sex pheromones after acquisition of plasmid DNA. Proc Natl Acad Sci USA. 1983;80:5369–5373. doi: 10.1073/pnas.80.17.5369. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B21] 21.Ike Y, Hashimoto H, Clewell D B. High incidence of hemolysin production by Enterococcus (Streptococcus) faecalis strains associated with human parenteral infections. J Clin Microbiol. 1987;25:1524–1528. doi: 10.1128/jcm.25.8.1524-1528.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B22] 22.Jett B D, Huycke M M, Gilmore M S. Virulence of enterococci. Clin Microbiol Rev. 1994;7:462–478. doi: 10.1128/cmr.7.4.462. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23.Jett B D, Jensen H G, Nordquist R E, Gilmore M S. Contribution of the pAD1-encoded cytolysin to the severity of experimental Enterococcus faecalis endophthalmitis. Infect Immun. 1992;60:2445–2452. doi: 10.1128/iai.60.6.2445-2452.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B24] 24.Johnson A P. The pathogenicity of enterococci. J Antimicrob Chemother. 1994;33:1083–1089. doi: 10.1093/jac/33.6.1083. [DOI] [PubMed] [Google Scholar]

[B25] 25.Kreft B, Marre R, Schramm U, Wirth R. Aggregation substance of Enterococcus faecalis adhesion to cultured renal tubular cells. Infect Immun. 1992;60:25–30. doi: 10.1128/iai.60.1.25-30.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 26.Lennox E S. Transduction of linked characters of the host bacteriophage P1. Virology. 1955;1:190–200. doi: 10.1016/0042-6822(55)90016-7. [DOI] [PubMed] [Google Scholar]

[B27] 27.Lewenstein A, Frigero G, Moroni M. Biological properties of SF68, a new approach to the treatment of diarrhoeal diseases. Curr Ther Res. 1979;26:967–981. [Google Scholar]

[B28] 28.Lewington J, Greenaway S D, Spillane B J. Rapid small scale preparation of bacterial genomic DNA suitable for cloning and hybridisation analysis. Lett Appl Microbiol. 1987;5:51–53. [Google Scholar]

[B29] 29.Lowe A M, Lambert P A, Smith A W. Cloning of an Enterococcus faecalis endocarditis antigen: homology with adhesins from some oral streptococci. Infect Immun. 1995;63:703–706. doi: 10.1128/iai.63.2.703-706.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B30] 30.Noble W C, Virani Z, Cree R G A. Co-transfer of vancomycin and other resistance genes from Enterococcus faecalis NCTC 12201 to Staphylococcus aureus. FEMS Microbiol Lett. 1992;93:195–198. doi: 10.1016/0378-1097(92)90528-v. [DOI] [PubMed] [Google Scholar]

[B31] 31.Olmsted S B, Dunny G M, Erlandsen S L, Wells C L. A plasmid-encoded surface protein on Enterococcus faecalis augments its internalisation by cultured intestinal epithelial cells. J Infect Dis. 1994;170:1549–1556. doi: 10.1093/infdis/170.6.1549. [DOI] [PubMed] [Google Scholar]

[B32] 32.Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]

[B33] 33.Sannomiya P A, Craig R A, Clewell D B, Suzuki A, Fujino M, Till G O, Marasco W A. Characterisation of a class of nonformylated Enterococcus faecalis-derived neutrophil chemotactic peptides. The sex pheromones. Proc Natl Acad Sci USA. 1990;87:66–70. doi: 10.1073/pnas.87.1.66. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34.Schlievert P M, Gahr P J, Assimacopoulos A P, Dinges M M, Stoehr J A, Harmala J W, Hirt H, Dunny G M. Aggregation and binding substance enhance pathogenicity in rabbit models of Enterococcus faecalis endocarditis. Infect Immun. 1998;66:218–223. doi: 10.1128/iai.66.1.218-223.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] 35.Shankar V, Baghdayan A S, Huycke M M, Lindahl G, Gilmore M S. Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein. Infect Immun. 1999;67:193–200. doi: 10.1128/iai.67.1.193-200.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B36] 36.Shankar V, Gilmore M S. Characterisation of the Enterococcus faecalis alpha C protein homolog—evidence for the expression of alternate forms in commensals and infection derived isolates. Adv Exp Med Biol. 1997;418:1045–1048. [PubMed] [Google Scholar]

[B37] 37.Simjee S, Gill M J. Gene transfer, gentamycin resistance and enterococci. J Hosp Infect. 1997;36:249–259. doi: 10.1016/s0195-6701(97)90051-7. [DOI] [PubMed] [Google Scholar]

[B38] 38.Singh K V, Coque T M, Weinstock G M, Murray B E. In vivo testing of an Enterococcus faecalis efaA mutant and use of efaA homologs for species identification. FEMS Immunol Med Microbiol. 1998;21:323–331. doi: 10.1111/j.1574-695X.1998.tb01180.x. [DOI] [PubMed] [Google Scholar]

[B39] 39.Su Y A, Sulavik M C, He P, Makinen K K, Makinen P-L, Fiedler S, Wirth R, Clewell D B. Nucleotide sequence of the gelatinase gene (gelE) from Enterococcus faecalis subsp. liquefaciens. Infect Immun. 1991;59:415–420. doi: 10.1128/iai.59.1.415-420.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] 40.Tomich P K, An F Y, Damle S P, Clewell D B. Plasmid-related transmissibility and multiple drug resistance in Streptococcus faecalis subsp. zymogenes strain DS16. Antimicrob Agents Chemother. 1979;15:828–830. doi: 10.1128/aac.15.6.828. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B41] 41.Trovatelli L D, Schiesser A. Identification and significance of enterococci in hard cheese made from raw cow and sheep milk. Milchwissenschaft. 1987;42:717–719. [Google Scholar]

[B42] 42.Wessels D, Jooste P J, Mostert J F. Technologically important characteristics of Enterococcus isolates from milk and dairy products. Int J Food Microbiol. 1990;10:349–352. doi: 10.1016/0168-1605(90)90082-g. [DOI] [PubMed] [Google Scholar]

[B43] 43.Wirth R. The sex pheromone system of Enterococcus faecalis—more than just a plasmid-collection mechanism. Eur J Biochem. 1994;222:235–246. doi: 10.1111/j.1432-1033.1994.tb18862.x. [DOI] [PubMed] [Google Scholar]

[B44] 44.Yagi Y, Kessier R E, Shaw J H, Lopatin D E, An F, Clewell D B. Plasmid content of Streptococcus faecalis strain 39-5 and identification of pheromone (cPD1)-induced surface antigen. J Gen Microbiol. 1983;129:1207–1215. doi: 10.1099/00221287-129-4-1207. [DOI] [PubMed] [Google Scholar]

PERMALINK

Molecular Screening of Enterococcus Virulence Determinants and Potential for Genetic Exchange between Food and Medical Isolates

Tracy J Eaton

Michael J Gasson

Abstract

TABLE 2.

MATERIALS AND METHODS

Bacterial strains and media.

TABLE 1.

Enterococcal isolates.

Isolation of enterococcal DNA.

DNA manipulations.

TABLE 3.

TABLE 4.

Generation of primers and probes.

Production of gelatinase and hemolysin.

Generation of transconjugants.

RESULTS

Distribution of virulence determinants in food and medical isolates.

TABLE 5.

(i) E. faecalis.

(ii) E. faecium and E. durans.

Silent genes are present in starter, food, and medical strains.

Transfer of virulence plasmids from medical strains into food starter strains by conjugation.

DISCUSSION

ACKNOWLEDGMENTS

REFERENCES

ACTIONS

PERMALINK

RESOURCES

Cite

Add to Collections

PERMALINK

Molecular Screening of Enterococcus Virulence Determinants and Potential for Genetic Exchange between Food and Medical Isolates

Tracy J Eaton

Michael J Gasson

Abstract

TABLE 2.

MATERIALS AND METHODS

Bacterial strains and media.

TABLE 1.

Enterococcal isolates.

Isolation of enterococcal DNA.

DNA manipulations.

TABLE 3.

TABLE 4.

Generation of primers and probes.

Production of gelatinase and hemolysin.

Generation of transconjugants.

RESULTS

Distribution of virulence determinants in food and medical isolates.

TABLE 5.

(i) E. faecalis.

(ii) E. faecium and E. durans.

Silent genes are present in starter, food, and medical strains.

Transfer of virulence plasmids from medical strains into food starter strains by conjugation.

DISCUSSION

ACKNOWLEDGMENTS

REFERENCES

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases