ABSTRACT
We report the near-complete genome sequence of an avian orthoavulavirus 13 (AOAV-13) strain isolated from a wild goose fecal sample collected in South Korea in early 2020. The AOAV-13 sequence had a unique 3′ trailer region, including an 84-nucleotide (nt) deletion and a 24-nt insertion, compared to the most closely related Chinese genome sequence from 2015.
ANNOUNCEMENT
Avian paramyxoviruses (APMVs) have been reported all around the world, infecting poultry as well as diverse species of wild birds. APMVs belong to the recently assigned subfamily Avulavirinae of the family Paramyxoviridae. The subfamily Avulavirinae is composed of three genera, namely, Metaavulavirus (avian metaavulavirus [AMAV]), Orthoavulavirus (avian orthoavulavirus [AOAV]), and Paraavulavirus (avian paraavulavirus [APAV]) (1). Avulavirinae member viruses possess nonsegmented, single-stranded, negative-sense RNA genomes ranging from 14.9 to 17.4 kbp, encoding at least six proteins (NP, P, M, F, HN, and L) (2). In this study, we report the near-complete genome sequence of an AOAV-13 strain that was isolated in South Korea in 2020.
A hemagglutinating agent was isolated from allantoic fluid harvested from 9- to 11-day-old embryonated chicken eggs inoculated with a fecal sample (36°59′14.4″N, 126°39′45.9″E) from a wild migratory bird that had been collected during avian influenza virus surveillance from October 2019 to April 2020. The host species of the isolated virus was determined from wild bird feces by the mitochondrial DNA barcoding PCR technique (3). Viral RNA was isolated using the TRIzol LS reagent. Extracted RNA was amplified using the sequence-independent single-primer amplification (SISPA) method, which utilizes random priming to amplify unknown RNA virus genomes, as described previously (4). Library preparation and sequencing were performed at Biocore Co., Ltd. (Seoul, Republic of Korea), using an Ion Torrent S5TM XL system. The resulting raw reads (1,536,656 reads) were trimmed and mapped to the whole-genome sequence of an AOAV-13 strain from the GenBank database (GenBank accession no. MN150295.1) with Geneious Prime v2021.2.2 using default parameters. A total of 544,667 reads were mapped to produce a near-complete genome of AOAV-13. Putative insertions and deletions identified in the initial assembly were verified with Sanger sequencing with primers designed to amplify the nucleotide position 14508 to 16032 region. The genome positions were calculated based on the AOAV-13/wild goose/China/Hubei/V93-1/2015 (China/V93-1) genome (GenBank accession no. MN150295).
Barcoding PCR of the host mitochondrial DNA identified the host as a greater white-fronted goose (Anser albifrons) by using the primers AvesF (GCATGAGCAGGAATAGTTGG) and AvesR (AAGATGTAGACTTCTGGGTG), as described previously (3). The isolate was named Korea/AOAV-13/Greater white-fronted goose/South Korea/E20-158-3/2020 (here referred to as Korea/E20-158-3). The genome of Korea/E20-158-3 had a GC content of 42.6% (5). A BLAST search of the whole-genome sequence of Korea/E20-158-3 returned the highest identity (99.15%) to China/V93-1. The furin cleavage site of the F gene in Korea/E20-158-3 had the same motif (112V-R-E-N-R-L117) as found in other AOAV-13 strains. The monobasic amino acid at the C terminus of the cleavage site and leucine at residue 117 suggest low pathogenicity in domestic poultry (2, 6–8). The Korea/E20-158-3 genome sequence had the same length of the 3′ leader region (n = 55) as observed in most genomes of the subfamily Paramyxovirinae (9). The genome of Korea/E20-158-3 also possessed paramyxovirus-characteristic complementary 5′ leader and 3′ trailer termini of 14 nucleotides (nt) (one mismatch at nucleotide position 9) (9). For the 3′ trailer region, additional Sanger sequencing confirmed that Korea/E20-158-3 exhibited an 84-nt deletion at nucleotide positions 15304 to 15387 and a 24-nt insertion at nucleotide positions 15811 to 15834, compared to the most closely related sequence, China/V93-1. Genome sequencing of Korea/E20-158-3 revealed genomic diversity among AOAV-13 strains.
Data availability.
The near-complete genome sequence of AOAV-13/Greater white-fronted goose/South Korea/E20-158-3/2020 has been deposited in the GenBank and Sequence Read Archive (SRA) databases under the accession no. OK513542.1 and SRR19361424, respectively.
ACKNOWLEDGMENTS
This research was supported by the Bio & Medical Technology Development Program of the National Research Foundation (NRF) funded by the Korean government (MSIT) (grant NRF-2018M3A9H4056535).
We declare no conflicts of interest.
Contributor Information
Chang-Seon Song, Email: songcs@konkuk.ac.kr.
Jelle Matthijnssens, KU Leuven.
REFERENCES
- 1.Walker PJ, Siddell SG, Lefkowitz EJ, Mushegian AR, Adriaenssens EM, Dempsey DM, Dutilh BE, Harrach B, Harrison RL, Hendrickson RC, Junglen S, Knowles NJ, Kropinski AM, Krupovic M, Kuhn JH, Nibert M, Orton RJ, Rubino L, Sabanadzovic S, Simmonds P, Smith DB, Varsani A, Zerbini FM, Davison AJ. 2020. Changes to virus taxonomy and the statutes ratified by the International Committee on Taxonomy of Viruses (2020). Arch Virol 165:2737–2748. doi: 10.1007/s00705-020-04752-x. [DOI] [PubMed] [Google Scholar]
- 2.Gogoi P, Ganar K, Kumar S. 2017. Avian paramyxovirus: a brief review. Transbound Emerg Dis 64:53–67. doi: 10.1111/tbed.12355. [DOI] [PubMed] [Google Scholar]
- 3.Lee D-H, Lee H-J, Lee Y-J, Kang H-M, Jeong O-M, Kim M-C, Kwon J-S, Kwon J-H, Kim C-B, Lee J-B, Park S-Y, Choi I-S, Song C-S. 2010. DNA barcoding techniques for avian influenza virus surveillance in migratory bird habitats. J Wildl Dis 46:649–654. doi: 10.7589/0090-3558-46.2.649. [DOI] [PubMed] [Google Scholar]
- 4.Chrzastek K, Lee D-H, Smith D, Sharma P, Suarez DL, Pantin-Jackwood M, Kapczynski DR. 2017. Use of sequence-independent, single-primer-amplification (SISPA) for rapid detection, identification, and characterization of avian RNA viruses. Virology 509:159–166. doi: 10.1016/j.virol.2017.06.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Kolakofsky D, Pelet T, Garcin D, Hausmann S, Curran J, Roux L. 1998. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. J Virol 72:891–899. doi: 10.1128/JVI.72.2.891-899.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Yamamoto E, Ito H, Tomioka Y, Ito T. 2015. Characterization of novel avian paramyxovirus strain APMV/Shimane67 isolated from migratory wild geese in Japan. J Vet Med Sci 77:1079–1085. doi: 10.1292/jvms.14-0529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Fei Y, Liu X, Mu J, Li J, Yu X, Chang J, Bi Y, Stoeger T, Wajid A, Muzyka D, Sharshov K, Shestopalov A, Amonsin A, Chen J, Ding Z, Yin R. 2019. The emergence of avian orthoavulavirus 13 in wild migratory waterfowl in China revealed the existence of diversified trailer region sequences and HN gene lengths within this serotype. Viruses 11:646. doi: 10.3390/v11070646. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Swayne DE, Brown I. 2021. OIE terrestrial manual of diagnostic tests and vaccines for terrestrial animals. World Organization for Animal Health, Paris, France. https://www.woah.org/fileadmin/Home/eng/Health_standards/tahm/A_summry.htm. [Google Scholar]
- 9.Paldurai A, Subbiah M, Kumar S, Collins PL, Samal SK. 2009. Complete genome sequences of avian paramyxovirus type 8 strains goose/Delaware/1053/76 and pintail/Wakuya/20/78. Virus Res 142:144–153. doi: 10.1016/j.virusres.2009.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The near-complete genome sequence of AOAV-13/Greater white-fronted goose/South Korea/E20-158-3/2020 has been deposited in the GenBank and Sequence Read Archive (SRA) databases under the accession no. OK513542.1 and SRR19361424, respectively.
