Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2022 Jul 20;12(9):183. doi: 10.1007/s13205-022-03242-y

Changes in physiological traits and expression of key genes involved in sugar signaling pathway in rice under high temperature stress

K Stephen 1, R Beena 1,✉, A G Kiran 2, S Shanija 1, R Saravanan 3
PMCID: PMC9300813  PMID: 35875179

Abstract

Efficient assimilate partitioning between the source and sink organs to achieve increased grain weight is coordinated by the sugar signaling mechanism. The expression of the genes involved in sugar signaling mainly hexokinases 2 (OsHXK2), Sucrose-nonfermentation1-related protein kinase1 (OsSnRK1), trehalose-6-phosphate synthase 1 (OsTPS1) and target of rapamycin (OsTOR) under high temperature stress was examined in tolerant (NL-44) and susceptible (Vandana) varieties of rice. The photosynthetic rate, stomatal conductance, water-use efficiency, photochemical efficiency (Fv/Fm), quantum yield (ϕPSII), pollen viability, spikelet fertility and 1000 grain weight were significantly higher in NL-44 compared to Vandana under stress. The difference in the gene expression levels in the vegetative and grain-filling phases as well as between the tolerant and susceptible varieties, revealed unique pathways of sugar signaling under heat stress. In the vegetative phase, the expression of OsTOR seems to be the difference between NL-44 and Vandana for their differed heat stress tolerance whereas, in the grain-filling phase, the difference between the varieties lay in the regulation of OsHXK2. The comparative changes in the expression levels between the genes under the varying conditions indicate the sugar status in the source and sink organs that are available for translocation or remobilization.

Keywords: Sugar signaling, Gene expression, Heat stress, Rice, NL-44, Vandana

Introduction

The effects of high temperature on crop performance have been well reviewed by several authors (Jagadish et al. 2015; Hassan et al. 2021) and its effects on the physiological and reproductive traits are well known for reducing the fertility leading to high losses in the yield of the plants (Wang et al. 2019; Lawas et al. 2018). Rice, being the staple crop for more than half the world, occupies major portion of the productive area in India (Mahajan et al. 2017; Rejeth et al. 2020). In this regard, it is imperative that we keep exploring the mechanisms that contribute to improving the performance of various rice varieties. One such mechanism that is important for the partitioning and accumulation of photo-assimilates in the grains is the sugar signaling mechanism. Sugars play a dual role in carbon metabolism as well as acting as signaling molecules that coordinate with stress and hormonal signals to modulate plant growth (Smeekens and Hellmann 2014; Sami et al. 2019). Sugar signals are increasingly recognized as coordinators for integrating the nutrient and metabolic status thereby causing the plant to adapt its cellular mechanisms (Sakr et al. 2018). The kinases and phosphatases involved in the sensing and transduction of these signals are crucial for understanding the pathways that are involved in (Lastdrager et al. 2014). However, we have a limited understanding of the molecular mechanisms underlying those feedback regulations. Addressing this research gap is critical because improving crop yield requires a better understanding of how plants coordinate source activity with sink demand. In higher plants, three classes of sugar sensors have been identified: target of rapamycin (TOR), hexokinase (HXK) and Snf1-related protein kinase 1 (SnRK1), in addition to the signaling metabolite trehalose-6-phospate (T6P).

The current study was conducted to understand the gene expression of a few genes that are known to be the major coordinators of sugar metabolism. Hexokinases (HXK) have a dual role in metabolism and signaling, acting as a glucose phosphorylating enzyme as well as a glucose sensor (Li and Sheen 2016). It has been implicated in regulating photosynthesis, transpiration and also as an indicator of sugar availability (Lugassi et al. 2015). Using sugar analogues, mutants and transgenic approaches, AtHXK1 was shown to trigger the glucose repression of photosynthesis and plant growth. Rice OsHXK5 and OsHXK6 were found to have a similar function to AtHXK1, indicating that this pathway is conserved among plants. Sucrose-nonfermentation1-related protein kinases (SnRK) have been well known to be involved in the starvation response under carbon limiting conditions occurring during various stresses (Lastdrager et al. 2014; Stephen et al. 2021). They down-regulate the genes involved in anabolic processes and activate the genes involved in degradation processes (Nunes et al. 2013). SnRK1 complex is a starvation sensor and usually acts antagonistically to TOR. SnRK1 is directly inhibited by trehalose 6-phosphate (T6P). Trehalose-6-phosphate (T6P) is an active signaling metabolite that is involved in the regulation of metabolism and stress-related genes. Production of T6P is catalyzed by trehalose-6-phosphate synthase (TPS) in the biosynthetic pathway of trehalose, a non-reducing disaccharide (Li et al. 2011). T6P is a sensing sugar which often acts as a proxy for sucrose levels. The T6P sugar signaling mechanism links sucrose availability to growth and development including resource allocation and yield formation in crops. Recently, it was shown that applications of T6P precursors in wheat and maize can lead to crop yield improvement and abiotic stress resilience (Paul et al. 2018, 2020). target of rapamycin (TOR) is a another regulatory kinase that has been reported to integrate diverse metabolic aspects related to nutrition, light, hormones and energy status of the plants (Fu et al. 2016; Smeekens and Hellmann 2014). TOR complex promotes plant development and growth under favorable conditions and is known for its major role in sink development and growth including seeds, meristems and roots. TOR over expression was previously shown to boost photosynthesis and yield in rice plants. Understanding how sugar signaling pathways respond to heat stress and what roles they play during the reproductive and grain filling phases are crucial for developing new rice varieties with improved heat tolerance that can fix more carbon and allocate more resources to the grains under heat stress. With this background, the present study focused on the change in gene expression pattern under high temperature condition in reported susceptible and tolerance varieties.

Materials and methods

Location

The research area is located at the College of Agriculture, Vellayani, which is present in the southern Indian state of Kerala (8.44° N, 76.99° E). The climate is typically humid tropical with average summer temperature reaching around 35 ℃ and the average winter temperatures about 20 ℃.

Planting materials

The experiment was conducted as a pot cultivation study. The pot size was 25 × 15 cm and each pot was filled with soil and farm yard manure in 2:1 ratio. The average weight of the pot after filling was about 6 kg. Rice varieties, Vandana and NERICA L-44 (New Rice for Africa—Lowland 44) were selected for the study. Vandana (developed by ICAR-National Rice Research Institute, Cuttack, Odisha) has been reported as heat susceptible variety (Prasanth et al. 2017) while NERICA L-44 (NL-44), an interspecific hybrid, was reported as a heat tolerant variety (Bahuguna et al. 2015; Ravikiran et al. 2020). The seedlings were raised in a nursery and transplanted to the pots after 18 days. The fertilizer dosage followed (100:60:40 kg ha−1 of N:P:K) was rationalized and supplied as per the Package of Practices of Kerala Agricultural University.

Crop growth conditions

The plants were grown as in lowland conditions, i.e., with standing water for most of the crop duration except for mid-season drainage at 40 and 60 days. Until maximum tillering stage, the plants were kept in normal environmental conditions with the average daytime temperature ranging around 30–32 ℃ and night temperature around 24–26 ℃. The stress treatment plants were moved to a high temperature polyhouse at the time of panicle initiation where the average temperature was around 42–43 ℃ during the day. The plants were kept in the high temperature conditions until their harvest (Fig. 1). Minimum relative humidity was very low under polyhouse conditions (Fig. 2).

Fig. 1.

Fig. 1

Open in a new tab

The weekly average of maximum and minimum temperatures recorded under ambient conditions as well as in the high temperature polyhouse

Fig. 2.

Fig. 2

Open in a new tab

The weekly average of relative humidity recorded in the ambient conditions as well as in the high temperature polyhouse condition

Parameters recorded

The growth and physiological parameters were recorded at the flowering stage. The plant height was measured from the base of the plant to the tip of the primary panicle. Tiller number, productive tiller number, days to flowering and time of anthesis was also measured. The pollen viability percentage was calculated by the iodine-potassium iodide method, where 1% iodine-potassium iodide solution was used to stain the pollen grains placed on a glass slide and observed under a microscope (Lx300, Labomed). The stained pollen grains were counted as viable. The pollen viability percentage was calculated by the formula: (Number of stained pollen grains/Total number of pollen grains) × 100. The cell membrane stability was measured according to the procedure given by Sairam et al. (1997). The membrane stability index (MSI) was calculated using the formula:

MSI=1-C1/C2×100

where C1 and C2 are the initial and final electrical conductance measured when leaf disks (100 mg) were heated in a water bath at 40 ℃ (30 min) and 100 ℃ (10 min.) respectively.

The photosynthetic rate, transpiration rate, stomatal conductance and leaf temperature were measured using the Infra-Red Gas Analyzer (LI-COR 6400XT, USA). The fluorescence based parameters such as Fv/Fm ratio, ϕPSII, and electron transport rate (ETR) were also measured. The Water-Use efficiency (WUE) was calculated by dividing the photosynthetic rate (A) with the transpiration rate (E). The length of the panicle was expressed in centimeters and the 1000 grain weight was expressed in grams. The spikelet fertility (SF) percentage was calculated using the formula:

SF%=Number of fertile spikelets/Total number of spikelets×100

.

Gene expression

The leaf samples were taken at the vegetative stage and the grain filling stage. Two biological replications and three technical replications were considered for studying the gene expression. The leaves were frozen in liquid nitrogen and the total RNA was isolated using trizol reagent (Hi-media). The RNA was converted to cDNA using the cDNA synthesis kit (Verso cDNA synthesis kit, Thermo Fisher Scientific). The qRT-PCR (Real-Time Quantitative Reverse Transcription Polymerase chain Reaction) was done on the BIO-RAD CFX™ Touch Real time detection system with SYBR Green Master mix (Origin Diagnostics & Research, India). The data on threshold cycle value (Cq) of four genes, viz., hexokinase (OsHXK2), Snf-1-related kinase (OsSnRK1), trehalose-6-phosphate synthase (OsTPS1) and target of rapamycin (OsTOR), were retrieved using BIO-RAD CFX Maestro 1.0 software. Actin (OsActin) was used as internal reference and non-template (without cDNA) kept as control. Sequence of gene primers was obtained from the literature (Cho et al. 2006; Li et al. 2011; Maegawa et al. 2015; Filipe et al. 2018) and confirmed by checking the available sequence from database. The gene primers used were given in Table 1.

Table 1.

List of primers used for qRT-PCR

Gene Forward primer Reverse primer
OsHXK2 5’-TATACTGGGAACAGGTACTAATGC-3’ 5’-CCATCTTTAATAGGACTCTACGAA-3’
OsSnRK1 5’ CGAATCACTTCACAAGAGACTG 3’ 5’ CTGGAGTTACTTGAGCGAGAG 3’
OsTPS1 5’ TTGAAGTTCGGTCTGTCG 3’ 5’ CTGCCTATCCAAGAACATG 3’
OsTOR 5’ CAAATCGTATGGGAGGAGCTA 3’ 5’ GCAGCCATAAGAAGTTTCTCCA 3’
OsActin 5’ CTCCCCCATGCTATCCTTCG 3’ 5’ TGAATGAGTAACCACGCTCCG 3’
Open in a new tab

The gene expression was calculated as relative fold change using the Livak’s method/2−δδCt method using the control condition as baseline. The gene expression of the control treatment was normalized to 1. A gene with relative fold change of less than 1 was considered to be down-regulated, whereas the fold change greater than 1 was considered to be up-regulated (Livak and Schmittgen 2001).

Statistical analysis

The statistical analysis was performed using the statistical package GRAPES 1.0.0 (Gopinath et al. 2021). All parameters were calculated by averaging the data of three replicates. The design adopted for the data analysis was completely randomized design (CRD). The means were separated using Tukey’s least significant difference (LSD) test at 0.05 levels. A 95% confidence level was considered to calculate the critical difference.

Results

Growth parameters

The mean height of NL-44 was 106.09 cm while Vandana variety had a higher mean height of 129.6 cm (Fig. 3). Both the varieties expressed significantly increased height under high temperature stress compared to control conditions. The tiller number was measured at the harvest stage. The number of tillers was significantly reduced in plants grown under the high temperature stress conditions. On average, Vandana variety characteristically produced almost twice the number of tillers (10.33) compared to NL-44 (5.66). Similar to the tiller number, the productive tiller number showed a decreasing trend under the stress conditions for both the varieties compared to the un-stressed plants. The cell membrane stability index under control conditions was 82.7% and 76.7% for NL-44 and Vandana, respectively. The MSI was significantly decreased in both the varieties; NL-44 recorded MSI of 65.93% and Vandana with 55.66% under stress (Fig. 3).

Fig. 3.

Fig. 3

Open in a new tab

Effect of high temperature on plant height (cm), tiller number, productive tiller number and cell membrane stability index (MSI) of NL-44 and Vandana at 0.05 levels of significance. The notations a,b,c,d represent the significance of the individual treatments in a decreasing order. The treatments with similar letters are stated to be on par

Characteristics of flowering

Under normal environmental conditions, Vandana variety expressed earlier flowering habit (54 days) compared to NL-44 (66 days) (Fig. 4). Under heat stressed conditions, the plants of both the varieties took more number of days to flowering. Under ambient temperature conditions, the time of anthesis for both Vandana and NL-44 started at 10:00 am (Table 2). The difference in the duration of anthesis which was two hours for NL-44, whereas it was only one hour for Vandana (Table 2). Under stress conditions, Vandana showed earlier anthesis time beginning at 9:30 am, continuing up to one hour. Contrastingly, NL-44 showed a delay in anthesis time beginning at 10:30 am; however, the duration of anthesis was comparatively reduced to one hour.

Fig. 4.

Fig. 4

Open in a new tab

Effect of high temperature on days to flowering and duration of anthesis (hours) on NL-44 and Vandana at 0.05 levels of significance. The notations a,b,c,d represent the significance of the individual treatments in a decreasing order. The treatments with similar letters are stated to be on par

Table 2.

The time of anthesis of NL-44 and Vandana under ambient and high temperature stress conditions

Variety Time of Anthesis
Control Stress
NL-44 10:00–12:00 AM 10:30–11:30 AM
Vandana 10:00–11:00 AM 9:30–10:30 AM
Open in a new tab

In Fig. 5, it can be observed that Vandana variety showed a greater decrease in pollen viability (− 30.23%) under high temperature conditions. The decrease under the same conditions was not so much in NL-44 which was only − 7.79%. The mean panicle length of NL-44 (27.66 cm) was greater than that of Vandana (25.63 cm). The difference in the panicle length between the stress and control plants of NL-44 was not significant; however, significant difference was observed between the plants of the two conditions of Vandana variety with lower panicle length (23.26 cm) recorded in the stressed plants.

Fig. 5.

Fig. 5

Open in a new tab

Effect of high temperature on pollen viability (%) and panicle length (cm) of NL-44 and Vandana at 0.05 levels of significance. The notations a,b,c,d represent the significance of the individual treatments in a decreasing order. The treatments with similar letters are stated to be on par

Gas exchange and fluorescence-related parameters

The photosynthetic rate of NL-44 (30.15 µmol cm−2 s−1) and Vandana (31.73 µmol cm−2 s−1) was found to be on par under un-stressed conditions, whereas they were significantly reduced under heat stress conditions with the least value recorded in Vandana (21.12 µmol cm−2 s−1). Vandana variety recorded the higher stomatal conductance (0.278 mol m−2 s−1) compared to NL-44 (0.201 mol m−2 s−1) under control conditions. Under higher temperatures, the two varieties exhibited significantly contrasting trends with Vandana recording a decrease (0.227 mol m−2 s−1) while NL-44 shows an increase (0.254 mol m−2 s−1) in stomatal conductance compared to their respective controls (Fig. 6).

Fig. 6.

Fig. 6

Open in a new tab

Effect of high temperature on photosynthetic rate (A) and stomatal conductance (Gs) of NL-44 and Vandana at 0.05 levels of significance. The notations a,b,c,d represent the significance of the individual treatments in a decreasing order. The treatments with similar letters are stated to be on par

Under ambient temperature, NL-44 had lower rate of transpiration (5.89 mmol m−2 s−1) compared to that of Vandana (7.82 mmol m−2 s−1) (Fig. 7). However, under heat stress conditions, significantly increased transpiration rate was recorded in NL-44 (6.74 mmol m−2 s−1) while there was a significant decrease in the rate of transpiration in Vandana (6.82 mmol m−2 s−1) in relation to their corresponding controls. The leaf temperature of the two varieties under ambient conditions was on par with a mean of 36.5 ℃. The leaf temperature was significantly decreased under stress treatment with a mean of 35 ℃ although the difference between the varieties was not significant (Crawford et al 2012). This is due to increased transpiration and enhanced leaf cooling capacity. Leaf cooling by transpiration was shown by NL-44 under high temperature condition. This may be due to more uptake of water under high temperature by NL-44.

Fig. 7.

Fig. 7

Open in a new tab

Effect of high temperature on transpiration rate (E) and leaf temperature of NL-44 and Vandana at 0.05 levels of significance. The notations a,b,c,d represent the significance of the individual treatments in a decreasing order. The treatments with similar letters are stated to be on par

The WUE of NL-44 was significantly higher compared to Vandana (5.11) under control conditions. The WUE of Vandana (3.09) and NL-44 (3.83) under stress were significantly lower compared to their corresponding non-stressed controls. The Fv/Fm ratio is used as an estimate of the maximal yield of photochemical efficiency. The Fv/Fm ratio of Vandana (0.763) was found to be significantly higher than NL-44 (0.688) under normal temperature conditions. The Fv/Fm ratio of NL-44 was significantly increased during high temperature (0.799). Contrastingly, there was nonsignificant decrease in the Fv/Fm ratio in Vandana (0.736) under stress (Fig. 8).

Fig. 8.

Fig. 8

Open in a new tab

Effect of high temperature on Water-Use Efficiency (WUE) and Fv/Fm ratio of NL-44 and Vandana at 0.05 levels of significance. The notations a,b,c,d represent the significance of the individual treatments in a decreasing order. The treatments with similar letters are stated to be on par

The effective quantum yield of Photosystem-II is denoted as ϕPSII. The ϕPSII of NL-44 (0.151) was significantly higher than Vandana (0.126) under ambient temperatures. The ϕPSII of both the varieties was decreased under increased temperature; however, the difference was not significant. The electron transport rate of NL-44 (99.05) was higher than Vandana (83.25) under un-stressed conditions. The ETR was significantly reduced under heat stress conditions for both the varieties (Fig. 9).

Fig. 9.

Fig. 9

Open in a new tab

Effect of high temperature on ϕPSII and electron transport rate of NL-44 and Vandana at 0.05 levels of significance. The notations a,b,c,d represent the significance of the individual treatments in a decreasing order. The treatments with similar letters are stated to be on par

Yield parameters

The spikelet fertility percentage was found to be highest in Vandana (90.63%) with NL-44 recording 85.73% under non-stressed conditions. The extreme stress condition that the plants were subjected to was evident in the drastic reduction in the spikelet fertility percentage with NL-44 recording 30.83% and the least spikelet fertility being observed in Vandana (11.73%). Under control conditions, the highest 1000 grain weight was recorded in NL-44 (24.16 g) while Vandana had a weight of 20.86 g. The reduction in the grain weight under the high temperature stress was not significant in the variety NL-44 (23.1 g). However, there was significant reduction in the 1000 grain weight of Vandana (18.67 g) under the stress conditions (Fig. 10).

Fig. 10.

Fig. 10

Open in a new tab

Effect of high temperature on spikelet fertility (%) and 1000 grain weight (g) of NL-44 and Vandana at 0.05 levels of significance. The notations a,b,c,d represent the significance of the individual treatments in a decreasing order. The treatments with similar letters are stated to be on par

Correlation analysis

Correlation analysis between the various morphological, physiological, gas exchange and yield related traits was conducted (Fig. 11). The data analyzed revealed that significant positive correlation for the 1000 grain weight with water use efficiency (WUE), electron transport rate (ETR), ϕPSII, pollen viability, days to flowering and panicle length. Strong positive correlation was also obtained at 0.001 level between spikelet fertility and pollen viability, photosynthetic rate, leaf temperature and membrane stability index, and at 0.01 level with WUE.

Fig.11.

Fig.11

Open in a new tab

The effect of high temperature is represented in a correlogram which shows the correlation of various morphological, physiological, biochemical, gas exchange and yield related parameters. The more solid the color and greater filling of the square indicates stronger correlation between the parameters

Gene expression

Vegetative phase The genes OsHXK2 and OsSnRK1 were up-regulated in both the varieties. Their expression levels were significantly higher in Vandana (28 & 7.31, respectively) compared to NL-44 (9.7 & 2.79). The expression of OsTPS1 was down-regulated in both the varieties. The gene expression of OsTOR was down-regulated in NL-44 (0.23) and up-regulated in Vandana (1.29) (Fig. 12).

Fig. 12.

Fig. 12

Open in a new tab

The expression levels of OsHXK2, OsSnRK1, OsTPS1 and OsTOR of NL-44 and Vandana during vegetative and grain-filling phases under high temperature stress relative to the control conditions. ANOVA analysis revealed significance at p ≤ 0.05 level between the two varieties for each gene. The notations a, b and c represent the degree of significance in a decreasing order. The treatments with similar letters are stated to be on par

Grain filling OsHXK2 gene was up-regulated in the variety NL-44 (1.06), whereas it was down-regulated in Vandana (0.44). The genes OsSnRK1, OsTPS1 and OsTOR were upregulated in both the varieties. The expression level of OsSnRK1 was on par in both Vandana (1.52) and NL-44 (1.5). The expression level of OsTPS1 in Vandana (3.3) was greater than in NL-44 (1.68); however, the reverse was true in case of OsTOR expression with Vandana (1.97) level lower than NL-44 (8.44).

Discussion

Effect of heat stress on growth

There was significant difference in growth characteristics under high temperature conditions compared to control. Plant height increased under high temperature in both the varieties. Poli et al. (2013) also reported that plant height was increased in plants subjected to heat stress. The increase in plant height may be due to increase in humidity in polyhouse condition (Beena et al. 2018a). There was significant reduction in both the tiller numbers and the productive tiller numbers under stress which had a cumulative effect on the reduction in the yield of the crop. The results correlate with Oh-e et al. (2007) who reported that the number of panicles was reduced when stress was given after the active tillering stage. The vegetative to reproductive transition of a tiller to produce a productive panicle is affected by stress as the transport of photo-assimilates from source to sink tissues is curtailed through modification in meristem identity genes (Wang et al. 2021). Fichtner et al. (2017) showed that trehalose-6-phosphate (T6P) triggers axillary bud outgrowth in garden pea by regulating sucrose levels. In their study, the increased T6P levels were correlated with increased amino acid synthesis. T6P is known to coordinate the carbon and nitrogen metabolic pathways to enhance growth. We can correlate this in our current investigation, where the down-regulation of OsTPS1 under stress is associated with the decrease in the number of tillers.

The decrease in MSI of Vandana was significantly higher than that of NL-44. Kumar et al. (2015) observed a decrease of 5–20% in the MSI both sensitive and tolerant genotypes under elevated temperatures. The decrease in MSI was attributed to higher levels of lipid peroxidation (MDA content) resulting in disruption of cell membrane leading to electrolyte leakage. Cell membranes are the frontier structures that perceive and transmit heat stress and therefore are prime targets for disruption of integrity (Vivitha et al. 2017; Beena et al. 2018b; Ali et al. 2021).

Effect of high temperature on the flowering characteristics

Under heat stressed conditions, both the varieties showed delayed flowering compared to control. Early flowering is the resultant of better accumulation of starch and faster rates of growth. The delayed flowering habit in the heat stressed plants can be attributed to the requirement of sufficient biomass for the plant to perceive the developmental signals to transition to the reproductive phase. In the vegetative-phase gene expression data, both the varieties showed down-regulation of OsTPS1 indicating low sucrose content which could be the probable cause for the delayed flowering. According to Quilichini (2019), target of rapamycin (TOR) regulates cell growth by controlling the rates of protein synthesis. Moreau et al. (2012) in their study, reported that over-expression of TOR resulted in early transition to flowering while mutants of TORC1 exhibited late onset of flowering. In this study, we note that expression of OsTOR was down-regulated in NL-44 and low in Vandana indicating an inversely proportional relationship between the date of flowering and their expression levels.

Several studies have clearly established the fact that varieties that have shown an earlier time of anthesis have higher levels of tolerance against heat stress as they can escape the higher temperatures during the latter part of the day (Julia and Dingkuhn 2012; Zhao et al. 2016). In this regard, Vandana showed an early anthesis time of half an hour. The NL-44 variety does not seem to follow the same mechanism as, under stress conditions, the flowering was delayed by half an hour rather than being advanced. However, it is to be noted that the duration of active anthesis was reduced to one hour under heat stress compared to 2 hours under control conditions. This could also be a stress adaptive mechanism as the plant can escape the heat stress by reducing the duration for which the anthers are exposed to heat stress.

Reduction in pollen viability percentage was 7.79% in NL-44 under high temperature compared to control. The failure of pollen to achieve viability is due to the impaired cell division of microspore mother cells (Takeoka et al. 1992). The anthers are highly sensitive to increased temperatures. The pollen of heat stressed anthers was found to be reduced in size with a wrinkled shape (Kumar et al. 2015). Accumulation of reactive oxygen species (ROS) and decrease in the accumulation of carbohydrates are the leading causes for the decrease in pollen viability (Santiago and Sharkey 2019). The decrease in pollen viability was greater in the sensitive variety, Vandana. The decrease in pollen fertility under heat stress in susceptible varieties has also been reported by Wang et al. (2019). The inability to metabolize the incoming sucrose was noted to be the reason for poor pollen development in plants expressing anti-sense SnRK1 (Zhang et al. 2001). According to Halford and Dickson (2001), the expression of SnRK1 is activated by low intracellular glucose. This is in line with our findings of high expression levels of OsSnRK1 indicating low glucose content resulting in impaired growth.

The panicle length of NL-44 under both treatment conditions was on a par, whereas a significant reduction in its length was observed in Vandana. Increased panicle length is a significant contributing character for the yield of the plant (Sun et al. 2016). Liu et al. (2016) reported an increase of 13.73% in yield correlated with an increase of 41.02% in the length of the panicle of NIL-LP1. The panicle length in combination with the number of spikelets and density modifies the panicle architecture determining the grain number per panicle. Higher expression of OsSnRK1 might be the reason for reduction in panicle length in the susceptible variety Vandana. Snf1-related kinases were activated under low glucose level which resulted in inhibition of growth and cell cycle-related processes by phosphorylating key metabolic enzymes (Halford et al. 2003).

Effect of heat stress on gas exchange and fluorescence-related parameters

The lower percentage of reduction in the photosynthetic rate in NL-44 (14.19%) compared to Vandana (33.43%) reveals the importance of the higher assimilation rate as a tolerance mechanism to withstand extreme stress. In a study by Gesch et al., (2003), the heat tolerant rice genotype (N22) could maintain photosynthetic activity for a longer time after heating leading to increased grain weights, compared to heat-sensitive genotypes (IR20, IR53, IR46). Bahuguna et al. (2015) described a 13% decrease in photosynthetic rate in NL-44 under elevated temperatures. They noted that NL-44 was able to maintain low hydrogen peroxide production and non-photochemical quenching (NPQ). Sharma et al. (2015) reported a positive correlation between Fv/Fm ratio and the photosynthetic rate as well as chlorophyll content resulting in increased dry matter.

Under higher temperature, the tolerant variety, NL-44 showed enhanced stomatal conductance (Gs) and transpiration (E) which is essential for the plant to lower its tissue temperature in order to adapt to the stress. By evaporating more water, plants can maintain cooler canopy temperature, thereby acclimatizing to higher temperatures (Crawford et al. 2012). The results are in agreement with Li et al. (2019) who also reported significant increase in the rate of transpiration and stomatal conductance under high temperature in rice. A study by Lugassi et al. (2015) reported that HXK1 stimulates stomatal closure by regulating sucrose levels in the guard cells. In the current investigation, the stomatal conductance (Gs) of Vandana variety was decreased under stress. This is correlated with the gene expression results, wherein the higher expression of OsHXK2 in Vandana during vegetative phase results in stomatal closure leading to reduced stomatal conductance. In another study, Van Houtte et al. (2013) reported that increased expression of trehalase (enzyme mediating hydrolysis of trehalose to glucose) reduces stomatal aperture. This is in agreement with the results obtained in our study where Vandana variety, expressing higher relative fold change of OsTPS1 under stress, exhibited lower stomatal conductance. Heat stress causes damage to the chlorophyll molecules as well as the photosystem-II. There was reduction in leaf temperature in both the varieties under stress. The reduction in the leaf temperature helps to protect the photosynthetic apparatus from the effects of heat (Tang et al. 2018).

The water-use efficiency (WUE) of NL-44 was significantly higher under control and treatment conditions compared to Vandana. This is due to the reduced photosynthetic rate coupled with increased transpiration rate in the susceptible variety which results in reduced biomass accumulation per unit of water transpired. Photosynthetic rate and chlorophyll fluorescence are indirect indicators of abiotic stress. As the photosystem-II is the most heat labile structure (Vacha et al. 2007), a reduction in fluorescence due to high temperature stress is a clear indicator of its susceptibility. Therefore, the fluorescence parameters such as Fv/Fm ratio, ϕPSII and the electron transport rate are important traits for studying heat tolerance in rice. The Fv/Fm ratio, ϕPSII and ETR were significantly higher in NL-44 compared to Vandana under the stress conditions although they were lower than their corresponding controls. Shefazadeh et al. (2012) correlated higher Fv/Fm ratio in wheat lines to better grain yield under high temperature stress. In a study by Thussagunpanit et al. (2015), heat stress was found to reduce the stomatal conductance (Gs), Fv/Fm ratio, electron transport rate (ETR) and ϕPSII. Heat stress was reported to significantly reduce the Fv/Fm ratio of tolerant rice genotypes NL-44 and N-22 (Bahuguna et al. 2015). Sailaja et al. (2015) in their study on rice, reported that N-22 genotype which maintained high Fv/Fm (0.75) under heat stress was identified as heat-tolerant compared to Vandana variety which recorded a lower Fv/Fm (0.70). Higher expression levels of TOR gene reportedly increased the photosynthetic efficiency and biomass under water-limiting conditions (Bakshi et al. 2017). This is in line with our current study wherein, NL-44 maintained higher expression level of OsTOR and high Fv/Fm ratio under high temperature during grain filling stage.

Effect of heat stress on yield-related parameters

Despite the extreme heat conditions, the ability of NL-44 to achieve higher spikelet fertility percentage compared to Vandana indicates its tolerance to heat stress. The decrease in spikelet fertility may be attributed to myriad factors such as anther indehiscence, pollen sterility, failure of pollen to germinate on stigma and impairment in the elongation of pollen tube in the pistil (Sunoj et al. 2017). Spikelet sterility under elevated temperature was due to decrease in the duration of grain filling caused by reduced supply of assimilates such as starch and protein (Kumar et al. 2015; Beena et al. 2018a). Sucrose is the major photo-assimilate that is transported into the grains (Pravallika et al. 2020). Therefore, a greater availability of sucrose in the leaves during higher temperatures indicates that the variety is more tolerant under stress contributing to increased grain yield. Prasad and Djanaguiraman (2014), in a study on sorghum, reported that heat tolerant genotypes recorded higher sucrose contents compared to heat susceptible genotypes.

Crop yield is a result of combination of several factors such as tiller number, number of panicles, number of grains per panicle, spikelet fertility (Wang et al. 2019; Poli et al. 2013; Beena et al. 2021a). The 1000 grain weight is a component that signifies the accumulation and remobilization of assimilates indicating their partitioning efficiency (Beena et al. 2021b; Nithya et al. 2021). The ability of NL-44 to maintain the 1000 grain weight even under heat stress on par with the control treatment is an essential trait to reduce the losses under stress. Target of rapamycin (TOR) is implicated in sensing nutrient availability and coordinating growth and cell division. It induces genes involved in stress responses (Dobrenel et al. 2011). This fact can be correlated with the higher expression of OsTOR in NL-44 during grain-filling under stress. According to Paul et al. (2018), the decreased trehalose-6-phosphate levels in the vegetative tissues results in resource re-allocation of sucrose to withstand abiotic stresses. Accordingly, we can see that in the current study, in the vegetative phase, the down-regulation of OsTPS1 in NL-44 indicates better stress tolerance. This may have resulted in the genotype NL-44 being able to maintain the 1000 grain weight even under stress conditions.

Correlation of factors influenced by heat stress

The negative correlation between the 1000 seed weight and tiller number is attributed to increased remobilization into the grain under stress which would otherwise be utilized for stress tolerance. The positive correlation of the days to flowering with the 1000 grain weight is significant as the prolonged vegetative phase accumulates greater amounts of starch in the stem which can be remobilized during grain-filling phase. The strong positive correlation between pollen viability and spikelet fertility indicates that higher number of pollen available for pollination ensures greater success in fertilizing greater number of spikelets. The association of panicle length with 1000 grain weight indicates that it is an important yield contributing factor. The membrane stability index was also positively associated with pollen viability and ETR which is important for maintaining cellular homeostasis. The water use efficiency, pollen viability and efficiency of photosystem-II (ϕPSII) which are major contributors to the thermo-tolerance of the plant were found to be positively correlated to the 1000 seed weight which is beneficial for reducing the yield loss under stress. There is significant positive correlation between transpiration rate and stomatal conductance. This is in agreement with the study of Beena et al. (2012). The significant positive correlation between spikelet fertility with the leaf temperature, pollen viability, photosynthetic rate and membrane stability index is beneficial for improving the grain filling percentage which enhances the yield of the crop. Sailaja et al. (2015) also reported a positive correlation between spikelet fertility and grain yield as well as between photosystem-II efficiency and grain yield along with evapotranspiration rate.

Gene expression under heat stress

OsHXK2

Hexokinases (HXKs) primarily sense the glucose level which is the product of cleavage of sucrose by sucrose synthase (SuSy) and invertase (INV). Low glucose flux causes the down-regulation of HXKs. The glucose sensor gene, OsHXK2 was expressed at a higher level in Vandana under vegetative phase signifying higher glucose content. In the grain-filling phase, it was down-regulated indicating that in susceptible variety, the glucose content was lower indicating decreased translocation or remobilization of photo-assimilates into the grains. The activity of hexokinase enzyme involved in glycolysis was reported to be significantly decreased in susceptible rice varieties under prolonged high temperature treatment (Yaliang et al. 2020). This results in the inhibition of transport of carbohydrates from the leaves to the panicles. This is correlated significantly with the decrease in 1000 grain weight and the photosynthetic rate in Vandana variety. Contrastingly, the OsHXK2 was up-regulated in the tolerant variety NL-44 even in the grain-filling phase signifying its ability to transport photo-assimilates to the grains even under energy limiting conditions.

OsSnRK1

The energy-sensing protein kinase, SnRK1 modulates the metabolic and transcriptional changes in plants as an adaptive mechanism to overcome stress under energy depleting conditions (Smeekens et al. 2010; Baena-Gonzalez et al. 2007; Cho et al. 2012). According to Nunes et al. (2013), high sugar levels inhibit SnRK1. As the levels of expression of OsSnRK1 during the vegetative phase were higher while significantly lower during the grain filling stage, we can state that the sugar levels were relatively higher during the grain filling phase compared to the vegetative phase. This may be attributed to the requirement of sucrose for remobilization into the grain during the maturation phase. The nonsignificant difference between the two varieties points to the fact that change in OsSnRK1 expression levels may not play a crucial role in mechanisms differentiating the tolerant and susceptible varieties. Both the varieties maintained an up-regulated status of OsSnRK1 under stress in the grain filling stage indicating activation of starvation response which modulates the activity of genes directed toward storage of photo-assimilates rather than the growth activity. TOR kinase is repressed by SnRKs under conditions of starvation. It is derepressed under favorable conditions of nutrient availability promoting growth and division by down-regulation or suppression of SnRKs.

OsTPS1

The trehalose-6-phosphate (T6P) is a signal of sucrose availability (Yadav et al. 2014). In the current investigation, OsTPS1 was found to be down-regulated in the vegetative phase in high temperature, pointing toward diminished sucrose availability under heat stress. Contrastingly, we observed that the gene was up-regulated during the grain-filling phase indicating enhanced sucrose availability for translocation into the panicles. In maize kernels, Smeekens (2015) reported an increased sink activity with reduced levels of T6P. Based on these results, we can infer that during grain-filling stage, enhanced sink activity is due to up-regulation of TPS1 in NL-44. In a study by Zhang et al. (2009), the activity of AtSnRK1 was reportedly suppressed by the application of trehalose-6-phosphate. T6P is a direct negative regulator of SnRK1 activity. The synchrony of these two genes indicates the sugar status in the source organs that can be transported to the sink organs, i.e., panicles.

OsTOR

Target of rapamycin (TOR) is a central regulatory hub that integrates varied signals related to plant growth and development including stress responses. Plants with mutations in the TOR gene were observed to express symptoms of stress even in the absence of a trigger (Fu et al. 2016). The study by Pereyra et al. (2020) cautioned that that the duration and intensity of stress plays an essential role in the level of TOR gene expression. The current study also imparts a similar opinion as the stress received in the vegetative phase was of shorter duration compared to that received during the grain filling phase.

The data analyzed from the current experiment reveals that during the vegetative phase, OsTOR was down-regulated in the tolerant variety, NL-44. Xiong et al. (2013) stated that low glucose status suppresses the activity of TOR kinase. Therefore, this can be correlated with the expression levels of OsHXK2, it was upregulated in NL-44 compared to Vandana. The lower glucose content indicates that higher sucrose content is available for translocation. During the grain-filling phase, OsTOR was up-regulated and significantly higher in the tolerant variety, NL-44 than the susceptible variety, Vandana. These results are in agreement with Sharma et al. (2019) who reported that over-expression of TOR increased the gene expression of heat shock factors in seedlings. TOR gene expression was also reported to be up-regulated in Lolium perenne under heat stress (Wang et al. 2017) implying its expression as an indicator of heat tolerance.

Gene regulation pathway

In the vegetative phase, both varieties have shown up-regulation of OsHXK2, OsSnRK1 and down-regulation of OsTPS1. But OsTOR is up-regulated in the susceptible variety (Vandana), while it was down-regulated in the tolerant variety (NL-44). In the grain filling phase, the signaling pathway differs with regard to the one expressed in the vegetative phase. OsSnRK1, OsTPS1 and OsTOR have been similarly expressed, i.e., up-regulated in both the varieties under stress. However, the difference lay in the expression of OsHXK2 which was down-regulated in the susceptible variety, whereas it was up-regulated in the tolerant variety. Functionality and expression of sugar-signaling genes under various conditions have been reported (Lim et al. 2013; Min et al. 2014; Ljung et al. 2015; Smeekens 2015; Wurzinger et al. 2018; Ryabova et al. 2019; Fu et al. 2016).

The data analyzed with regard to the four sugar signaling genes reveals unique interactions between them. Expression levels of these genes contribute to tolerance against high temperature stress by maintaining better physiological and yield parameters. Therefore, we can summarize that enhanced glucose level under high temperature is maintained by up-regulation of OsHXK2 in both the phases. Also, up-regulation of OsSnRK1 in the vegetative phase followed by down-regulation in the grain-filling phase leads to the translocation of photo-assimilates from source into the sink organs. A reduced expression of OsTPS1 gene in the grain filling stage in the source organs is essential as the reduced levels of trehalose in the leaves allows for greater transport of sucrose into the sink tissues (Griffiths et al. 2016). The up-regulation of OsTOR in the grain filling phase would be a necessary pre-requisite for coordinating with abscisic acid (ABA) signaling pathway which is involved in stress adaptation (Fu et al. 2016).

Conclusion

The current investigation reveals a unique pathway of the sugar signaling mechanism under high temperature stress between contrasting rice varieties, Vandana and NL-44. The study clearly identifies and confirms the tolerant and susceptible rice varieties as NL-44 and Vandana, respectively, based on various physiological, gas exchange and fluorescence parameters as well as the yield contributing characters. The gene expression studies conducted with these varieties have revealed distinct sugar signaling pathways with respect to the susceptible and tolerant varieties as well as between the vegetative and grain-filling phase. The gene expression data obtained can be used to identify varieties for tolerance to high temperature stress on a genetic basis. Integration of this data with the enzymatic expression of important enzymes involved in grain filling will help in further elucidating the role of these genes in the sugar signaling mechanism. The trehalose 6-phosphate (T6P) signaling system has emerged as a mechanism of resource allocation, including assimilate partitioning from source to sink and improvement in yield in various environments. Understanding the mode of action of T6P through the SnRK1 protein kinase regulatory system is providing a basis for a unifying mechanism controlling whole-plant resource allocation and source–sink interactions in crops. T6P/SnRK1 pathway can be harnessed for further improvements such as grain number and grain filling traits and abiotic stress resilience through targeted gene editing, breeding and chemical approaches. The regulation of these genes under higher temperatures needs to be further elucidated as this information will be helpful in applications in further increasing the thermo-tolerance of high-yielding varieties. The sugar-signaling pathway is a critical and important target in this effort as it is at the center of plant metabolism controlling the yield of the crop. Foliar application of T6P can improve grain number and size, recovery of more vegetative tissue after stress through gene priming of these traits.

Acknowledgements

Authors are thankful to Kerala Agricultural University for providing the Ph.D. fellowship and all other research facilities.

Author contributions

BR: conceptualized the study. SK and SS: performed the work. SK, KAG and SR: assisted in analytical work and taking observations. SK and SS: assisted in data analysis. BR: supervised and provided the resources for research study. All authors reviewed and approved the manuscript.

Declarations

Conflict of interest

All authors do not have any conflict of interest in publishing this article in 3 Biotech Journal.

References

  1. Ali BSA, Beena R, Stephen K. Combined effect of high temperature and salinity on growth and physiology of rice (Oryza sativa L.) Agric Res J. 2021;58(5):783–788. doi: 10.5958/2395-146X.2021.00111.3. [DOI] [Google Scholar]
  2. Baena-González E, Rolland F, Thevelein JM, Sheen J. A central integrator of transcription networks in plant stress and energy signalling. Nature. 2007;448(7156):938–942. doi: 10.1038/nature06069. [DOI] [PubMed] [Google Scholar]
  3. Bahuguna RN, Jha J, Pal M, Shah D, Lawas LM, Khetarpal S, Jagadish KS. Physiological and biochemical characterization of NERICA-44: a novel source of heat tolerance at the vegetative and reproductive stages in rice. Physiol Plant. 2015;154(4):543–559. doi: 10.1111/ppl.12299. [DOI] [PubMed] [Google Scholar]
  4. Bakshi A, Moin M, Kumar MU, Reddy ABM, Ren M, Datla R, Siddiq EA, Kirti PB. Ectopic expression of Arabidopsis target of rapamycin (AtTOR) improves water-use efficiency and yield potential in rice. Sci Rep. 2017;7(1):1–16. doi: 10.1038/srep42835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Beena R, Sheshshayee MS, Madhura JN, Prasad TG, Udayakumar M. Development of SSR markers and genetic variability in physiological traits in bambara groundnut (Vignasubterranea L. Verdc) In: Sabu A, Anu A, editors. Prospects in bioscience: addressing the issues. Berlin: Springer Nature Publishing; 2012. pp. 229–242. [Google Scholar]
  6. Beena R, Vighneswaran V, Sindumole P, Narayankutty MC, Voleti SR. Impact of high temperature stress during reproductive and grain filling stage in rice. Oryza Int J Rice. 2018;55(1):126–133. [Google Scholar]
  7. Beena R, Veena V, Narayankutty MC. Evaluation of rice genotypes for acquired thermo-tolerance using temperature induction response technique. Oryza Int J Rice. 2018;55(2):285–291. [Google Scholar]
  8. Beena R, Veena V, Jaslam MPK, Nithya N, Adarsh VS. Germplasm innovation for high temperature tolerance from traditional rice accessions of Kerala using genetic variability, genetic advance, path coefficient analysis and principal component analysis. J Crop Sci Biotechnol. 2021 doi: 10.1007/s12892-021-00103-7. [DOI] [Google Scholar]
  9. Beena R, Silvas K, Nithya N, Manickavelu A, Sah RP, Abida PS, Sreekumar J, Jaslam PM, Rejeth R, Jayalekshmy VG, Roy S, Manju RV, Viji MM, Siddique KM. Association mapping of drought tolerance and agronomic traits in rice (Oryza sativa L.) landraces. BMC Plant Biol. 2021;21(1):1–21. doi: 10.1186/s12870-021-03272-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cho J, Ryoo N, Ko S, Lee SK, Lee J, Jung KH, Lee YH, Bhoo SH, Winderickx J, An G, Hahn TR, Jeon JS. Structure, expression, and functional analysis of the hexokinase gene family in rice (Oryza sativa L.) Planta. 2006;224:598–611. doi: 10.1007/s00425-006-0251-y. [DOI] [PubMed] [Google Scholar]
  11. Cho YH, Hong JW, Kim EC, Yoo SD. Regulatory functions of SnRK1 in stress-responsive gene expression and in plant growth and development. Plant Physiol. 2012;158:1955–1964. doi: 10.1104/pp.111.189829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Crawford AJ, McLachlan DH, Hetherington AM, Franklin KA. High temperature exposure increases plant cooling capacity. Curr Biol. 2012;22:R396–R397. doi: 10.1016/j.cub.2012.03.044. [DOI] [PubMed] [Google Scholar]
  13. Fichtner F, Barbier FF, Feil R, Watanabe M, Annunziata MG, Chabikwa TG, Höfgen R, Stitt M, Beveridge CA, Lunn JE. Trehalose 6-phosphate is involved in triggering axillary bud outgrowth in garden pea (Pisum sativum L.) Plant J. 2017;92(4):611–623. doi: 10.1111/tpj.13705. [DOI] [PubMed] [Google Scholar]
  14. Filipe O, Vleesschauwer DD, Haeck A, Demeestere K, Höfte M. The energy sensor OsSnRK1a confers broad-spectrum disease resistance in rice. Sci Rep. 2018;8(3864):1–12. doi: 10.1038/s41598-018-22101-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Fu G, Feng B, Zhang C, Yang Y, Yang X, Chen T, Zhao X, Zhang X, Jin Q, Tao L. Heat stress is more damaging to superior spikelets than inferiors of rice (Oryza sativa L.) due to their different organ temperatures. Front Plant Sci. 2016;7:1637. doi: 10.3389/fpls.2016.01637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gesch RW, Kang IH, Gallo-Meagher M, Vu JCV, Boote KJ, Allen LH, Bowes G. Rubisco expression in rice leaves is related to genotypic variation of photosynthesis under elevated growth CO2 and temperature. Plant Cell Environ. 2003;26(12):1941–1950. [Google Scholar]
  17. Gopinath PP, Parsad R, Joseph B, Adarsh VS. GrapesAgri1: collection of shiny apps for data analysis in agriculture. J Open Sour Softw. 2021;6(63):3437. [Google Scholar]
  18. Griffiths CA, Sagar R, Geng Y, Primavesi LF, Patel MK, Passarelli MK, Gilmore IS, Steven RT, Bunch J, Paul MJ, Davis BG. Chemical intervention in plant sugar signalling increases yield and resilience. Nature. 2016;540(7634):574–578. doi: 10.1038/nature20591. [DOI] [PubMed] [Google Scholar]
  19. Halford and Dickinson . Sugar sensing and cell cycle control : evidence of cross talk between two ancientsignalling pathways. In: Francis D, editor. The Plant Cell Cycle and its interfaces. Sheffield: Sheffield Academic Press; 2001. pp. 87–107. [Google Scholar]
  20. Halford NG, Hey S, Jhurreea D, Laurie S, McKibbin RS, Paul M, Zhang Y. Metabolic signalling and carbon partitioning:role of Snf1-related (SnRK1) protein kinase. Journal of Experimental Botany. 2003;54(382):467–475. doi: 10.1093/jxb/erg038. [DOI] [PubMed] [Google Scholar]
  21. Hassan MU, Chattha MU, Khan I, Chattha MB, Barbanti L, Aamer M, Iqbal MM, Nawaz M, Mahmood A, Ali A, Aslam MT. Heat stress in cultivated plants: nature, impact, mechanisms, and mitigation strategies—a review. Plant Biosyst Int J Deal Asp Plant Biol. 2021;155(2):211–234. [Google Scholar]
  22. Jagadish SVK, Murty MVR, Quick WP. Rice responses to rising temperatures– challenges, perspectives and future directions. Plant Cell Environ. 2015;38(9):1686–1698. doi: 10.1111/pce.12430. [DOI] [PubMed] [Google Scholar]
  23. Julia C, Dingkuhn M. Variation in time of day of anthesis in rice in different climatic environments. Eur J Agron. 2012;43:166–174. [Google Scholar]
  24. Kumar N, Kumar N, Shukla A, Shankhdhar SC, Shankhdhar D. Impact of terminal heat stress on pollen viability and yield attributes of rice (Oryza sativa L.) Cereal Res Commun. 2015;43(4):616–626. [Google Scholar]
  25. Lastdrager J, Hanson J, Smeekens S. Sugar signals and the control of plant growth and development. J Exp Bot. 2014;65(3):799–807. doi: 10.1093/jxb/ert474. [DOI] [PubMed] [Google Scholar]
  26. Lawas LMF, Shi W, Yoshimoto M, Hasegawa T, Hincha DK, Zuther E, Jagadish SK. Combined drought and heat stress impact during flowering and grain filling in contrasting rice cultivars grown under field conditions. Field Crop Res. 2018;229:66–77. [Google Scholar]
  27. Li HW, Zang BS, Deng XW, Wang XP. Overexpression of the trehalose-6-phosphate synthase gene OsTPS1 enhances abiotic stress tolerance in rice. Planta. 2011;234(5):1007–1018. doi: 10.1007/s00425-011-1458-0. [DOI] [PubMed] [Google Scholar]
  28. Li L, Sheen J. Dynamic and diverse sugar signalling. Curr Opin Plant Biol. 2016;33:116–125. doi: 10.1016/j.pbi.2016.06.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Li S, Jiang H, Wang J, Wang Y, Pan S, Tian H, Duan M, Wang S, Tang X, Mo Z. Responses of plant growth, physiological, gas exchange parameters of super and non-super rice to rhizosphere temperature at the tillering stage. Sci Rep. 2019;9(1):1–17. doi: 10.1038/s41598-019-47031-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lim MN, Lee SE, Yim HK, Kim JH, Yoon IS, Hwang YS. Differential anoxic expression of sugar-regulated genes reveals diverse interactions between sugar and anaerobic signalling systems in rice. Mol Cells. 2013;36(2):169–176. doi: 10.1007/s10059-013-0152-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Liu E, Liu Y, Wu G, Zeng S, Thi TG, Liang L, Liang Y, Dong Z, She D, Wang H, Zaid IU. Identification of a candidate gene for panicle length in rice (Oryza sativa L.) via association and linkage analysis. Front Plant Sci. 2016;7:596. doi: 10.3389/fpls.2016.00596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  33. Ljung K, Nemhauser JL, Perata P. New mechanistic links between sugar and hormone signalling networks. Curr Opin Plant Biol. 2015;25:130–137. doi: 10.1016/j.pbi.2015.05.022. [DOI] [PubMed] [Google Scholar]
  34. Lugassi N, Kelly G, Fidel L, Yaniv Y, Attia Z, Levi A, Alchanatis V, Moshelion M, Raveh E, Carmi N, Granot D. Expression of Arabidopsis hexokinase in citrus guard cells controls stomatal aperture and reduces transpiration. Front Plant Sci. 2015;6:1114. doi: 10.3389/fpls.2015.01114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Maegawa K, Takii R, Ushimaru T, Akiko Kozaki A. Evolutionary conservation of TORC1 components, TOR, Raptor, and LST8, between rice and yeast. Mol Genet Genom. 2015 doi: 10.1007/s00438-015-1056-0. [DOI] [PubMed] [Google Scholar]
  36. Mahajan G, Kumar V, Chauhan BS. Rice production worldwide. Cham: Springer; 2017. Rice production in India; pp. 53–91. [Google Scholar]
  37. Min L, Li Y, Hu Q, Zhu L, Gao W, Wu Y, Ding Y, Liu S, Yang X, Zhang X. Sugar and auxin signalling pathways respond to high-temperature stress during anther development as revealed by transcript profiling analysis in cotton. Plant Physiol. 2014;164(3):1293–1308. doi: 10.1104/pp.113.232314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Moreau M, Azzopardi M, Clément G, Dobrenel T, Marchive C, Renne C, Martin-Magniette ML, Taconnat L, Renou JP, Robaglia C, Meyer C. Mutations in the Arabidopsis homolog of LST8/GβL, a partner of the target of rapamycin kinase, impair plant growth, flowering, and metabolic adaptation to long days. Plant Cell. 2012;24(2):463–481. doi: 10.1105/tpc.111.091306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Nithya N, Beena R, Abida PS, Sreekumar J, Roy S, Jayalekshmy VG, Manju RV, Viji MM. Genetic diversity and population structure analysis of bold type rice collection from Southern India. Cereal Res Commun. 2021;49(2):311–328. doi: 10.1007/s42976-020-00099-w. [DOI] [Google Scholar]
  40. Nunes C, O’Hara LE, Primavesi LF, Delatte TL, Schluepmann H, Somsen GW, Silva AB, Fevereiro PS, Wingler A, Paul MJ. The trehalose 6-phosphate/SnRK1 signaling pathway primes growth recovery following relief of sink limitation. Plant Physiol. 2013;162(3):1720–1732. doi: 10.1104/pp.113.220657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Oh-e I, Saitoh K, Kuroda T. Effects of high temperature on growth, yield and dry-matter production of rice grown in the paddy field. Plant Prod Sci. 2007;10(4):412–422. [Google Scholar]
  42. Paul MJ, Gonzalez-Uriarte A, Griffiths CA, Hassani-Pak K. The role of trehalose 6-phosphate in crop yield and resilience. Plant Physiol. 2018;177(1):12–23. doi: 10.1104/pp.17.01634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Paul MJ, Watson A, Griffiths CA. Trehalose 6-phosphate signalling and impact on crop yield. Biochem Soc Trans. 2020;48:2127–2137. doi: 10.1042/BST20200286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Pereyra CM, Aznar NR, Rodriguez MS, Salerno GL, Martínez-Noël GM. Target of rapamycin signaling is tightly and differently regulated in the plant response under distinct abiotic stresses. Planta. 2020;251(1):1–14. doi: 10.1007/s00425-019-03305-0. [DOI] [PubMed] [Google Scholar]
  45. Poli Y, Basava RK, Panigrahy M, Vinukonda VP, Dokula NR, Voleti SR, Desiraju S, Neelamraju S. Characterization of a Nagina22 rice mutant for heat tolerance and mapping of yield traits. Rice. 2013;6(1):1–9. doi: 10.1186/1939-8433-6-36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Prasanth VV, Babu MS, Basava RK, Tripura Venkata VGN, Mangrauthia SK, Voleti SR, Neelamraju S. Trait and marker associations in Oryza nivara and O. rufipogon derived rice lines under two different heat stress conditions. Front Plant Sci. 2017;8:1819. doi: 10.3389/fpls.2017.01819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Prasad PVV, Djanaguiraman M. Response of floret fertility and individual grain weight of wheat to high temperature stress: sensitive stages and thresholds for temperature and duration. Funct. Plant Biol. 2014;41:1261–1269. doi: 10.1071/FP14061. [DOI] [PubMed] [Google Scholar]
  48. Pravallika K, Arunkumar C, Vijayakumar A, Beena R, Jayalekshmi VG. Effect of high temperature stress on seed filling and nutritional quality of rice (Oryza sativa L.) J Crop Weed. 2020;16(2):18–23. [Google Scholar]
  49. Quilichini TD, Gao P, Pandey PK, Xiang D, Ren M, Datla R. A role for TOR signalling at every stage of plant life. J Exp Bot. 2019;70(8):2285–2296. doi: 10.1093/jxb/erz125. [DOI] [PubMed] [Google Scholar]
  50. Ravikiran KT, Krishnan SG, Vinod KK, Dhawan G, Dwivedi P, Kumar P, Bansal VP, Nagarajan M, Bhowmick PK, Ellur RK, Bollinedi H. A trait specific QTL survey identifies NL44, a NERICA cultivar as a novel source for reproductive stage heat stress tolerance in rice. Plant Physiol Rep. 2020;25(4):664–676. [Google Scholar]
  51. Rejeth R, Manikanta Ch LN, Beena R, Roy S, Manju RV, Viji MM. Water stress mediated root trait dynamics and identification of microsatellite markers associated with root traits in rice (Oryza sativa L.) Physiol Mol Biol Plants. 2020;26(6):1225–1236. doi: 10.1007/s12298-020-00809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Ryabova LA, Robaglia C, Meyer C. Target of rapamycin kinase: central regulatory hub for plant growth and metabolism. J Exp Bot. 2019;70(8):2211. doi: 10.1093/jxb/erz108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Sailaja B, Subrahmanyam D, Neelamraju S, Vishnukiran T, Rao YV, Vijayalakshmi P, Voleti SR, Bhadana VP, Mangrauthia SK. Integrated physiological, biochemical, and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature. Front Plant Sci. 2015;6:1044. doi: 10.3389/fpls.2015.01044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Sairam RK, Deshmukh PS, Shukla DS. Tolerance of drought and temperature stress in relation to increased antioxidant enzyme activity in wheat. J Agron Crop Sci. 1997;178(3):171–178. [Google Scholar]
  55. Sakr S, Wang M, Dédaldéchamp F, Perez-Garcia MD, Og L, Hamama L, Atanassova R. The sugar-signaling hub: overview of regulators and interaction with the hormonal and metabolic network. Int J Mol Sci. 2018;19(9):2506. doi: 10.3390/ijms19092506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Sami F, Siddiqui H, Hayat S. Interaction of glucose and phytohormone signaling in plants. Plant Physiol Biochem. 2019;135:119–126. doi: 10.1016/j.plaphy.2018.11.005. [DOI] [PubMed] [Google Scholar]
  57. Santiago JP, Sharkey TD. Pollen development at high temperature and role of carbon and nitrogen metabolites. Plant Cell Environ. 2019;42(10):2759–2775. doi: 10.1111/pce.13576. [DOI] [PubMed] [Google Scholar]
  58. Sharma DK, Andersen SB, Ottosen CO, Rosenqvist E. Wheat cultivars selected for high Fv/Fm under heat stress maintain high photosynthesis, total chlorophyll, stomatal conductance, transpiration and dry matter. Physiol Plant. 2015;153(2):284–298. doi: 10.1111/ppl.12245. [DOI] [PubMed] [Google Scholar]
  59. Sharma M, Banday ZZ, Shukla BN, Laxmi A. Glucose-regulated HLP1 acts as a key molecule in governing thermomemory. Plant Physiol. 2019;180(2):1081–1100. doi: 10.1104/pp.18.01371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Shefazadeh MK, Mohammadi M, Karimizadeh R. Genotypic difference for heat tolerance traits under real field conditions. J Food Agric Environ. 2012;10:484–487. [Google Scholar]
  61. Smeekens S. From leaf to kernel: trehalose-6-phosphate signaling moves carbon in the field. Plant Physiol. 2015;169(2):912–913. doi: 10.1104/pp.15.01177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Smeekens S, Hellmann HA. Sugar sensing and signalling in plants. Front Plant Sci. 2014;5:113. doi: 10.3389/fpls.2014.00113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Smeekens S, Ma J, Hanson J, Rolland F. Sugar signals and molecular networks controlling plant growth. Curr Opin Plant Biol. 2010;13(3):273–278. doi: 10.1016/j.pbi.2009.12.002. [DOI] [PubMed] [Google Scholar]
  64. Stephen K, Beena R, Manju RV, Viji MM, Roy S. Mechanism of sugar signalling in plants. Acta Sci Agric. 2021;5(2):45–55. [Google Scholar]
  65. Sun P, Zhang W, Wang Y, He Q, Shu F, Liu H, Wang J, Wang J, Yuan L, Deng H. OsGRF4 controls grain shape, panicle length and seed shattering in rice. J Integr Plant Biol. 2016;58(10):836–847. doi: 10.1111/jipb.12473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Sunoj J, Impa MS, Chiluwal A, Perumal R, Prasad PVV, Jagadish SVK. Resilience of pollen and post-flowering response in diverse Sorghum genotypes exposed to heat stress under field conditions. Crop Sci. 2017 doi: 10.2135/cropsci2016.08.0706. [DOI] [Google Scholar]
  67. Takeoka YA, Al Mamun A, Wada T, Kaufman PB. Development on crop science. Tokyo: Japan Scientific Soceties Press; 1992. Primary features of the effect of environmental stress on rice spikelet morphogenesis, Chap 5. Reproductive adaptation of rice to environmental stress; p. pp113–141.. [Google Scholar]
  68. Tang S, Zhang H, Li L, Liu X, Chen L, Chen W, Ding Y. Exogenous spermidine enhances the photosynthetic and antioxidant capacity of rice under heat stress during early grain-filling period. Funct Plant Biol. 2018;45(9):911–921. doi: 10.1071/FP17149. [DOI] [PubMed] [Google Scholar]
  69. Thussagunpanit J, Jutamanee K, Sonjaroon W, Kaveeta L, Chai-Arree W, Pankean P, Suksamrarn A. Effects of brassinosteroid and brassinosteroid mimic on photosynthetic efficiency and rice yield under heat stress. Photosynthetica. 2015;53(2):312–320. [Google Scholar]
  70. Vacha F, Adamec F, Valenta J, Vacha M. Spatial location of photosystem pigment-protein complexes in thylakoid membranes of chloroplasts of Pisum sativum studied by chlorophyll fluorescence. J Luminesc. 2007;122:301–303. [Google Scholar]
  71. Van Houtte H, Vandesteene L, López-Galvis L, Lemmens L, Kissel E, Carpentier S, Feil R, Avonce N, Beeckman T, Lunn JE, Van Dijck P. Overexpression of the trehalase gene AtTRE1 leads to increased drought stress tolerance in Arabidopsis and is involved in abscisic acid-induced stomatal closure. Plant Physiol. 2013;161(3):1158–1171. doi: 10.1104/pp.112.211391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Vivitha P, Raveendran M, Vijayalekshmi D. Introgression of QTLs controlling spikelet fertility maintains membrane integrity and grain yield in improved White Ponni derived progenies exposed to heat stress. Rice Sci. 2017;24(1):32–40. [Google Scholar]
  73. Wang K, Liu Y, Tian J, Huang K, Shi T, Dai X, Zhang W. Transcriptional profiling and identification of heat-responsive genes in perennial ryegrass by RNA-sequencing. Front Plant Sci. 2017;8:1032. doi: 10.3389/fpls.2017.01032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Wang Y, Wang L, Zhou J, Hu S, Chen H, Xiang J, Zhang Y, Zeng Y, Shi Q, Zhu D, Zhang Y. Research progress on heat stress of rice at flowering stage. Rice Sci. 2019;26(1):1–10. [Google Scholar]
  75. Wang C, Yang X, Li G. Molecular insights into inflorescence meristem specification for yield potential in cereal crops. Int J Mol Sci. 2021;22:3508. doi: 10.3390/ijms2207350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Wurzinger B, Nukarinen E, Nägele T, Weckwerth W, Teige M. The SnRK1 kinase as central mediator of energy signaling between different organelles. Plant Physiol. 2018;176(2):1085–1094. doi: 10.1104/pp.17.01404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Xiong Y, McCormack M, Li L, Hall Q, Xiang C, Sheen J. Glucose–TOR signalling reprograms the transcriptome and activates meristems. Nature. 2013;496(7444):181–186. doi: 10.1038/nature12030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Yadav UP, Ivakov A, Feil R, Duan GY, Walther D, Giavalisco P, Piques M, Carillo P, Hubberten HM, Stitt M, et al. The sucrose-trehalose-6-phosphate (Tre6P) nexus: specificity and mechanisms of sucrose signalling by Tre6P. J Exp Bot. 2014;65:1051–1068. doi: 10.1093/jxb/ert457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Yaliang W, Yikai Z, Qinghua S, Huizhe C, Jing X, Guohui H, Yanhua C, Xiaodan W, Junke W, Zihao YI, Defeng Z. Decrement of sugar consumption in rice young panicle under high temperature aggravates spikelet number reduction. Rice Sci. 2020;27(1):44–55. [Google Scholar]
  80. Zhang Y, Shewry PR, Jones H, Barcelo P, Lazzeri PA, Halford NG. Expression of antisense SnRK1 protein kinase sequence causes abnormal pollen development and male sterility in transgenic barley. Plant J. 2001;28(4):431–441. doi: 10.1046/j.1365-313x.2001.01167.x. [DOI] [PubMed] [Google Scholar]
  81. Zhang Y, Primavesi LF, Jhurreea D, Andralojc PJ, Mitchell RA, Powers SJ, Schluepmann H, Delatte T, Wingler A, Paul MJ. Inhibition of SNF1-related protein kinase1 activity and regulation of metabolic pathways by trehalose-6-phosphate. Plant Physiol. 2009;149(4):1860–1871. doi: 10.1104/pp.108.133934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Zhao L, Lei J, Huang Y, Zhu S, Chen H, Huang R, Peng Z, Tu Q, Shen X, Yan S. Mapping quantitative trait loci for heat tolerance at anthesis in rice using chromosomal segment substitution lines. Breed Sci. 2016;66(3):358–366. doi: 10.1270/jsbbs.15084. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES