Skip to main content
New Microbes and New Infections logoLink to New Microbes and New Infections
. 2022 Jun 30;48:100999. doi: 10.1016/j.nmni.2022.100999

Beneficial role of skim milk against drug-resistant Escherichia coli associated with pediatric diarrhoea

K Chellapandi 1,4, S Subbarayan 2, S De Mandal 2, L Ralte 3, N Senthil Kumar 2, TK Dutta 1,, I Sharma 4
PMCID: PMC9305617  PMID: 35873064

Abstract

Background

Antibiotic-resistance in E. coli is a global issue affecting humans especially the pediatric population. Antibiotic-resistant E. coli is a pathogen frequently pediatric population as well as healthy adults.

Methods

This study aimed to examine the antibiotic resistance of E. coli causing pediatric diarrhea and its drug-resistant rates, its adhering abilities to cell line in vitro, and inhibition efficiency of a few selected chemical compounds. Clinical strains were isolated from both the healthy and infected pediatric population of Mizoram.

Results

Adhesion is a significant pathogenic process during bacterial infections, which has been employed for pathotyping of DEC by comparing adhesion efficiency in both normal (CHO-k1) and cancer (HeLa) cell lines. E. coli adherent pathotypes were identified by both PCR assay and in-vitro cell adhesion assays; the study also evaluated the adhesion inhibition ability of human skimmed milk, gentamicin, and cephalexin in-vitro. Of all isolates, 20.05% of adherent DEC (EPEC, DAEC, and EIEC) and 11.39 % of non-adherent DEC (STEC and ETEC) were found to be associated with pediatric diarrhoea in Mizoram. Human skimmed milk has a high potential adhesion inhibition against EAEC (50.25/90.90 μg/mL), EPEC (53.42/259.70 μg/mL), and EIEC (59.13/30.30 μg/mL) in both cell lines in comparison with gentamicin and cephalexin.

Conclusion

This study concludes that as a dietary supplement-human skimmed milk has high potential to prevent adhesion of DEC pathotypes in cells in-vitro thus in in-vivo.

Keywords: Adherent E. coli, cell culture, CHO-k1, diarrheagenic E. coli, E. coli pathotypes, HeLa, virulent genes

Introduction

The infectious diarrheal disease takes the second position as a leading cause of morbidity and mortality in developing countries amongst the pediatric population aged below 5 years with an incidence of 2.3 million annual deaths in Indian children [2,3]. Of the bacterial pathogens, diarrheagenic Escherichia coli (DEC) is an important etiological agent causing endemic and epidemic diarrhea worldwide; although DEC pathotypes cause diarrhea with similar symptoms but show type-specific pathological changes in gut epithelial cells in in-vitro proved by earlier studies [17]. The information regarding host tissue-specific adhesion patterns of virulent E. coli pathotypes on normal epithelial cell lines is scanty. The human cancer cells create a complex heterogeneity environment compared with normal cells for the biochemical interactions between its cell surface and microbes [21]. Hence the present study was intended to analyze adhesion patterns of the pathogenic E. coli strains on both cancerous (HeLa) and non-cancerous (CHO-k1) cell lines.

It is important to understand the complex interactions between pathogenic bacteria and human tissues in-vivo for effective treatment by using in-vitro cell lines as models. The human milk contains glycans, glycol-conjugates which act as secretory immunoglobulin A (sIgA), and lactoferrin that has bactericidal properties are having the ability to inhibit gut pathogens in HeLa cell lines [23]. Thus the current study formulated with the hypothesis whether the human skimmed milk (1% fat) and buttermilk have a similar effect as the antibiotics in inhibiting the attachment of bacterial pathogens against both normal and cancerous cell lines in-vitro.

Materials and methods

Isolation and characterization of diarrheal E. coli pathotypes

Collection of samples

The diarrheic faecal samples from the children aged 0–60 months were collected from three major Hospitals (Aizawl Civil Hospital, Aizawl Hospital & Research Centre, and Synod Hospital) in Aizawl district, Mizoram Northeast India. Out of 262 samples, 210 samples were collected from children suffering from diarrhea with or without blood or mucus and the rest 52 samples were obtained from apparently healthy children but were admitted to the hospital for non-diarrheal illness. The faecal samples were plated on MacConkey agar and incubated at 37°C for 24 h, after incubation, the colonies of selective morphology indicating E. coli were selected for further characterization and identification by Standard Bacteriological methods [7]. The identified pure isolates were stocked into glycerol and stored at -20°C.

Serotyping

Serotyping of the E. coli isolates based on “O” antigen was carried out at National Salmonella and Escherichia Centre, Central Research Institute (CRI), Himachal Pradesh, India.

Molecular detection of diarrheagenic E. coli pathotypes

Identification of virulence genes by multiplex PCR

From the overnight cultures grown at 37°C in Luria Bertani broth (HI Media, India), the genomic DNA extracted using DNeasy blood and tissue kit (Qiagen, Inc., Valencia, CA) and plasmid DNA was purified by Genejet Plasmid DNA purification Kit (Thermo Scientific, USA). The isolated genomic and plasmid DNA are subjected to PCR-based screening targeting specific virulence markers of EAEC, EPEC, DAEC, and EIEC by using a different set of primers listed in the Table 1 [11,25]. The multiplex PCR reaction mixture contained 2.5 μl of 10X PCR buffer with 1.5 mM of MgCl2, 1 μl each primer, 2 μl of 10 mM each of dNTPs, 0.2 μl of 5.0 U Taq DNA polymerase and 4.0 μl template DNA. The PCR reaction condition includes initial denaturation at 95 oC for 5 min, followed by 32 cycles of denaturation at 94°C for 45 sec, annealing at 57°C for 45 sec (for EPEC, EIEC, and EAEC) at 60°C for 45 sec (for DAEC), and extension at 72°C for 1 min followed by a final extension at 72°C for 5 min [25].

Table 1.

List of Primers used in this study to detect diarrheagenic E. coli (DEC) pathotypes

Pathotypes Virulent markers (product size-bp) Sequence (5′- 3′) Annealing temp. References
EPEC eaeA (229) F TGATAAGCTGCAGTCGAATCC 57 oC Hegde et al., 2012
R CTGAACCAGATCGTAACGGC
bfpA (450) F CACCGTTACCGCAGGTGTGA
R GTTGCCGCTTCAGCAGGAGT
EAEC CVD432 (630) F CTGGCGAAAGACTGTATCAT 55 oC
R CAATGTATAGAAATCCGCTGTT
EIEC Ial (320) F CTGGTAGGTATGGTGAGG 57 oC
R CCAGGCCAACAATTATTTCC
DAEC daaE (542) F GAACGTTGGTTAATGTGG GGTAA 60 oC Vidal et al., 2005
R TATTCACCGGTCGGTTATCAG T
EHEC hlyA (534) F GCATCATCAAGCGTACGTTCC 55 oC Hegde et al., 2012
R AATGAGCCAAGCTGGTTAAGCT
STEC Stx1 (180) F ACACTGGATGAATCTCAGTGG 55 oC Shetty et al., 2012
R CTGAATCCCCTCCATTATG
Stx2 (225) F CCATGACAACGGACAGCAGTT
R CCTGTCAACTGAGCAGCACTTTG
ETEC elt (322) F CTCTATGTGCACACGGAGC 55 oC Hegde et al., 2012
R CCATACTGATTGCCGCAAT
Stla (170) F TCTTTCCCCTCTTTTAGTCAGTC
R CCGCACAGGCAGGATTAC

Cell lines and culture medium

HeLa and CHO-k1 cells (1 × 106 cells/mL) (NCCS, Pune) were seeded with DMEM supplemented with 1% mannose (DMEM-mannose) without FBS on 6 well plates containing sterile poly L-lysine coated glass cover slips (Tarsons, India). The cells were incubated at 37 oC with 5% CO2. An amount of 100 μl of overnight bacterial cultures of selected E. coli strains to contain 3 × 108 bacteria/mL was added to the wells and incubated for 3 hours [7]. After incubation, the unattached bacteria were removed by washing with 1x PBS, the cells were fixed with 4% paraformaldehyde and stained with 10% Giemsa stain for 15 minutes. At least 100 fields were observed under a microscope to detect the number of bacteria adhered to the cells and counted [8]. The strains that adhered to the monolayers were recorded as adhering in localized (LA), localized-like (LAL), diffuse (DA), or aggregative (AA) patterns [22]. All tests were repeated at least two times as the duplicates helped to eliminate the potential technical errors, the bacterial adherence was calculated for each preparation by the standard error of mean using SPSS 17 software.

Enumeration of adherent bacteria

HeLa and CHO-k1 cells were co-inoculated with bacterial culture as the method motioned above and incubated at 37oC with 5% CO2 for 3 hours. After incubation, unattached bacteria were removed by washing with 1xPBS, the OD values were detected to compare with OD values of blank media taken before inoculation and calculated the percentage of adherence to find out the level of adherence by a particular E. coli pathotypes. For further confirmation to find the level of adherence the cells were also plated in MacConkey agar and incubated at 37°C for 18 h for the colony counting. Data were expressed as Log CFU per well.

Bacterial inhibition assay

HeLa and CHO-k1 cells were co-inoculated with bacterial culture as the method motioned above and incubated at 37oC with 5% CO2 for 3 h for cell adhesion. The cells were washed thrice with 1X PBS (pH 7.4) for the removal of non-adherent bacterial cells. The HeLa and CHO-k1 cells containing adherent bacterial cells were incubated with the different inhibitory concentrations (20, 40, 60, 80, and100 μg/mL) of cephalexin (CN), buttermilk, and human skimmed milk (20, 40, 60, 80, and100 μg/mL) for 3 h at 37°C and control (without antimicrobial agents) wells were also included for each inhibitory agent. After incubation, the adherent bacterial cells remain in the cell lines were extracted and plated on MacConkey agar medium. The CFU was calculated for each concentration. The percentage inhibition of cell adhesion for each concentration was calculated and compared with control [26].

Statistical analysis

The prevalence of diarrheagenic E. coli in patient and control samples was compared by a two-tailed X2 test with Yates correction and Fisher's exact test. When analyzing the adherence to HeLa and CHO-k1 cell lines with different dilutions, and to detect the minimal inhibitory concentration of antibiotics in cell lines were expressed as means of SD and SEM. Statistical significance was tested by the two-tailed non-paired Student's t-test (SPSS.17). A P-value of < 0.05 was considered significant among the values of tests.

Results

Molecular detection of diarrheagenic E. coli pathotypes

A total of 334 E. coli isolates were recovered from the faecal samples of pediatric diarrheal patients. All the 334 diarrheagenic E. coli isolates lysates were subjected to the PCR based virulent marker detection assays. Among the isolates, 31.44% (105 of 334) isolates carried pathogenic virulent genes and 68.56% (229 of 334) isolates were non-pathogenic which does not carry the selected virulent genes confirmed by multiplex PCR using gene-specific primers (Table 1). Pathogenic isolates were further classified into two types based on the virulence and cytological effects on cell monolayers such as non-toxigenic adherent pathotypes (20.05%) which include EAEC, EPEC, EIEC, and DAEC and adherent toxigenic pathotypes (11.37%) which included the strains of STEC, ETEC, and EHEC.

The first type isolates are EPEC 14.97% (50 of 334) which have both eaeA and bfpA genes containing EAF plasmid; this EPEC has been further classified into two subtypes such as typical EPEC (tEPEC) 8.68% (29 of 334), which carried both eaeA and bfpA genes and atypical EPEC (aEPEC) 6.28%, (21 of 334) which carried the eaeA gene alone. The Second type was EIEC 2.40% (8 of 334) which carried virulent gene ial which was a part of the plasmid of invasion (pInv). The third and fourth types were DAEC 0.90% (3 of 334) and EAEC 1.80% (6 of 334) which carried the virulent genes daaE for diffuse adherence and pCVD432 which occurred in DAEC and EAEC respectively (Fig.1A).

Fig. 1.

Fig. 1

Distribution and adhesion pattern of E. coli pathotypes associated with pediatric diarrhoea in Mizo children. A. Distribution of diarrheagenic E. coli isolates. B. Adhesion pattern of E. coli pathotypes on HeLa and CHO-k1.

Screening of pathological interaction between diarrheagenic E. coli pathotypes and cell monolayers

In cell monolayer adhesion assay, all the adherent pathogenic isolates showed strong adhesion against HeLa and CHO-k1 cell lines. The pattern of isolates adherence to monolayers of human cancer (HeLa) and non-cancerous (CHO-k1) cells were classified into four types such as localized (LA), localized-like (LAL), diffuse (DA), or aggregative (AA) patterns (Table 2) (Fig. 1A). The AA pattern was observed from 8.96% (6 of 67) of EAEC isolates on HeLa and CHO-k1 monolayer and 1.49% (1 of 67) DAEC on HeLa monolayer only. The LAL pattern was observed from both atypical and typical EPEC. The typical EPEC on HeLa monolayer was (4.47%, 3 of 67 isolates) and the CHO-k1 monolayer was 1.49%, (1 of 67 isolates). Similarly, the LA pattern was also observed from both atypical, typical EPEC, and EIEC. Atypical EPEC at 11.9% (8 of 67 isolates), typical EPEC at 29.8% (20 of 67 isolates), and EIEC (1.49%, 1 of 67 isolates) on the CHO-k1 monolayer were detected with LA pattern. The DA pattern was observed from 2.98% (2of67) of DAEC isolates, 7.46% (5of67) of EIEC isolates on HeLa monolayer and 4.47% (3 of 67) of DAEC isolates, 10.4% (7 of 67) EIEC isolates were observed on CHO monolayer (Fig. 1B).

Table 2.

Cellular adherence and Molecular profiles of E. coli pathotypes

Strain no. E. coli pathotypes Serotype Seasonal Adherence pattern
Genetic profile Resistance profile
HeLa cell line CHO-k1 cell line
D-21 EAEC O55 Winter AA AA CVD432+ blaTEM,blaCMY2
D-54 EAEC O141 Summer AA AA CVD432+ blaTEM,blaCTX-M-15
D-29 EPEC (t) O22 Summer LA LA eaeA + bfpA+ blaTEM
D-36 EPEC (t) O22 Summer LA LA eaeA + bfpA+ blaTEM
D-59 EPEC (a) O86 Summer LAL LAL eaeA + bfpA- blaCTX-M-15
LR-141 DAEC UT Autumn/rainy DA DA daaE+ blaCTX-M-15
LR-142 DAEC O128 Autumn/rainy DA DA daaE+ blaCTX-M-15
LR-143 DAEC O141 Autumn/rainy AA DA daaE+ -Nil-
D-12 EIEC O96 Summer LA DA ial+ blaSHV
LR-128 EIEC O124 Monsoon DA DA ial+ blaTEM

EAEC – Enteroaggregative Escherichia coli, EPEC-Enteropathogenic Escherichia coli, DAEC-Diffusely adherent Escherichia coli, EIEC- Entero-invasive Escherichia coli, LA-localized adherence, LAL-localized-like adherence, DA-diffuse adherence, AA-aggregative adherence patterns.

Sero-grouping of the pathogenic E. coli isolates based on “O” antigen

The diarrheagenic E. coli of this study mostly belongs to the following serotypes including O22, O141, O124, O128, O86, O5, O96, and UT. The O antigen serotypes of all the strains included in this study with their virulence profile, origin, antibiotic resistance profile is shown in Table 2.

Enumeration of bacterial adhesion

The percentage of an adherent pattern of different pathotypes varies from cancerous (HeLa) and non-cancerous (CHO-k1) cell monolayers in in-vitro adhesion assay. The bundle forming pilus containing typical EPEC isolates showed stronger adhesion (Adh++) in both HeLa and CHO-k1 cell lines but the adherent percentage was high in cancerous HeLa cells (60%) when compared with normal CHO–K1 cells (20%). Similarly, the pCVD432 gene carried EAEC isolates showed an adhesive adhesion (Adh+) in both HeLa and CHO-k1 cell lines but the adherent percentage was high in cancerous HeLa cells (20%) when compared with normal CHO–K1 cells (10%). DAEC and EIEC isolates were showed non-adhesion (Adh-) on HeLa monolayer and CHO-k1 monolayers (Fig. 3) (Table 3).

Fig. 3.

Fig. 3

Percentage adhesions of pathotypes in HeLa and CHO-k1 cell lines.

Table 3.

Quantitative adhesion of bacterial isolates on HeLa and CHO-k1 cell lines

S. No Strains Adhesion on HeLa cells
Adhesion on CHO-k1 cells
(%) Level (%) Level
1. D-21 42.6 ± 0.9 + 70.0 ± 0.5 ++
2. D-54 44.7 ± 0.6 + 39.4 ± 0.3 +
3. D-29 90.0 ± 9.3 ++ 60.7 ± 53.0 ++
4. D-36 58.3 ± 2.4 ++ 32.5 ± 1.4 +
5. D-59 59.3 ± 3.2 ++ 60.7 ± 2.3 ++
6. LR-141 13.7 ± 1.3 55.5 ± 0.7 ++
7. LR-142 16.1 ± 14.9 90.0 ± 8.7 ++
8. LR-143 26.7 ± 0.2 24.7 ± 0.2
9. D-12 27.7 ± 0.4 26.4 ± 0.2
10. LR-128 33.3 ± 0.6 + 34.8 ± 0.3 +

(++) strong adhesive; (+) adhesive; (-) non adhesive.

Effect of minimum inhibitory concentration of antibiotics against bacterial adhesion

Adhesion inhibition of different pathotypes was observed in two different methods of inhibition in-vitro that by cell monolayers and Luria Bertani broth dilution assay. The adhesion inhibition of antibiotics, buttermilk, and skimmed milk was dose-dependent in in-vitro cell monolayer adhesion assay. The adhesion inhibition (MIC) of Buttermilk in HeLa cell monolayer containing EACE, EPEC, DAEC, and EIEC was similar with CHO-k1 cell monolayer. But, the adhesion inhibition (MIC) of cephalexin against pathogens in HeLa cell monolayer was lower than MIC needed for CHO-k1 cell monolayer. In Luria Bertani broth dilution assay, MIC of buttermilk against pathotypes were 4, 8, 8, and 4 μg/mL, respectively which is very low in comparison with the results got from the cell lines. Similarly, MIC of cephalexin and human skimmed milk against pathotypes were also recorded.

In adhesion inhibition (MIC) of human skimmed milk on HeLa cell monolayer containing pathotypes were very low than CHO-k1 cell monolayer containing pathotypes. As a whole, the result revealed that the minimal inhibitory concentration required by all the components were greatly lower in broth medium as compared to cell lines especially against the normal cell lines (CHO-k1 monolayers).

Further, this study revealed that human skimmed milk has a lethal effect on adhesion inhibition of EPEC pathotypes in both CHO-k1 and HeLa cell lines. Followed by cephalexin and buttermilk showed adhesion inhibition with higher concentrations in both cell lines.

Discussion

Diarrhea remains an important health issue for the pediatric population worldwide. Adhesion to the host cell is the prime process in any infection for colonization and subsequent consequences of the disease. In infectious diarrhea, after adhesion, the pathogens invade the intestinal tissues which lead to the penetration of inner organs and cause systemic infections. Of all the bacterial pathogens causing infectious diarrhoea, E. coli predominates in infantile diarrhoea, so the different adherent pathotypes of diarrheagenic E. coli prevalent among children of Mizoram is taken for the current study.

Earlier some studies carried out to investigate the adhesion mechanisms of E. coli in different cell lines and inhibition of adhesion by different components in-vitro. Similarly, this current study with few changes in the protocols checks the adherence pattern of all the different E. coli pathotypes but in both normal (CO-k1) and cancer (HeLa) cell lines. Unlike, the other studies, this study used food components containing probiotics such as buttermilk and commercial human skim milk powder to check its efficiency inhibiting the adhesion process of E. coli pathotypes in comparison with the customary antibiotics i.e., cephalexin. To prevent enteric infections, it is a must to stop the colonization and adhesion of pathogens to the gut epithelium by either killing or by blocking the pathogens colonization factors. Of all the inhibitors studied extensively earlier, reports regarding food supplements efficiency against all the different pathotypes of E. coli are not found. Hence, the current study investigates the efficiency of buttermilk and skim milk powder (commercial) against all the pathotypes of E. coli in the in-vitro model.

Diarrheagenic E. coli causes mild to severe diarrhoea in children and infants, efficient therapy against DEC infection is lacking, as E. coli are neglected in stool cultures as it belonged to a normal gut flora of human. Current treatment is based on fluid replacement and supportive care; however, increasing knowledge on DEC virulence factors and mechanism of infections has contributed to the development of new treatment policies including inhibition of quorum sensing, use of strain-specific bacteriocins, and inhibition of strain binding to their host receptor with antibodies or ligands [20]. In this study, we tested the efficiency of food supplements as an alternative approach to interfere with DEC infections, which may avoid the complications which are seen while using antibiotics during therapy.

EPEC are those strains belongs to specific E. coli serogroups (O groups) and produce a characteristic LA or LAL adherence pattern in tissue culture and also based on the carriage of adherent cum virulent markers (eaeA and bfpA) which are then classified as atypical (aEPEC) and typical (tEPEC) [3,9,18]. Clonal analyses of the classical EPEC serogroups (O26, O55, O86, O126, and O128) were detected in this present study and corroborates with previous reports [9,22,26]. The previous studies reported that EAEC pathotypes have an aggregative adhesion (AA) on HEp-2 cell lines which is induced by a specific gene (pCVD) carrying plasmid (Fig. 2) [4,5]. This study confirmed the correlation of the virulent marker pCVD with the pattern of adherence in cell lines. EIEC strains cause watery diarrhoea and dysentery in humans; the lack of epidemiological attention to EIEC is related to the low incidence of this pathogen as a cause of diarrhoea concerning other strains of diarrheal E. coli [27].

Fig. 4.

Fig. 4

MIC (minimum inhibitory concentration) values and percentage of inhibition of E. coli pathotypes in HeLa and CHO cell lines. A- inhibition against EAEC, B- inhibition against EPEC, C- inhibition against DAEC, and D- inhibition against EIEC.

Fig. 2.

Fig. 2

Giemsa stained images of co-cultures of Bacterial strains with HeLa and CHO cell lines. Upper panel: HeLa cell line (A, B- localized adherence (LA) and localized-like adherence (LAL) pattern of Adhesion and C-aggregating Adherence (AA) adhesion pattern of bacterial strains). Lower panel: CHO K1 cell line (D, E- localized adherence (LA) and localized-like adherence (LAL) pattern of Adhesion, and F- aggregating adherence (AA) adhesion pattern of bacterial strains).

Despite earlier reports, this current study detects a significant correlation between DAEC isolates and diarrhoea; however, most of the children in the present study carried DAEC were between the ages of 12 to 36 months, which suggested that this particular age group may be a vulnerable one for the DAEC pathotypes [2,14]. This data also found that the non-breastfeeding infants were at high risk for the infection with DAEC strains which may be connected to deprived innate immunity. These findings led us to check the efficiency of milk-based food supplements against DEC.

Buttermilk contains water-soluble components such as milk protein, lactose, minerals, and also milk fat globule membrane (MFGM) derived from milk. Skim milk powder contains very little fat (<0.5%) compared with buttermilk (>5%) which may be due to the presence of MFGM fractions, small milk fat globules, and free lipids that were not extracted during the churning process [13,24]. Earlier studies found that the immunoglobulins found in buttermilk are more reactive than the ones found in skimmed milk powder, which is also evident here in this study as in both the cell lines more MIC was required for skim milk powder to inhibit the adhesion of pathogens (Table 4).

Table 4.

Inhibitory concentrations of antimicrobial agents on HeLa and CHO-k1 cell lines against diarrheal E. coli pathotypes

Pathotypes MIC on HeLa cell lines
MIC on CHO-k1 cell lines
MIC on nutrient broth (broth dilution method)
Gentamicin (μg/mL) Cephalexin (μg/mL) Skimmed milk fragments (μg/mL) Gentamicin (μg/mL) Cephalexin (μg/mL) Skimmed milk fragments (μg/mL) Gentamicin (μg/mL) Cephalexin (μg/mL) Skimmed milk fragments (μg/mL)
EAEC 69.56∗ 67.71∗ 50.25+ 69.57∗ 75.39 190.90# 4.0 0.75+ 0.5+
EPEC 73.70+ 67.53 53.42+ 73.70+ 72.55 259.70# 8.0∗ 8.0 16.0+
DAEC 87.05 69.20∗ 72.73∗ 87.05 79.92 130.30# 8.0∗ 8.0∗ 12.0#
EIEC 83.71 68.95∗ 59.13∗ 83.71 84.82 83.88# 4.0 8.0∗ 24.0#

P < 0.05 significant p < 0.05; +p < 0.01; #p < 0.001.

Many epidemiological studies of diarrhoea have shown that breast-feeding protects infants from intestinal and respiratory infections [12,15,19]. Milk contains maternal antibodies triggered by infection lead to an active immune response that is relevant to a particular infection and subsequently will protect infants. Studies proved the role of immunoglobulin and non-immunoglobulin elements present in human milk in protecting the host from the diarrheal pathogens [1,10,18]. Such findings verify the interaction between milk elements and bacterial pathogens, their role in inhibiting the adherence to cultured cells. This current study also confirmed the reports of similar earlier studies that have pointed out the significant role of human skimmed milk and buttermilk antimicrobial activity against diarrheal pathogens; hence this could be used to boost the innate immunity in children and adults [6,16,18].

Although skim milk and buttermilk are in use as a food supplement in pediatric nutrition, complications or irreversible reactions in humans are not reported. The foremost benefit of its use would be that does not encourage any resistance in bacterial strains as an antibiotic does which is the major issue in the medical field. The effects of inhibitory concentrations of antimicrobials on bacterial growth were studied by comparing the number of colony-forming units after growth in the absence or presence of antibiotics (data not shown).

Cell numbers were decreased by about 20% in a few cultures but were not affected in most cases. Cephalexin has also produced such similar effects but with higher MIC concentrations; such findings were also observed by Vidya et al., against the E. coli of urine sample origin [26].

Interestingly, our work detected that the significant role of food supplements to block the adhesion of all E. coli pathotypes including the multidrug-resistant strains carrying β-lactam enzymes onto both normal and cancerous cells.

CHO-k1 may express receptors similar to those in the human intestine, as both cells belong to the normal epithelial cell lines and are derived from non-cancerous hosts. Furthermore, an adhesive E. coli has been shown to have a similar degree of adhesion for CHO-k1 and fetal enterocytes [5]. These data are suggesting that the CHO-k1 may be particularly suitable for use in the study of E. coli, which was thought to have properties of intestinal epithelial tissues.

Conclusion

In conclusion, the cell lines are a great model to prove the bacterial pathologic mechanism and effect of antimicrobials on adhesion or inhibition of pathogens. Human skimmed milk and buttermilk show a great effect to inhibit the adherence of E. coli pathotypes on both the cell lines with small concentrations in comparison with antibiotics used for the treatment of diarrheal pathogens in hospital settings. The main advantage of human skim milk and buttermilk is not inducing any allergic reactions or complications as it is seen with most antibiotics used in infants and children. It is a good dietary supplement next to breast milk and this supplement can be used in both children and adults for the treatment or prevention of diarrheagenic E. coli. This will bring a change in empirical therapy of pediatric diarrheal diseases, as it can be used along with antibiotics without interacting to cause contradictory effects; and never inducing antibiotic resistance among the pediatric diarrheal pathogens.

Authors' contributions and credits

All the authors have contributed equally in bringing out the data and compilation of this research article. (A). Conception: KC, TKD, NSK, SS and IS; (B). Design of Work: CK, LR, SM, NSK, SS; (C). Acquisition and analysis: SS, SM, TKD, IS and LR; (D). Interpretation of data: KC, SS, SM, LR, NSK, TKD and IS; (E). Drafting and Revision: TKD, LR, IS and SM.

All the authors have approved the submitted version (and any substantially modified version that involves the author's contribution to the study); And also have agreed both to be personally accountable for the author's own contributions and to ensure that questions related to the accuracy or integrity of any part of the work, even ones in which the author was not personally involved, are appropriately investigated, resolved, and the resolution documented in the literature.

Ethics approval and consent to participate

Ethics approval is received from the concern hospitals and patients to participate for sample collection.

Consent for publication

It is to certify that all authors have seen and approved the final version of the manuscript being submitted. They warrant that the article is the authors' original work, hasn't received prior publication and isn't under consideration for publication elsewhere.

Availability of data and materials

All data generated or analysed during this study are included in this published article [and its supplementary information files].

Conflict of interest

The authors declare that they have no competing interests.

Funding

This work has not received fund from any agencies in the public, commercial, or not-for-profit sectors.

Acknowledgments

Authors are highly thankful to Dr. D. Kathiresan, Dean, CVSc & AH, CAU, Selesih, Aizawl for granting permission to carry out the work and to the Director, RIPANS, Zemabawk, Aizawl for their constant support. The authors are also thankful to the DBT, New Delhi, India funded project on ADMaC for the laboratory equipment support in CVSc & A.H, Selesih, and Advanced State Level Biotech Hub, Mizoram University for the infrastructural facility to conduct the work. The authors are thankful to National Salmonella and Escherichia Centre, Central Research Institute (CRI), Kasauli - Himachal Pradesh, India for assisting in the Serotyping of all the E. coli isolates.

Contributor Information

K. Chellapandi, Email: karuppskl27@gmail.com.

S. Subbarayan, Email: sarath07bio@gmail.com.

S. De Mandal, Email: surajit_micro@yahoo.co.in.

L. Ralte, Email: raltelalsanglura643@gmail.com.

N. Senthil Kumar, Email: nskmzu@gmail.com.

T.K. Dutta, Email: tapandutta@rediffmail.com.

I. Sharma, Email: drsharma7652@gmail.com.

References

  • 1.Ann E.L., Chloe A.A., Sophia D.E., Lars B., Victor N. Human milk oligosaccharides protect bladder epithelial cells against uropathogenic Escherichia coli invasion and cytotoxicity. The J Infect. Dis. 2014;209:389–398. doi: 10.1093/infdis/jit464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Babatunde W.O., Jennifer H., Aaron O.A., Iruka N.O. Diarrhoeagenic Escherichia coli in mother-child pairs in ile-ife, south-western Nigeria. BMC Infect Dis. 2016;16(28):1–9. doi: 10.1186/s12879-016-1365-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bassani D.G., Kumar R., Aswathi S., Morris S.K., Paul V.K., Shet A., Ram U., Gaffey M.F., Black R.E., Jha P., Million Death Study Collaborators Causes of neonatal and child mortality in India: a nationally representative mortality survey. The Lancet. 2010 Nov 27;376(9755):1853–1860. doi: 10.1016/S0140-6736(10)61461-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Benevides-Matos N., Pieri F.A., Penatti M., Orlandi P.P. Adherence and virulence genes of Escherichia coli from children diarrhea in the Brazilian Amazon. Braz J Microbiol. 2015;46(1):131–137. doi: 10.1590/S1517-838246120130917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Casandra W., Philipson Josep B.R., Raquel H. Animal models of Enteroaggregative Escherichia coli infection. Gut Microbe. 2013;4(4):281–291. doi: 10.4161/gmic.24826. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Christie G.T., Theresa J.O. The role of maternal breast milk in preventing infantile diarrhea in the developing world. Curr Trop Med Rep. 2014;1(2):97–105. doi: 10.1007/s40475-014-0015-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Collee J.G., Miles R.S., Watt B. Tests for identification of bacteria. Mackie McCartney Pract Med Microbiol. 1996;14:131–149. (Reprint-2014) [Google Scholar]
  • 8.Del Re B., Sgorbati B., Miglioli M., Palenzona D. Adhesion, autoaggregation and hydrophobicity of 13 strains of Bifidobacterium longum. Lett Appl Microbiol. 2000 Dec;31(6):438–442. doi: 10.1046/j.1365-2672.2000.00845.x. [DOI] [PubMed] [Google Scholar]
  • 9.Dulguer M.V., Fabbricotti S.H., Bando S., Moreira-Filho C.A., Fagundes-Neto U., Scaletsky I.C. Atypical enteropathogenic Escherichia coli strains: phenotypic and genetic profiling reveals a strong association between enteroaggregative E. coliheat-stable enterotoxin and diarrhea. J Infect Dis. 2003;188:1685–1694. doi: 10.1086/379666. [DOI] [PubMed] [Google Scholar]
  • 10.Gaetano C., Roberto M., Sheila C., Chiara F., Antonella G. Anti-infective properties of human milk. J Nutr. 2008;138:1801S–1806S. doi: 10.1093/jn/138.9.1801S. [DOI] [PubMed] [Google Scholar]
  • 11.Hegde A., Ballal M., Shenoy S. Detection of diarrheagenic Escherichia coli by multiplex PCR. Indian J Med Microbiol. 2012 Jul 1;30(3):279. doi: 10.4103/0255-0857.99485. [DOI] [PubMed] [Google Scholar]
  • 12.Ilse T., Jessica K.J., Hein R., Vincent J., Oscar F., Albert H., Johan J., Henrie È.M. Breastfeeding and the risk of respiratory tract infections after infancy: the Generation R Study. PLoS One. 2017;12(2) doi: 10.1371/journal.pone.0172763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Jean F.S., Guillaume L.B., Philippe V., Mario J., Josée H. Interactions of intestinal bacteria with components of the intestinal mucus. Front Cell Infect Microbiol. 2017;7:387. doi: 10.3389/fcimb.2017.00387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Karuppasamy C., Ralte L., De Mandal S., Kumar N.S., Dutta T.K., Sharma I. Diffusely adherent E. coliBurden in low socio-economic pediatric population. J Med Bacteriol. 2019;8(5, 6):44–55. [Google Scholar]
  • 15.Kovar M.G., Serdula M.K., Marks J.S., Fraser D.W. Review of the epidemiologic evidence for an association between infant feeding and infant health. Pediatrics, Suppl. 1984;74:615–638. [PubMed] [Google Scholar]
  • 16.MonaciL, Tregoat V., Arjon J., Hengel V., Anklam E. Milk allergens, their characteristics and their detection in food: a review. Eur Food Res. Tech. 2006 doi: 10.1007/s00217-005-0178-8. [DOI] [Google Scholar]
  • 17.Nataro J.P., Kaper J.B. Diarrheagenic escherichia coli. Clin Microbiol Rev. 1998 Jan 1;11(1):142–201. doi: 10.1128/cmr.11.1.142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Palmeira P., Carbonare S.B., Silva M.L.M., Trabulsi L.R., Carneiro-Sampaio M.M.S. Inhibition of enteropathogenic Escherichia coli (EPEC) adherence to HEp-2 cells by bovine colostrum and milk. Allergo Let Immunopathol. 2001;29(6):229–237. doi: 10.1016/s0301-0546(01)79064-7. [DOI] [PubMed] [Google Scholar]
  • 19.Quigley M.A., Carson C., Sacker A., Kelly Y. Exclusive breastfeeding duration and infant infection. Eur J Clin Nutr. 2016;70(12):1420–1427. doi: 10.1038/ejcn.2016.135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ruano-Gallego D., Yara D.A., Di Ianni L., Frankel G., Schuller S., Ferna´ndez L.A. A nanobody targeting the translocated intimin receptor inhibits the attachment of enterohemorrhagic E. colito human colonic mucosa. PLoS Pathog. 2019;15(8) doi: 10.1371/journal.ppat.1008031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sanchez-Villamil J., Tapia-Pastrana G., Navarro-Garcia F. Pathogenic lifestyles of E. coliPathotypes in a standardized epithelial cell model influence inflammatory signaling pathways and cytokines secretion. Front Cell .Infect Microbiol. 2016;6:120. doi: 10.3389/fcimb.2016.00120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Scaletsky I.C., Fabbricotti S.H., Carvalho R.D., Nunes C.R., Maranhão H.D., Morais M.B., Riley L., Fagundes-Neto U. Diffuse and enteroaggregative patterns of adherence of Escherichia coli isolated from stools of children in northeastern Brazil. Braz J Microbiol. 2001 Dec;32(4):313–319. [Google Scholar]
  • 23.Silva M.L.M., Giampaglia C.M.S. Colostrum and human milk inhibit localized adherence of enteropathogenic Escherichia coli to HeLa cells. Acta Paediat. 1992;81:266–267. doi: 10.1111/j.1651-2227.1992.tb12219.x. [DOI] [PubMed] [Google Scholar]
  • 24.Sodini I., Morin P., Olabi A., Jiménez-Flores R. Compositional and functional properties of buttermilk: a comparison between sweet, sour and whey buttermilk. J Dairy Sci. 2006;89:525–536. doi: 10.3168/jds.s0022-0302(06)72115-4. [DOI] [PubMed] [Google Scholar]
  • 25.Vidal M., Kruger E., Durán C., Lagos R., Levine M., Prado V., Toro C., Vidal R. Single multiplex PCR assay to identify simultaneously the six categories of diarrheagenic Escherichia coli associated with enteric infections. J Clin Microbiol. 2005 Oct 1;43(10):5362–5365. doi: 10.1128/JCM.43.10.5362-5365.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Vidya K.C., Mallya P.S., Rao P.S. Inhibition of bacterial adhesion by sub inhibitory concentration of antibiotics. Indian J Med Microbiol. 2005;23(2):102–105. doi: 10.4103/0255-0857.16048. [DOI] [PubMed] [Google Scholar]
  • 27.Vieira N., Bates S.J., Solberg O.D., Ponce K., Howsmon R., Cevallos W., Trueba G., Riley L., Eisenberg J.N. High prevalence of entero-invasive Escherichia coli isolated in a remote region of Northern Costal Ecuador. Am J Trop Med Hyg. 2007;76(3):528–533. [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analysed during this study are included in this published article [and its supplementary information files].


Articles from New Microbes and New Infections are provided here courtesy of Elsevier

RESOURCES