Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2022 Feb 2;14(2):274–285. doi: 10.1111/1758-2229.13048

Complete genome assembly of the levan‐positive strain PVFi1 of Pseudomonas savastanoi pv. savastanoi isolated from olive knots in Central Italy

Silvia Turco 1, Mounira Inas Drais 1, Luca Rossini 1, Elena Chaboteaux 1, Yaseen Jundi Rahi 1,2, Giorgio Mariano Balestra 1, Nicola Sante Iacobellis 3, Angelo Mazzaglia 1,✉
PMCID: PMC9302664  PMID: 35107220

Summary

Pseudomonas savastanoi pv. savastanoi, the causal agent of olive knot disease, is a fluorescent Gram‐negative bacterium classified, according to the specific LOPAT profile, as Ib. However, during the 90s, a number of atypical non‐fluorescent levan‐positive strains of Pseudomonas savastanoi pv. savastanoi have been unexpectedly isolated from olive knots in Central Italy. Since its first report, several studies were conducted on this species variant, but its genome sequence has never been reported. The complete genome sequence and two additional plasmids of PVFi1, a representative strain, were here obtained using a hybrid sequencing approach with both Oxford Nanopore Technology and Illumina sequencing. A thorough genomic analysis unravelled several genetic features of this peculiar strain, showing a transposase insertion downstream a fragmented copy of the levansucrase gene. The same features were previously reported on levan‐negative Pseudomonas savastanoi pv. savastanoi strains. In addition, a second copy of the levansucrase gene fully equipped for a gene expression and comparable to the levan‐positive Pseudomonas savastanoi pv. glycinea, may explain the levan‐positive test. This result provides a solid genetic demonstration that the bacterial species Pseudomonas savastanoi contains either levan‐positive or levan‐negative strains, providing insights for an update of the related LOPAT classification.

Introduction

Pseudomonas savastanoi is a monomorphic pathogenic Gram‐negative gamma‐proteobacterium, belonging to the genomospecies 2 of Pseudomonas syringae complex (Gardan et al., 1992). The strains referable to this species are further classified in pathovars, according to their respective host range. Pseudomonas savastanoi pv. savastanoi (Psv), pv. fraxini (Psf), pv. nerii (Psn) and pv. retacarpa (Psr) attack mainly woody hosts belonging to different species of the families Oleaceae, Fabaceae, Myrtaceae, Apocinaceae and Lythraceae (Bradbury, 1986; Gardan et al., 1992; Iacobellis et al., 1998; Janse, 1982; Marchi et al., 2011; Moretti et al., 2017; de los Rios, 1999). Pseudomonas savastanoi pv. glycinea (Psg) and pv. phaseolicola (Pph) infect instead herbaceous hosts, soybean (Young et al., 1978) and beans or mulberry (Völksch and Weingart, 1997; Dworkin, 2006), respectively.

Within the species Pseudomonas savastanoi, the pathovar savastanoi is responsible for the olive knot disease, widely diffused in the Mediterranean basin where this species is considered endemic. Infected plants present galls or knots on young woody organs (i.e., twigs and young branches), whilst leaves or fruits are seldom attacked. Although the viability of adult plants is not endangered, the detrimental effect on vegetative growth and olive yield becomes significant as the incidence of the disease increases (Schroth, 1973; Osman et al., 1980; Quesada et al., 2010).

A recent population structure analysis revealed a highly complex relationship between and within pathovars, suggesting that further genomic studies are necessary to better characterize this species (Rahi et al., 2020).

As a member of the subgroup 1b of the LOPAT scheme (LOPAT meaning a series of determinative tests: L, levan production; O, oxidase production; P, pectinolytic activity; A, arginine dihydrolase production; and T, tobacco hypersensibility), Pseudomonas savastanoi has long been classified as levan‐negative bacterium producing fluorescent pigments, in comparison with the other members of subgroup Ia, whom Pseudomonas syringae belongs, which are levan‐positive instead (Lelliott et al., 1966).

However, during an epidemiological survey in Central Italy in the 90s, non‐fluorescent levan‐positive bacteria have been isolated from olive knots, whose identity was molecularly confirmed as Pseudomonas savastanoi pv savastanoi (Iacobellis et al., 1993). Over time this occurrence was repeatedly confirmed, and it is now considered as a well‐established population of the pathogen and not a single isolated event (Marchi et al., 2005). These strains formed a separated cluster from the others when subjected to an AFLP analysis, either because of the same geographic origin or for being levan‐positive (Sisto et al., 2007).

Together with alginate, levan is an important component of the extracellular matrix produced by some representatives of Pseudomonas syringae group. These two high‐molecular‐weight molecules represent an important food storage during starvation, but also a physical barrier against the plant defence compounds during the early stage of infection, escaping the pathogen recognition system (Laue et al., 2006; Mann and Wozniak, 2012). Levan is a fructose polymer whose main chain is composed by β2–6 linkages and branching with β2–1 bonds, derived from the sucrose transfructosylation catalysed by the levansucrase enzyme (EC 2.4.1.10, Lsc) that belongs to family 68 of glycoside hydrolases.

The gene responsible for the levansucrase production has been found in Gram positive bacteria like Bacillus subtilis or Streptococcus mutans, as well as in Gram negative bacteria like Zymomona mobilis and Erwinia amilovora. Interestingly, this gene has been found in all sequenced Pseudomonas syringae strains, with a copy number varying from one (in Psv NCPPB 3335 and Pseudomonas syringae pv. oryzae I_6) to three in Pseudomonas syringae pv. tomato DC3000 and T1 strains, in Pseudomonas savastanoi pv phaseolicola 1448A and in Pseudomonas syringae pv. actinidiae (O'Brien et al., 2011; Luti et al., 2021).

The genetic structure of the genes encoding for the levan production and its regulatory system in Pseudomonas has been thoroughly described in Pseudomonas savastanoi pv. glycinea PG4180 (Hettwer et al., 1998; Li and Ullrich, 2001; Srivastava et al., 2012; Khandekar et al., 2014) and more recently in Pseudomonas syringae pv. actinidiae (Psa) (Luti et al., 2021). It has been ascertained that three copies of the levansucrase gene are present within the genome of these strains, two of which expressed differentially (lscB and lscC) whilst lscA is not expressed at all. Notably, lscA in PG4180 likely derives from Erwinia, while variants of lscB and lscC were found only in Pseudomonas syringae pathovars (Srivastava et al., 2012). Further studies on Pseudomonas savastanoi pv. glycinea PG4180 showed that the main difference between lscA and lscB/C resides in the absence, in lscA, of a 48 bp region at the N‐terminus of lscB/C ORF (MSTSSSAVSQLKNSPL) and the presence instead of a N‐terminus of 21 bp (WSRADAL). In addition, a 450 bp conserved region upstream the lscB/C ORF is not present upstream of lscA. This entire region of about 530 bp shows significant similarity with a pro‐phage borne DNA that prompted its naming as phage‐associated promoter element (PAPE), also referred as com gene (Li and Ullrich, 2001; Srivastava et al., 2012). The transcriptional start site for lscB/C was exactly determined by Khandekar et al. (2014) and located at nucleotide position −339 bp upstream of the translational start codon of lscB/C and it was also demonstrated that the lack of this upstream region in lscA hampers the gene expression.

The pool of information about the levan production in Pseudomonas savastanoi pv. glycinea and Pseudomonas syringae pv. actinidiae leads to the hypothesis that similar structures can be found in the strains of the peculiar levan‐positive Pseudomonas savastanoi pv. savastanoi, even though no information about the complete genome is present in the current literature.

With this work, hence, we aim to carefully reconstruct the complete genome sequence of one representative of the levan‐positive Pseudomonas savastanoi pv. savastanoi, the strain PVFi1, through a hybrid sequencing approach using both Oxford Nanopore and Illumina technologies.

Thus, the genome sequence underwent a meticulous analysis of the gene regions responsible for levan production, i.e. the levansucrase gene and its regulatory system, to assess the presence of orthologous genes, their arrangement and potential functionality, as well as signals of co‐evolution with related bacteria.

The genome was compared to the genomes available in NCBI database of other strains belonging to the same savastanoi pathovar, as well as to other representatives of pathovars fraxini, nerii and pv. retacarpa in order to obtain phylogenetic information and investigate the presence of enriched functions and single core genes between defined groups.

The phylogenetic analysis of the bacterium has been reinforced by the exact depiction of its secretion systems, type III secretion effectors, WHOP genes and other virulence related genes.

Results

Sequencing and annotation

Using the hybrid de novo assembly approach, the genome sequence of Pseudomonas savastanoi pv. savastanoi PVFi1 was arranged in one single circular chromosome of 6 253 686 bp, with a GC content of 57.98% and without any undetermined bases. In addition, two complete circular plasmids were assembled as well: the first one showing 72 349 bp long and the second one 41 097 bp (Fig. 1). The complete genome and the related plasmids have been deposited on the NCBI database under the accession numbers CP078139, CP078140 and CP078141, respectively.

Fig. 1.

Fig. 1

Open in a new tab

A graphical circular map of the de novo assembled PVFi1 genome and related plasmids realized with CGview. From outside to centre, ring 1 and 2 show the CDS, tRNAs and rRNAs annotated by Prokka in forward and reverse strand, ring 3 and 4 the GC content percentage and GC skiew.

The annotation using NCBI PGAP found a total of 5778 genes, 5695 of which are coding. The remaining 83 genes codify for RNA molecules: 16 for rRNAs, 63 for tRNAs and 4 noncoding RNAs. Instead, Prokka identified 5755 CDS on the chromosome, among which 2361 with hypothetical function, 63 tRNAs, 16 rRNAs and 1 tmRNA. Eighty‐three and 53 CDS were found in the two plasmids. Among these CDS, the great part was annotated as a hypothetical protein (50 and 44 CDS, respectively), while most of the remaining others are related to transposase and transposon invertase (21 and 9 CDS, respectively).

Although registered using a different nomenclature, three different chromosomal regions associated with the levan production were identified by both Prokka and PGAP: sacB_1, sacB_2 and sacB_3 (according to Bacillus subtilis nomenclature) in Prokka annotation, while, PGAP annotated them as glycoside hydrolase family 68.

Phylogenetic analysis of 40 MLST genes

The phylogenetic relationships among the 21 Pseudomonas savastanoi strains are depicted in Fig. 2. The strains belonging to the fraxini, nerii and retacarpa pathovars are grouped into distinct clades. The nine strains belonging to the pathovar savastanoi, instead, are divided in two distinct sub‐clades: one including seven strains (indicated in Fig. 2 as sav I) and a second one with only the strains NCPPB 3335 and ICMP 1411 (indicated in Fig. 2 as sav II), as previously found by Moreno‐Pérez et al. (2020).

Fig. 2.

Fig. 2

Open in a new tab

Phylogenetic relationships among Pseudomonas savastanoi strains based on the alignment of 40 MLSA genes. Only the bootstraps value higher than 70 are shown. NCPPB 3335 and ICMP 1411 represent a distinct phylogenetic clade and thus are visualized with a different shade of green than the other savastanoi strains.

Comparative analysis of levansucrase genes in savastanoi pathovars

For a comparative analysis, the sequences of the levansucrase genes lscA, lscB and lscC of Pseudomonas savastanoi pv. glycinea were investigated as described in ‘Identification of the levansucrase genes’ section. The lscA alignment resulted in two different hits corresponding to the first and second half of the levansucrase gene among all the pathovar savastanoi and sharing an average similarity above 99% with Pseudomonas savastanoi pv. glycinea lscA (Table S1). Notably, a third hit with 86% of similarity was obtained from lscA alignment towards PVFi1 and ICMP 13519 genomes, which corresponds to the prokka annotated sacB_1 and sacB_2, respectively. Instead, one single hit (and thus, one single copy) with 99% of similarity to either Pseudomonas savastanoi pv. glycinea lscB/C sequences were obtained from both PVFi1 and ICMP 13519. On the contrary, alignment of lscB/C to the other savastanoi strains showed a low similarity (84% and 87%), leading back to the same genomic region of lscA alignment, confirming that the levansucrase sequences they are bearing are indeed more related to this non‐functional gene than the functional lscB/C (Table S1).

A deeper analysis of the PVFi1 and ICMP 13519 genomic structure confirmed a gene organization similar to the one of lscB/C in glycinea, which comprises all the following features: (i) the page‐associated promoter PAGE including the transcription start site; (ii) the HexR repressor binding domain; (iii) the phagic com gene; (iv) the 48 bp region at the N‐terminal extremity of lsc/sacB_3 gene; and (v) 49–51 bp downstream the coding sequence possibly involved in the formation of a stem‐loop structure for p‐independent transcriptional termination (Fig. 3A). Furthermore, the region upstream the PAGE promoter appeared to have the EAL domain gene exactly as glycinea lscB, while the downstream region is similar to glycinea lscC for the presence of the glycoside idrolase 10 gene, also annotated as YddW protein. Three catalytic sites were also found within the coding sequence (Fig. 3A). The alignment of the regulatory lscR sequence of glycinea (accession number KX834132.1) and of the HexR sequence of savastanoi NCPPB 3335 (NZ_CP008742.1:173178–174044), necessary for levansucrase gene regulation, led to a sequence similarity of 97% and 100%, respectively (Table S1).

Fig. 3.

Fig. 3

Open in a new tab

Schematic representation of the genomic region carrying the levansucrase gene among Pseudomonas species.

A. LscB and lscC gene in Pseudomonas savastanoi pv. glycinea PG4180, Pseudomonas savastanoi pv. savastanoi PVFi1 and Pseudomonas savastanoi pv. savastanoi ICMP 13519.

B. Pseuodomonas syringae strain CFBP 2116 and Pseudomonas amygdali pv. morsprunorum strain R15244. Arrows represent coding sequences in the respective orientation, where the ORF has been annotated as ‘hypothetical protein’. Coloured blocks represent common regions or regulatory elements: the green arrow indicates the position from where the lscB and lscC are aligned, pink block represent the translation start site TSS, cyano block represents the HexR binding sequence, blue block is the 48 N‐terminal region and yellow blocks the catalytic sites, purple block represent the stem‐loop for translational termination.

Thus, the overall structure surrounding the highly conserved coding sequence was reconstructed in a region of 5072 bp that, when blasted, resulted to be 99.90% similar to Pseudomonas syringae pv. morsprunorum strain CFBP 2116 (LT985192.1), Pseudomonas amygdali pv. morsprunorum strain R15244 (CP026558.1) and to Pseudomonas syringae pv. morsprunorum strain CFBP 3840 (LT963409.1) and only 99.45% and 98.36% similar to lscB and lscC of glycinea, respectively, which have been used for the initial alignment (Fig. 3B, Table S2).

In addition, by extending the alignment region upstream and downstream the levansucrase gene, all the genomes of the aforementioned morsprunorum strains, as well as the PVFi1 genome, appeared to bear the same transposase genes belonging either to the Tn3 and IS110 family.

Annotation comparison through MAUVE alignment

Pseudomonas savastanoi pv. savastanoi genomes and their relative annotations were reordered with Mauve towards the reference NCPPB 3335, as detailed in ‘Comparative genomics analysis’ section. However, the analysis highlighted several differences in features organization and nomenclature among the strains.

Some strains resulted to have two features annotated as sacB_1 and sacB_2 (i.e., DAPP PG722 and PseNe107), others showed only one feature as sacB, corresponding to a first fragment of the complete levansucrase gene (i.e., 04589, ICMP 13786, ICMP 1411 and ICMP 4352), while the second fragment was annotated as hypothetical protein. Instead, in the complete circular NCPPB 3335 strain, the two features sacB_1 and sacB_2 appeared interrupted by a transposase insertion (ISPa41), leading to a non‐functional gene (Table S3 and Fig. S1).

As expected by the blast alignment in the ‘Comparative analysis of levansucrase genes in savastanoi pathovars’, PVFi1 strain showed three features related to levansucrase, with two of them (sacB_2 and sacB_3) interspersed within a region enriched in transposase genes. Furthermore, ICMP 13519 showed a sacB_2 feature that could be related to sacB_1 of Psv PVFi1 (data not shown).

Levansucrase PCR validation

In order to verify the gene organization described above, standard PCR reactions were performed to amplify the lscA/sacB_2–3 region and lscBC/sacB_1 in PVFi1 DNA. The results confirmed the in silico reconstructed organization, with the lscA being interrupted by the transposase and giving a product of 889 bp, instead of the 365 bp expected in absence of the transposase as in glycinea or 1542 bp expected with a transposase insertion within the gene, as in NCPPB 3335. On the other hand, the lscB/C gene results to be placed downstream the com gene, as expected (Fig. S2).

Pangenome analysis

The pangenome performed by Anvi'o resulted in a total of 7447 gene clusters with a total of 117 099 genes. Among the gene clusters, 3995 were defined as core genes with 3400 present as single copy per genome (SCG), while 2334 gene clusters were defined as accessory, and thus, present in 2–20 isolates (Fig. 4). Overall, 1115 gene clusters were present only in one isolate with 13 of them present only in Psv PVFi1, mostly with unknown function, besides one that was annotated as a sugar permease NicT. To further find out those functions that are peculiar to the defined levan‐positive group and, thus, to PVFi1 strain, we used the anvi‐get‐enriched‐functions‐per‐pan‐group function within Anvi'o, with both COG functions and Prokka annotation (see supplementary material, Table S4). Interestingly, the assumed group of levan‐positive savastanoi strains (PVFi1 and ICMP 13519) showed to be enriched in a cGAMP‐activated phospholipase (capV), which in Vibrio cholerae confers resistance to bacteriophages. The same group, together with the fraxini and retacarpa isolates, resulted to be enriched in the lipoprotein YddW (COG category S), whose gene was mapped downstream the levan‐coding gene (Fig. 3). Furthermore, transposase and related resolvase, phage‐related proteins belonging to the mobilome COG category X in membrane transport proteins, antitoxin genes and catalytic enzymes related genes were also enriched (Table S4).

Fig. 4.

Fig. 4

Open in a new tab

Pangenome analysis of Pseudomonas savastanoi strains performed with anvi'o. From outside to the inside, the different layers represent the Geometrical and Functional Homogeneity, the single core genome (SCG) clusters, Prokka and COG functional and category annotation. The inner layers represent individual genomes organized regarding their phylogenetic relationships as indicated by the dendrogram, with the dark colour indicating the presence of the gene cluster and the light colour its absence. Psv PVFi1 is enlighten in red. The singletons, accessory and core gene clusters are indicated. Host, pathovar and levan groups used for the enrichment analysis are also indicated.

Secretion systems substrates

Gram‐negative bacteria are known to release either into the surrounding environment or directly inside the host cells, specific proteins called substrates, through the different secretion systems. We assessed the presence of type II, III, IV and VI secretion systems by the alignment of the NCPPB 3335 annotated features from Rodriguez‐Palenzuela et al. (2010) with both PVFi1 genome and annotation. A complete set of 28 genes representing the type II secreted system were identified, including the two distinct groups of Sec and Tat systems, already known among Pseudomonas spp. (Duong et al., 2001, Table S5). The Type III secretion system was represented by 42 genes, including the peculiar gene cluster of 22 genes previously found in Psv NCPPB 3335, Pph 1448A, Pta 11528 and Por 1–6 (Rodriguez‐Palenzuela et al., 2010). Surprisingly, among the 21 genes of NCPPB 3335 type IV secretion system, blastn was able to identify only one hit, the TraA gene. Thus, a deeper analysis was carried out using the SecreT4 database, which identified 22 genes related either to type IVA or IVB. Lastly, 36 genes were related to the type VI secretion system arranged into two expected main clusters (Table S5).

Type III secretion effectors

Recently, more than 14 000 putative T3SEs arranged in 70 different families have been catalogued in the Pseudomonas syringae complex (Dillon et al., 2019). Among those, a selection of 76 effectors belonging to the Pseudomonas savastanoi species, including each single gene variant to have a complete picture of the diversity, was blasted towards Psv PVFi1 genome, as well as to the other savastanoi strains used in this study. The results shown in Fig. 5 and detailed in Table S5 are in agreement with the clustering obtained in phylogenetic tree in Fig. 2. NCPPB 3335 and ICMP 1411 strains represent a stand‐alone cluster, while PVFi1 results closely related to DAPP‐PG722 and PseNe107 strains, as well as to the other in silico levan‐positive ICMP 13589 strain. To be sure that nothing was left behind, the complete database with the 70 families identified by Dillon was blasted, and a further BastionHub prediction analysis was performed, but no more effectors than the savastanoi‐related were identified in PVFi1 strain.

Fig. 5.

Fig. 5

Open in a new tab

Distribution of type III secretion effector genes and variants among the Pseudomonas savastanoi pv. savastanoi strains used in this study. The black block indicates the presence of the effector retrieved by blast alignment; the white block indicates its absence.

Other virulence‐related genes

Pseudomonas species infecting woody plants and belonging to the phylogroup 1 and 3 are characterized by a genomic region defined as WHOP (Woody Host Pseudomonas spp.), as first identified by Rodriguez‐Pelenzuela in NCPPB 3335 (2010) and further extended to 40 additional species by Caballo‐Ponce et al. (2017). This WHOP region contains the antABC operon involved in anthranilate degradation into catechol, which is further degraded by the catABC operon product. To counteract the phenolic compounds produced by the plant as a mechanism of defence, this region carries also the genes necessary for their degradation (the ipoABC operon), which are regulated by the antR gene. Furthermore, in NCPPB 3335 the aerotaxis receptor (PSA3335_3206), the dhoAB operon and the benR regulator of the benABCD operon are associated with the WHOP region. Thus, the perfect alignment of 14 Kb WHOP region of NCPP 3335 downloaded from Genbank proved that the PVFi1 genome carries all the necessary tools to infect the vascular system of the woody plants. In addition, we found out that all the sequences annotated in the reference NCPPB 3335 genome as virulence‐related like adhesins, transporters, motility, chemotaxis proteins, as well as genes involved in the production of the indoleacetic acid and quorum sensing genes, were detected in the PVFi1 strain (Table S5).

Discussion

The results of this study provided a complete genome sequence of one of the levan‐positive Pseudomonas savastanoi pv. savastanoi strains that were unexpectedly identified during an epidemiological survey in Central Italy (Iacobellis et al., 1993). These strains have been previously characterized from a morphological, biochemical and molecular point of view (Marchi et al., 2005; Sisto et al., 2007), but without providing a complete picture of the genetic structure and the regulative elements involved in the levansucrase expression.

This work aimed to fill this gap in knowledge by providing the complete genome, arranged in a circular chromosome and two additional plasmids, obtained through a hybrid assembly of Illumina short reads and Oxford Nanopore Technology (ONT) long reads. Long reads, in fact, allows a better assembly performance of those regions of difficult exploration with only the short Illumina reads, such as those full of transposase or tandem repeats (Goodwin et al. 2016; van Dijk et al., 2018). On the other hand, the depth coverage and higher basecalling quality of the Illumina reads improves the solidity of the whole genetic reconstruction performed by the ONT reads (Chen et al., 2020).

The phylogenetic tree based on Multi Locus Sequence Typing (MLST), the core genome alignment and all the other features including secretion systems, effectors, phytohormones and quorum sensing, firmly place the levan‐positive savastanoi strains within the savastanoi clades. The circular chromosome carries two copies of the levansucrase gene, one related to the lscA (sacB_2 and sacB_3) and the other one to lscB/C (sacB_1) of Pseudomonas savastanoi pv. glycinea PG4180, while no levansucrase gene has been identified in the plasmids.

The first copy related to lscA has the Shine‐Dalgarno sequence just before the starting codon and the N‐terminal sequence WSRADAL, as observed in Erwinia amylovora, Zymomona mobilis, Pseuodomonas savastanoi pv. glycinea and Pseudomonas syringae pv. phaseolicola (Hettwer et al., 1998). The gene, expected to be 1248 bp, seems to be interrupted at position +728 from the translation start site, followed by a ISPa41 transposase gene insertion, as further confirmed by the PCR reactions. The same interruption has been found in the other savastanoi strains that are known to be levan negative and thus, suggesting that this fragmented gene is not functional.

The second copy of the levansucrase gene in PVFi1, as well as in ICMP 13519, is more related to the upstream region of glycinea lscB due to the presence of the EAL‐domain, to the downstream region of glycinea lscC for the presence of the YddW lipoprotein, and shows a 99% of similarity with both of them in the 1296 bp coding sequence. In addition, following the lipoprotein sequence, both the strains carry a muramidase gene that lscC has 2 kb upstream the coding sequence, suggesting a similar genetic rearrangement.

In the pathovar glycinea several regulatory elements have been proved to be necessary for the gene expression and enzymatic activity Hettwer et al., 1998; Li and Ullrich, 2001; Srivastava et al., 2012; Khandekar et al., 2014; Mehmood et al., 2015; Abdallah et al., 2016), which have been also found in our PVFi1 strain: (i) the PAPE region with the com gene; (ii) the transcriptional start site; (iii) the N‐terminal sequence of 48 bp; (iv) the hexose metabolism repressor HexR; (v) the prophage‐borne transcriptional regulator lscR; (vi) the enzyme catalytic sites, defined as block I, block II and block III; and (vii) the stem‐loop region for translation termination. This in silico reconstructed region of 5072 bp when blasted appeared to be more related to Pseudomonas syringae pv. morsprunorum than to Pseudomonas savastanoi pv. glycinea, suggesting a possible exchange of genetic material between the morsprunorum and the levan‐positive savastanoi strains.

This hypothesis is further supported by the presence of sequences related to Tn3 and IS110 transposase gene families that surround the levansucrase genes in both species. Indeed, the transposase TnAS2 of the family Tn3 is found upstream the EAL domain of PVFil, while a ISPsy16 is present 8 Kb further downstream the muramidase gene (data not shown). On the other hand, as example Pseudomonas syringae pv. morsprunorum CFBP 2116 carries a transposase ISPsy16 just downstream of the muramidase gene.

These findings also sustain the hypothesis that an original pro‐phage or transposase insertion may have contributed to the levansucrase gene spread among the Pseudomonas niche (Li and Ulrich, 2001; Srivastava et al., 2012). Indeed, horizontal gene transfer and transposable elements have already been linked to the exchange of avirulence factors and toxins among Pseudomonas syringae strains (Kim et al., 1998; Alarcón‐Chaidez et al., 1999). Indeed, the high number of genes shared with the other pathovars used in this study, as well as the genes related to mobile element and genetic rearrangement revealed with the enrichment analysis, suggest that these strains are prone to exchange genetic material. Thus, further studies on the phylogeny of these transposases would better clarify the potential interaction among these species.

Nonetheless, given that to date only these Italian P. savastanoi strains have been reported as levan positive, it is worth to mention that Psv ICMP 13519, to only other carrying potentially functional levansucrase gene, was isolated by J. Young on 1997 in New Zealand from quarantine olive plants cv frantoio possibly of Italian origin, thus sustaining the geographic origin of these peculiar strains (Young et al., 2004; Iacobellis, personal communication).

In conclusion, these findings support, from a genomic point of view, the results of Iacobellis and Marchi (Iacobellis et al., 1993; Marchi et al., 2005), further suggesting that the LOPAT scheme for Pseudomonas savastanoi should be updated, since this bacterial species can be either levan positive or levan negative.

Experimental procedures

DNA isolation and genome sequencing

An aliquote of the lyophilized stock of the Pseudomonas savastanoi pv. savastanoi strain PVFi1, maintained in the bacterial collection of the Department of Agriculture and Forest Science of the University of Tuscia, was re‐hydrated and grown on King's B (KB) medium at constant temperature of 26°C. High‐molecular‐weight (HMW) DNA was extracted according to Mayjonade et al. (2016). DNA integrity and DNA purity were evaluated in a 0.5% agarose gel electrophoresis run and with Thermo Scientific Multiskan GO (Thermo Fischer Scientific), respectively. The same DNA was quantified by an Invitrogen Qubit fluorimeter (Thermo Fisher Scientific, Massachusetts).

DNA sequencing approach was based on a double sequencing using both ONT, that was accomplished with a MinION Mk1C device (ONT, UK) using a R9.4.1 flow‐cell (ONT), after library preparation using the SQK‐LSK109 kit (ONT), and Illumina technology with a NovaSeq 6000 S2 system, using paired‐end sequencing at Eurofins Genomics (Eurofins Genomics GmbH, Konstanz, Germany).

Genome assembly and annotation

The quality of the paired‐end Illumina reads was evaluated using FastQC (Andrews, 2010), the adapters of the NovaSeq 6000 were removed using Trimmomatic (Bolger et al., 2014) and the low‐quality reads were removed by Sickle (Joshi and Fass, 2011). The basecalling of the ONT long reads was performed using Guppy within the MK1C device, while reads quality and sequencing statistics were evaluated with NanoPlot web‐service v. 1.30.1 (De Coster et al., 2018).

The de novo hybrid assembly of both ONT and Illumina reads was performed using Unicycler v0.4.9b (Wick et al., 2017) with default parameters, except the minimum fasta length that was set to 5.000. Quality assessment of genome assembly was carried out using QUAST 5.0 (Gurevich et al., 2013) and the genomes were graphically visualized using CGview (Petkau et al., 2010). Annotation was performed with the NCBI Prokaryotic Genome Annotation Pipeline (PGAP, Tatusova et al., 2016) and with Prokka for an unbiased comparative genomics analysis (Seemann, 2014).

Phylogenetic analysis

Phylogenetic and comparative genomics analysis were conducted retrieving from NCBI Genomes the complete or draft sequence of eight strains of Pseudomonas savastanoi pv. savastanoi and 12 Pseudomonas savastanoi pathovars (fraxini, nerii and retacarpa). The 20 genomes downloaded from the NCBI database and the genome sequenced in this work are listed in Table 1, together with additional information.

Table 1.

List of Pseudomonas savastanoi strains involved in the comparative genomics and phylogenetic analysis.

Strain name Pathovar Host Geographic origin Accession number
Psf_CFBP5062 fraxini Fraxinus excelsior Netherlands NZ_LIIC01000001.1
Psf_ICMP7712 fraxini Fraxinus excelsior Netherlands NZ_RBSC01000183.1
Psf_ICMP9129 fraxini Fraxinus excelsior Netherlands NZ_RBSA01000336.1
Psf_ICMP9132 fraxini Fraxinus excelsior Netherlands NZ_RBSB01000011.1
Psf_NCPPB1006 fraxini Fraxinus excelsior United Kingdom NZ_NIAW01000001.1
Psn_CFBP5067 nerii Nerium oleander Spain NZ_LIHX01000001.1
Psn_ESC23 nerii Nerium oleander Italy NZ_NIAY01000001.1
Psn_ICMP13781 nerii Nerium oleander Italy NZ_RBTO01000205.1
Psn_ICMP16944 nerii Nerium oleander France NZ_RBUB01000065.1
Psr_CECT4861 retacarpa Retama sphaerocarpa Spain NZ_NBYW01000001.1
Psr_ICMP16946 retacarpa Retama sphaerocarpa Spain NZ_RBQM01000278.1
Psr_ICMP16947 retacarpa Retama sphaerocarpa Not available NZ_RBNM01000403.1
Psv_04859 savastanoi Nerium oleander Not available NZ_RBNY01000535.1
Psv_DAPPPG722 savastanoi Olea europea Italy NZ_JOJV01000001.1
Psv_ICMP13519 savastanoi Olea europea New Zealand NZ_RBNW01000134.1
Psv_ICMP13786 savastanoi Nerium oleander Italy NZ_RBTN01000340.1
Psv_ICMP1411 savastanoi Olea europea California NZ_RBPF01000190.1
Psv_ICMP4352 savastanoi Olea europea Yugoslavia NZ_LJRJ01000054.1
Psv_NCPPB3335 savastanoi Olea europea France CP008742.1
Psv_PseNe107 savastanoi Olea europea Nepal NZ_JYHF01000001.1
Psv_PVFi1 savastanoi Olea europea Italy CP078139
Open in a new tab

To evaluate the phylogenetic relationship among the strains, a MLSA was applied on a set of 40 concatenated housekeeping genes that were aligned with MAFFT using default parameters (Katoh et al., 2018), according to the method used by Moreno‐Pérez et al. (2020). The tree was obtained using the neighbour‐joining method, Jukes–Cantor as substitution model, 100 bootstraps replicates and visualized in a dendrogram using FigTree v1.4.4 (http://tree.bio.ed.ac.uk/software/figtree).

Identification of the levansucrase genes

To identify and characterize the levansucrase gene, the sequences of lscA, lscB and lscC genes of Pseudomonas savastanoi pv. glycinea PG4180 (accession numbers AF037443.1, AF345638.1 and AF346402.1) were aligned to the genomes under investigation using NCBI blastn. The alignment was further visualized with Ugene (Altschul et al., 1990; Okonechnikov et al., 2012).

The validation of the genomic region containing lscA and lscB/C sequences provided by the in silico analysis, was performed by a series of standard PCR reactions using both the lscCf/lscCr primer pair from Marchi et al. (2005) and three additional pairs specifically designed in this study (Table 2): lscAF/lscAR, lscAF/transR and comF (to be used with lscCr).

Table 2.

List of primers and their relative sequences involved in this study.

Primer name Sequence 5′‐3′ References
lscAF AAGACTTTACGGAGGTGAAAACACT This study
lscAR GTCCTGAAAGACATAATGCGGGCGT This study
transR CACCATTATTCATGCCCCAAG This study
comF CCTCCCAAAGCTATTTAAAGG This study
lscCf ATCAGGGCGTGGAGTTGA Marchi et al. (2005)
lscCr GTCTGGAAAGGCTGCTCG Marchi et al. (2005)
Open in a new tab

PCR reactions were prepared as follows: 2 μl of DNA was incubated with 0.5 μM of forward primer and 0.5 μM of reverse primer in 1x master mix buffer, in a final volume of 20 μl. The amplifications were performed with a C1000 thermocycler (Biorad Laboratories, CA., USA) with the following program: initial denaturation for 5 min at 95°C, 35 cycles of denaturation for 30 s at 95°C, annealing for 30 s at 62°C, and extension for 60 s at 72°C, plus a final elongation step for 5 min at 72°C. The PCR products were separated by Midori‐stained agarose gel electrophoresis (1%) in TAE buffer (TRIS‐Acetate‐EDTA, pH 8).

Comparative genomics analysis

All the 21 Pseudomonas genomes listed in Table 1 were first annotated with Prokka v1.14.5 (Seemann, 2014) for an unbiased comparison. The genomes and related annotations were then reordered with MAUVE using savastanoi NCPPB 3335 as reference since, at the time of this research, it was the only one complete assembly. Progressive MAUVE algorithm with default parameters was subsequently used for the alignment (Darling et al., 2004).

The annotated features of NCPPB 3335 strain, including secretion systems, virulence‐related features, phytohormones and WHOP genes (Rodriguez‐Palenzuela et al. 2010; Caballo‐Ponce et al., 2017), were aligned towards the nine savastanoi strains using NCBI blastn, as well as effectors belonging to the Pseudomonas savastanoi species (Dillon et al., 2019).

SecreT4 database was used to identify the type IV secretion system related genes (Bi et al., 2013), while BastionHub was used to predict any further type III effectors (Wang et al., 2021).

Pangenome analysis

Prokka annotation of the 21 Pseudomonas genomes was used as input for the pangenome analysis performed within Anvi'o v.7 docker container (Eren et al., 2015).

Genomes were also annotated within Anvi'o using NCBI's Clusters of Orthologous Groups (COG) database for a functional categories comparison (Tatusov et al., 2000). The pangenome was created setting the following parameters: (i) NCBI blastp for amino acid sequence similarity search, (ii) the default minbit euristic set to 0.5 and (iii) the MCL inflation parameter set to 10, as recommended for the comparison of strains belonging to the same species (https://merenlab.org/2016/11/08/pangenomics-v2/)

Supporting information

Fig. S1. Mauve alignment of the levansucrase genomic region of the nine Pseudomonas savastanoi pv. savastanoi used in this study. Prokka annotation of the levansucrase genes and surrounding ISPa41 transposase and pdtaR are indicated. The red vertical bars represent the contigs interruptions and the coloured green blocks represent genetic similarity.

Click here for additional data file. (376KB, pdf)

Fig. S2. Levansucrase gene validation through Polymerase Chain Reaction (PCR). A) Schematic representation of the PCR primers designed on the lscA and lscB/C genes. Without any transposase insertion, the primers on the lscA gene (lscAF‐lscAR) would led to a PCR product of 365 bp. On the contrary, if lscA is interrupted by the transposase as in Psv NCPPB 3335, the same primers would led to a PCR product of 1,542 bp. Instead, lscAF in combination with a primer designed on the transposase itself, would produce a product of 889 bp. The presence of lscB can be detected using lscCF‐lscCR designed by Marchi et al. 2005, while the com gene can be detected with primers comF‐lscCR, leading to products of 549 and 1,128, respectively.

B) Gel electrophoresis showing the levansucrose genes arrangements in Psv PVFi. Lane M: 100 bp +3Kb Smobio ladder (DM2300); Lane 1: lscAF in combination with lscAR; Lane 2: lscAF in combination with transR. Lane 3: Marchi’s primers lscCF‐lscCR on the levansucrase gene. Lane 4: comF in combination with a reverse primer on the lscB/C gene. Lane 5: No template control.

Click here for additional data file. (239.8KB, pdf)

Table S1. Blastn results of the levansucrase genes lscA, lscB and lscC alignment on the Pseudomonas savastanoi strains under comparison.

Click here for additional data file. (10.6KB, xlsx)

Table S2. Blastn highest similarities of the reconstructed levansucrase region of PVFi1.

Click here for additional data file. (12.1KB, xlsx)

Table S3. Comparison of the of the different fragments of the levansucrase region among the different Pseudomonas savastanoi strains.

Click here for additional data file. (5.7KB, xlsx)

Table S4. Enrichment analysis performed with Anvi’o.

Click here for additional data file. (324.9KB, xlsx)

Table S5. Presence/Absence matrix of the virulence‐related features blasted on the Pseudomonas savastanoi strains under comparison.

Click here for additional data file. (266KB, xlsx)

Acknowledgements

The research was carried out in the frame of the Italian MIUR (Ministry for education, University and Research) initiative ‘Department of Excellence’ (Law 232/2016). All the bioinformatics calculations and analyses were performed at DAFNE HPC scientific computing centre of the Università degli Studi della Tuscia.

Data availability statement

The complete genome and the related plasmids have been deposited on the NCBI database under the accession numbers CP078139, CP078140 and CP078141, respectively. The fastq data that support the findings of this study are available from the corresponding author upon reasonable request.

References

  1. Abdallah, K. , Hartman, K. , Pletzer, D. , Zhurina, D. , and Ullrich, M.S. (2016) The bacteriophage‐derived transcriptional regulator, LscR, activates the expression of levansucrase genes in Pseudomonas syringae . Mol Microbiol 102: 1062–1074. [DOI] [PubMed] [Google Scholar]
  2. Alarcón‐Chaidez, F.J. , Peňaloza‐Vázquez, A. , Ullrich, M. , and Bender, C.L. (1999) Characterization of plasmids encoding the phytotoxin coronatine in Pseudomonas syringae . Plasmid 42: 210–220. [DOI] [PubMed] [Google Scholar]
  3. Altschul, S.F. , Gish, W. , Miller, W. , Myers, E.W. , and Lipman, D.J. (1990) Basic local alignment search tool. J Mol Biol 215: 403–410. [DOI] [PubMed] [Google Scholar]
  4. Andrews, S. (2010). FastQC: a quality control tool for high throughput sequence data. URL https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
  5. Bi, D. , Liu, L. , Tai, C. , Deng, Z. , Rajakumar, K. , and Ou, H.Y. (2013) SecReT4: a web‐based bacterial type IV secretion system resource. Nucleic Acids Res 41: D660–D665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bolger, A.M. , Lohse, M. , and Usadel, B. (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30: 2114–2120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bradbury, J.F. (1986) Guide to Plant Pathogenic Bacteria. Slough, UK: CAB International Mycological Institute. [Google Scholar]
  8. Caballo‐Ponce, E. , Murillo, J. , Martínez‐Gil, M. , Moreno‐Pérez, A. , Pintado, A. , and Ramos, C. (2017) Knots untie: molecular determinants involved in knot formation induced by Pseudomonas savastanoi in woody hosts. Front Plant Sci 8: 1089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen, Z. , Erickson, D.L. , and Meng, J. (2020) Benchmarking hybrid assembly approaches for genomic analyses of bacterial pathogens using Illumina and Oxford Nanopore sequencing. BMC Genomics 21: 631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Darling, A.C.E. , Mau, B. , Blattner, F.R. , and Perna, N.T. (2004) Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Res 14: 1394–1403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. De Coster, W. , D’Hert, S. , Schultz, D.T. , Cruts, M. , and Van Broeckhoven, C. (2018) NanoPack: visualizing and processing long‐read sequencing data. Bioinformatics 34: 2666–2669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. De Los Rios, J.E.G. (1999) Retama sphaerocarpa (L.) Boiss., a new host of Pseudomonas savastanoi . Phytopathol Mediterr 38: 54–60. [Google Scholar]
  13. Dillon, M.M. , Almeida, R.N.D. , Laflamme, B. , Martel, A. , Weir, B.S. , Desveaux, D. , and Guttman, D.S. (2019) Molecular evolution of Pseudomonas syringae type III secreted effector proteins. Front Plant Sci 10: 418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Duong, F. , Bonnet, E. , Géli, V. , Lazdunski, A. , Murgier, M. , and Filloux, A. (2001) The AprX protein of Pseudomonas aeruginosa: a new substrate for the Apr type I secretion system. Gene 262: 147–153. [DOI] [PubMed] [Google Scholar]
  15. Dworkin, M. (2006) The prokaryotes. In Proteobacteria: Gamma Subclass, 3rd ed, Vol. 6. New York, NY: Springer‐Verlag. [Google Scholar]
  16. Eren, A.M. , Esen, O.C. , Quince, C. , Vineis, J.H. , Morrison, H.G. , Sogin, M.L. , and Delmont, T.O. (2015) Anvi'o: an advanced analysis and visualization platform for ‘omics data. PeerJ 3: 1–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gardan, L. , Bollet, C. , Ghorrah, M.A. , Grimont, F. , and Grimont, P.A.D. (1992) DNA relatedness among the pathovar strains of pseudomonas syringae subsp. savastanoi Janse (1982) and proposal of pseudomonas savastanoi sp. nov. Int J Syst Bacteriol 42: 606–612. [Google Scholar]
  18. Goodwin, S. , McPherson, J.D. , and McCombie, W.R. (2016) Coming of age: ten years of next‐generation sequencing technologies. Nat Rev Genet 17: 333–351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gurevich, A. , Saveliev, V. , Vyahhi, N. , and Tesler, G. (2013) QUAST: quality assessment tool for genome assemblies. Bioinformatics 29: 1072–1075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hettwer, U. , Jaeckel, F.R. , Boch, J. , Meyer, M. , Rudolph, K. , and Ullrich, M.S. (1998) Cloning, nucleotide sequence, and expression in Escherichia coli of Levansucrase genes from the plant pathogens Pseudomonas savastanoi pv. glycinea and P. syringae pv. phaseolicola . Appl Environ Microbiol 64: 3180–3187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Iacobellis, N.S. , Caponero, A. , and Evidente, A. (1998) Characterization of Pseudomonas syringae ssp. savastanoi strains isolated from ash. Plant Pathology 47: 73–83. [Google Scholar]
  22. Iacobellis, N.S. , Sisto, A. , and Surico, G. (1993) Occurrence of unusual strains of Pseudomonas syringae subsp. savastanoi on olive in Central Italy. EPPO Bulletin 23: 429–435. [Google Scholar]
  23. Janse, J.D. (1982) Pseudomonas syringae subsp. savastanoi (ex Smith) subsp. nov., nom. rev., the bacterium causing excrescences on Oleaceae and Nerium oleander L. Int J Syst Evol Mycrobiol 32: 166–169. [Google Scholar]
  24. Joshi, N. & Fass, J. (2011). Sickle: a sliding‐window, adaptive, quality‐based trimming tool for FastQ files. URL https://github.com/najoshi/sickle
  25. Katoh, K. , Rozewicki, J. , and Yamada, K.D. (2018) MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform 20: 1160–1166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Khandekar, S. , Srivastava, A. , Pletzer, D. , Stahl, A. , and Ullrich, M.S. (2014) The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae. BMC Microbiol 14: 79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kim, J.F. , Charkowski, A.O. , Alfano, J.R. , Collmer, A. , and Beer, S.V. (1998) Sequences related to transposable elements and bacteriophages flank avirulence genes of Pseudomonas syringae . Mol Plant Microb Interact 11: 1247–1252. [Google Scholar]
  28. Laue, H. , Schenk, A. , Li, H. , Lambertsen, L. , Neu, T.R. , Molin, S. , and Ullrich, M.S. (2006) Contribution of alginate and levan production to biofilm formation by Pseudomonas syringae . Microbiology 152: 2909–2918. [DOI] [PubMed] [Google Scholar]
  29. Lelliott, R.A. , Billing, E. , and Hayward, A.C. (1966) A determinative scheme for the fluorescent plant pathogenic Pseudomonads . J Appl Bacteriol 29: 470–489. [DOI] [PubMed] [Google Scholar]
  30. Li, H. , and Ullrich, M.S. (2001) Characterization and mutational analysis of three allelic lsc genes encoding levansucrase in Pseudomonas syringae . J Bacteriol 183: 3282–3292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Luti, S. , Campigli, S. , Ranaldi, F. , Paoli, P. , Pazzagli, L. , and Marchi, G. (2021) Lscβ and lscγ, two novel levansucrases of Pseudomonas syringae pv. actinidiae biovar 3, the causal agent of bacterial canker of kiwifruit, show different enzymatic properties. Int J Biol Macromol 179: 279–291. [DOI] [PubMed] [Google Scholar]
  32. Mann, E.E. , and Wozniak, D.J. (2012) Pseudomonasbiofilm matrix composition and niche biology. FEMS Microbiol Rev 6: 893–916. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Marchi, G. , Cinelli, T. , and Surico, G. (2011) A review on Pseudomonas savastanoi genetic traits involved in disease development and in symptom induction. In Olive Disease and Disorders: Kerala, India: Transworld Research Network. [Google Scholar]
  34. Marchi, G. , Viti, C. , Giovannetti, L. , and Surico, G. (2005) Spread of levan‐positive populations of Pseudomonas savastanoi pv. savastanoi, the causal agent of olive knot, in Central Italy. Eur J Plant Pathol 112: 101–112. [Google Scholar]
  35. Mayjonade, B. , Gouzy, J. , Donnadieu, C. , Pouilly, N. , Marande, W. , Callot, C. , et al. (2016) Extraction of high‐molecular‐weight genomic DNA for long‐read sequencing of single molecules. Biotechniques 61: 203–205. [DOI] [PubMed] [Google Scholar]
  36. Mehmood, A. , Abdallah, K. , Khandekar, S. , Zhurina, D. , Srivastava, A. , Al‐Karablieh, N. , et al. (2015) Expression of extra‐cellular levansucrase in Pseudomonas syringae is controlled by the in planta fitness‐promoting metabolic repressor HexR. BMC Microbiol 15: 48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Moreno‐Pérez, A. , Pintado, A. , Murillo, J. , Caballo‐Ponce, E. , Tegli, S. , Moretti, C. , et al. (2020) Host range determinants of Pseudomonas savastanoi pathovars of woody hosts revealed by comparative genomics and cross‐pathogenicity tests. Front Plant Sci 11: 1–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Moretti, C. , Vinatzer, B.A. , Onofri, A. , Valentini, F. , and Buonaurio, R. (2017) Genetic and phenotypic diversity of Mediterranean populations of the olive knot pathogen, Pseudomonas savastanoi pv. savastanoi. Plant Pathol 66: 595–605. [Google Scholar]
  39. O'Brien, H.E. , Desveaux, D. , and Guttman, D.S. (2011) Next‐generation genomics of Pseudomonas syringae . Curr Opin Microbiol 14: 24–30. [DOI] [PubMed] [Google Scholar]
  40. Okonechnikov, K. , Golosova, O. , Fursov, M. , Varlamov, A. , Vaskin, Y. , Efremov, I. , et al. (2012) Unipro UGENE: a unified bioinformatics toolkit. Bioinformatics 28: 1166–1167. [DOI] [PubMed] [Google Scholar]
  41. Osman, W.A. , Tarabeih, A.M. , and Michail, S.H. (1980) Studies on the distribution of olive knot disease induced by Pseudomonas savastanoi in Iraq. Mesopotamia J Agric 15: 245–261. [Google Scholar]
  42. Petkau, A. , Stuart‐Edwards, M. , Stothard, P. , and Van Domselaar, G. (2010) Genome analysis interactive microbial genome visualization with GView. Bioinformatics 26: 3125–3126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Quesada, J.M. , Penyalver, R. , Pérez‐Panadés, J. , Salcedo, C.I. , Carbonell, E.A. , and López, M.M. (2010) Dissemination of pseudomonas savastanoi pv. savastanoi populations and subsequent appearance of olive knot disease. Plant Pathol 59: 262–269. [Google Scholar]
  44. Rahi, Y.J. , Turco, S. , Taratufolo, M.C. , Tatì, M. , Cerboneschi, M. , Tegli, S. , et al. (2020) Genetic diversity and population structure of Pseudomonas savastanoi, an endemic pathogen of the Mediterranean area, revealed up to strain level by the MLVA assay. J Plant Pathol 102: 1051–1064. [Google Scholar]
  45. Rodríguez‐Palenzuela, P. , Matas, I.M. , Murillo, J. , López‐Solanilla, E. , Bardaji, L. , Pérez‐Martínez, I. , et al. (2010) Annotation and overview of the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 draft genome reveals the virulence gene complement of a tumour‐inducing pathogen of woody hosts. Environ Microbiol 12: 1604–1620. [DOI] [PubMed] [Google Scholar]
  46. Schroth, M.N. (1973) Quantitative assessment of the effect of the olive knot disease on olive yield and quality. Phytopathology 63: 1064. [Google Scholar]
  47. Seemann, T. (2014) Prokka: rapid prokaryotic genome annotation. Bioinformatics 30: 2068–2069. [DOI] [PubMed] [Google Scholar]
  48. Sisto, A. , Cipriani, M.G. , Tegli, S. , Cerboneschi, M. , Stea, G. , and Santilli, E. (2007) Genetic characterization by fluorescent AFLP of pseudomonas savastanoi pv. Savastanoi strains isolated from different host species. Plant Pathol 56: 366–372. [Google Scholar]
  49. Srivastava, A. , Al‐Karablieh, N. , Khandekar, S. , Sharmin, A. , Weingart, H. , and Ullrich, M.S. (2012) Genomic distribution and divergence of Levansucrase‐coding genes in Pseudomonas syringae . Genes 3: 115–137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Tatusov, R.L. , Galperin, M.Y. , Natale, D.A. , and Koonin, E.V. (2000) The COG database: a tool for genome‐scale analysis of protein functions and evolution. Nucleic Acids Res 28: 33–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Tatusova, T. , Dicuccio, M. , Badretdin, A. , Chetvernin, V. , Nawrocki, E.P. , Zaslavsky, L. , et al. (2016) NCBI prokaryotic genome annotation pipeline. Nucleic Acids Res 44: 6614–6624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. van Dijk, E.L. , Jaszczyszyn, Y. , Naquin, D. , and Thermes, C. (2018) The third revolution in sequencing technology. Trends Genet 34: 666–681. [DOI] [PubMed] [Google Scholar]
  53. Völksch, B. , and Weingart, H. (1997) Comparison of ethylene‐producing Pseudomonas syringae strains isolated from kudzu (Pueraria lobata) with Pseudomonas syringae pv. phaseolicola and Pseudomonas syringae pv. glycinea . Eur J Plant Pathol 103: 795–802. [Google Scholar]
  54. Wang, J. , Li, J. , Hou, Y. , Dai, W. , Xie, R. , Marquez‐Lago, T.T. , et al. (2021) BastionHub: a universal platform for integrating and analyzing substrates secreted by gram‐negative bacteria. Nucleic Acids Res 49: 651–659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Wick, R.R. , Judd, L.M. , Gorrie, C.L. , and Holt, K.E. (2017) Unicycler: resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput Biol 13: e1005595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Young, J.M. , Dye, D.W. , Bradbury, J.F. , Panagopoulos, C.G. , and Robbs, C.F. (1978) A proposed nomenclature and classification for plant pathogenic bacteria. N Z J Agric Res 21: 153–177. [Google Scholar]
  57. Young, J.M. , Wilkie, J.P. , Fletcher, M.J. , Park, D.C. , Pennycook, S.R. , Triggs, C.M. , et al. (2004) Relative tolerance of nine olive cultivars to Pseudomonas savastanoi causing bacterial knot disease. Phytopathol Mediterr 43: 395–402. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1. Mauve alignment of the levansucrase genomic region of the nine Pseudomonas savastanoi pv. savastanoi used in this study. Prokka annotation of the levansucrase genes and surrounding ISPa41 transposase and pdtaR are indicated. The red vertical bars represent the contigs interruptions and the coloured green blocks represent genetic similarity.

Click here for additional data file. (376KB, pdf)

Fig. S2. Levansucrase gene validation through Polymerase Chain Reaction (PCR). A) Schematic representation of the PCR primers designed on the lscA and lscB/C genes. Without any transposase insertion, the primers on the lscA gene (lscAF‐lscAR) would led to a PCR product of 365 bp. On the contrary, if lscA is interrupted by the transposase as in Psv NCPPB 3335, the same primers would led to a PCR product of 1,542 bp. Instead, lscAF in combination with a primer designed on the transposase itself, would produce a product of 889 bp. The presence of lscB can be detected using lscCF‐lscCR designed by Marchi et al. 2005, while the com gene can be detected with primers comF‐lscCR, leading to products of 549 and 1,128, respectively.

B) Gel electrophoresis showing the levansucrose genes arrangements in Psv PVFi. Lane M: 100 bp +3Kb Smobio ladder (DM2300); Lane 1: lscAF in combination with lscAR; Lane 2: lscAF in combination with transR. Lane 3: Marchi’s primers lscCF‐lscCR on the levansucrase gene. Lane 4: comF in combination with a reverse primer on the lscB/C gene. Lane 5: No template control.

Click here for additional data file. (239.8KB, pdf)

Table S1. Blastn results of the levansucrase genes lscA, lscB and lscC alignment on the Pseudomonas savastanoi strains under comparison.

Click here for additional data file. (10.6KB, xlsx)

Table S2. Blastn highest similarities of the reconstructed levansucrase region of PVFi1.

Click here for additional data file. (12.1KB, xlsx)

Table S3. Comparison of the of the different fragments of the levansucrase region among the different Pseudomonas savastanoi strains.

Click here for additional data file. (5.7KB, xlsx)

Table S4. Enrichment analysis performed with Anvi’o.

Click here for additional data file. (324.9KB, xlsx)

Table S5. Presence/Absence matrix of the virulence‐related features blasted on the Pseudomonas savastanoi strains under comparison.

Click here for additional data file. (266KB, xlsx)

Data Availability Statement

The complete genome and the related plasmids have been deposited on the NCBI database under the accession numbers CP078139, CP078140 and CP078141, respectively. The fastq data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Environmental Microbiology Reports are provided here courtesy of Wiley

RESOURCES