Skip to main content
PeerJ logoLink to PeerJ
. 2022 Jul 19;10:e13639. doi: 10.7717/peerj.13639

Engineering a tunable bicistronic TetR autoregulation expression system in Gluconobacter oxydans

Monica Bertucci 1, Ky Ariano 1, Meg Zumsteg 1, Paul Schweiger 1,
Editor: Joseph Gillespie
PMCID: PMC9306550  PMID: 35873911

Abstract

Acetic acid bacteria are well-known for their ability to incompletely oxidize their carbon sources. Many of the products of these oxidations find industrial uses. Metabolic engineering of acetic acid bacteria would improve production efficiency and yield by allowing controllable gene expression. However, the molecular tools necessary for regulating gene expression have only recently started being explored. To this end the ability of the activation-dependent Plux system and two constitutive repression Ptet systems were examined for their ability to modulate gene expression in Gluconobacter oxydans. The activation-dependent Plux system increased gene expression approximately 5-fold regardless of the strength of the constitutive promoter used to express the luxR transcriptional activator. The Ptet system was tunable and had a nearly 20-fold induction when the tetR gene was expressed from the strong constitutive promoters P0169 and P264, but only had a 4-fold induction when a weak constitutive promoter (P452) was used for tetR expression. However, the Ptet system was somewhat leaky when uninduced. To mitigate this background activity, a bicistronic TetR expression system was constructed. Based on molecular modeling, this system is predicted to have low background activity when not induced with anhydrotetracycline. The bicistronic system was inducible up to >3,000-fold and was highly tunable with almost no background expression when uninduced, making this bicistronic system potentially useful for engineering G. oxydans and possibly other acetic acid bacteria. These expression systems add to the newly growing repertoire of suitable regulatable promoter systems in acetic acid bacteria.

Keywords: Promoter, Induction, Expression, Plasmid, β-D-Glucuronidase UidA, GFP, Acetic acid bacteria

Introduction

Acetic acid bacteria (AAB) are a unique group of organisms that incompletely oxidize their carbon and energy substrates (e.g. sugars, polyols, alcohols). This incomplete oxidation is done using a set of membrane-bound dehydrogenases that are oriented toward the periplasmic space and release their products into the medium (Deppenmeier & Ehrenreich, 2009; Prust et al., 2005). This feature has been widely used in the production of vinegar, vitamin C, 6-amino-L-sorbose to produce the antidiabetic drug miglitol, tanning agents (dihydroxyactone and erythrulose), and flavor and fragrance products (Deppenmeier, Hoffmeister & Prust, 2002; Wang et al., 2016).

The ability to express target genes in acetic acid bacteria is of recent interest, especially in the industrially important genera Gluconobacter, Gluconacetobacter, Komagataeibacter, Acetobacter, and Acidiphilium. Gene expression allows basic research into the physiology and metabolism of these bacteria, as well as for genetic and metabolic engineering. To date most engineering in AAB has been done using constitutive promoters (Blank & Schweiger, 2018; Kallnik et al., 2010; Kiefler, Bringer & Bott, 2015; Kosciow et al., 2014; Merfort et al., 2006; Meyer, Schweiger & Deppenmeier, 2013; Siemen et al., 2018; Yuan et al., 2016). However, regulatable expression is often desired. Despite this, few regulatable systems have been reported and those that have are often reported to be leaky, resulting in low induction ratios (reviewed in: (Fricke et al., 2021b)). For example, the well-studied LacI system had low induction and high leakiness in the AAB Gluconobacter spp. and K. xylinus (Condon, FitzGerald & O’Gara, 1991; Liu et al., 2020). Similarly, the acyl homoserine lactone (AHL) inducible LuxR-Plux had high expression, but only 4-fold induction in free-living cells due to leakiness in uninduced K. rhaeticus (Florea et al., 2016). Recently two systems for regulatable gene expression in Gluconobacter oxydans have been reported, a L-arabinose-inducible AraC-PBAD system and an ATc-inducible Tn10-based TetR-dependent system. The L-arabinose-inducible AraC-PBAD system was reported to have low background leakiness and was inducible to 480-fold (Fricke et al., 2020). Interestingly, a similar system in K. rhaeticus was highly leaky and had low induction (Teh et al., 2019). While the Tn10-based TetR-dependent system was tightly regulated and is highly tunable in G. oxydans, a similar system was leaky and had low induction in K. rhaeticus (Florea et al., 2016; Fricke et al., 2021b). This highlights differences in control within the AAB despite their high evolutionary similarity (Cleenwerck et al., 2009; De Vuyst et al., 2008; Papalexandratou et al., 2009). Therefore, the response in each host must be confirmed prior to use.

To address the problem of low induction and leaky gene expression in AAB, we investigated the use of the LuxR-Plux system and a bicistronic TetR-dependent system for tightly regulated gene expression in G. oxydans using a pBBR1MCS-2 plasmid backbone. While both systems were regulatable, the amount of basal level expression varied between these systems. While the LuxR-Plux system showed strong induction, it lacked the ability for tunable expression of the bicistronic TetR system. These regulatory systems will add to the growing ability to control gene expression in AAB.

Materials and Methods

Bacterial strains and culture conditions

Gluconobacter oxydans 621H (DSMZ 2343) was routinely grown at 30 °C and 250 rpm in yeast mannitol (YM) or yeast glucose (YG) medium (6 g/L yeast extract, 20 g/L mannitol or glucose, 2.5 g/L MgSO4 × 7 H2O, 1 g/L (NH4)2SO4, 1 g/L KH2PO4, pH 6.0) with 50 μg/ml cefoxitin. Escherichia coli strains (Table 1) were grown in lysogeny broth (LB; 5g/L yeast extract, 10 g/L tryptone, 10 g/L sodium chloride) at 37 °C and 250 rpm. Agar was added to 1.5% when making solid medium. Kanamycin or ampicillin were added to 50 or 100 μg/ml for plasmid maintenance (Table 1). G. oxydans was transformed either by conjugation with E. coli S17-1 or by electroporation (Kallnik et al., 2010; Kiefler, Bringer & Bott, 2017). Competent E. coli 10β and E. coli JM109 were prepared by the TSS method (Chung, Niemela & Miller, 1989).

Table 1. Strains, plasmids, and primers.

Strain Description Source
G. oxydans 621H Wildtype DSMZ 2343
E. coli DH5α fhuA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17 New England Biolabs
E. coli S17-1 recA pro hsdR RP4-2-Tc::Mu-Km::Tn7 integrated into the chromosome, strR spcR tmpR. ATCC 47055
E. coli 10β Δ(ara-leu) 7697 araD139 fhuA ΔlacX74 galK16 galE15 e14- ϕ80dlacZΔM15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 Δ(mrr-hsdRMS-mcrBC) New England Biolabs
E. coli JM109 endA1, recA1, gyrA96, thi, hsdR17 (rk−, mk+), relA1, supE44, Δ(lac-proAB), [F′ traD36, proAB, laqIqZΔM15] Promega
Plasmids Description Source
pBBR1MSC-2 Broad-host-range derivative of pBBR1MCS; KmR Kovach et al. 1995)
pBBR1p264-SPpelB-Streplong pBBR1MCS-2 derivative containing the 5´-UTR of gox0264, an elongated C-terminal Streptag II and the signal sequence of pelB; KanR (Zeiser et al. 2014)
pBBRp452-ST pBBR1MCS-2 (Kovach et al. 1995) derivative containing the 5´-UTR of gox0452 and a C-terminal Streptag II; KanR (Kallnik et al., 2010)
pASK-IBA3 Tetracycline inducible expression plasmid; AmpR IBA GmBH
pUC57pTet pUC57 containing the Ptet promotor (iGEM BBa_R0040), RBS (iGEM BBa_B0034), the pASK-IBA3 MCS region, and the iGEM BBa_B0010 transcriptional terminator; AmpR GenScript
p264TetR pBBR1p264-SPpelB-Streplong derivative containing the TetR gene from pASK-IBA3 This study
p452TetR pBBR1p452-ST derivative containing the TetR gene from pASK-IBA3 This study
p0169TetR p452TetR derivative containing the G. oxydans p0169 promoter rather than the G. oxydans p452 promoter This study
pTET0169-uidA p0169TetR derivative containing the Tet regulon and MCS from pUC57pTet, and the uidA reporter gene This study
pTET264-uidA p264TetR derivative containing the Tet regulon and MCS from pUC57pTet, and the uidA reporter gene This study
pTET452-uidA p452TetR derivative containing the Tet regulon and MCS from pUC57pTet, and the uidA reporter gene This study
p264LuxR pBBR1p264-SPpelB-Streplong derivative containing the LuxR gene from A. fischeri This study
p452LuxR pBBR1p452-ST derivative containing the containing the LuxR gene from A. fischeri This study
p0169LuxR p452LuxR derivative containing the G. oxydans p0169 promoter rather than the G. oxydans p452 promoter This study
pLUX0169-uidA p0169LuxR derivative containing the Plux promotor (iGEM parts BBa_R0062), RBS (iGEM BBa_B0034), pASK-IBA3 MCS region, and the iGEM BBa_B0010 transcriptional terminator This study
pLUX264-uidA p264LuxR derivative containing the Plux promotor (iGEM parts BBa_R0062), RBS (iGEM BBa_B0034), pASK-IBA3 MCS region, and the iGEM BBa_B0010 transcriptional terminator This study
pLUX452-uidA p452LuxR derivative containing the Plux promotor (iGEM parts BBa_R0062), RBS (iGEM BBa_B0034), pASK-IBA3 MCS region, and the iGEM BBa_B0010 transcriptional terminator This study
pUC57miniBicis pUC57-mini derivative containing the Tetracycline-inducible bicistronic system from pZH512 (Hensel, 2017); AmpR GenScript
pBICISTRON pBBR1p452-ST containing the bicistronic tetracycline-inducible system This study
Primers Sequencea Endonuclease
EcoRI/RBS/tetR_F ATGAGAATTCAAAGAGGAGAAATACTAGATGTCTCGTTTAGATAAAAG EcoRI
MluI/RBS/tetR_F ATGAACGCGTAAAGAGGAGAAATACTAGATGTCTCGTTTAGATAAAAG MluI
TetR_R ATGAAAGCTTTTAAGACCCACTTTCACAT HindIII
p0169_F ATGCAGAGCTCTGAAAGCGGCTGGCGCGT SacI
p0169_R ATGCAGAATTCGCGGAAGGCGTTATACCCTGA EcoRI
pTet_F GCTCGAATGCCCCAGGGTC PasI
pTet_R CGAGCGCATTGTATACGAG Bst1107I
BsaI_uidA_F ATGGTAGGTCTCAAATGTTACGTCCTGTAGAAACCCCAAC BsaI
BsaI_uidA_R ATGGTAGGTCTCATATCATTGTTTGCCTCCCTGCTGCGG BsaI
EcoRI/RBS/luxR_F ATGAGAATTCAAAGAGGAGAAATACTAGATGAAAAACATAAATGCCGAC EcoRI
MluI/RBS/luxR_F ATGAACGCGTAAAGAGGAGAAATACTAGATGAAAAACATAAATGCCGAC MluI
luxR_R ATGAGGTCTCAAGCTGTTAATTTTTAAAGTATGGGC BsaI
TetBicis_F GTGCTCGAATGCGAGCTC SacI
TetBicis_R CACGAGCGCATTATTAATATAAAACG VspI

Note:

a

Restriction endonuclease recognition site is underlined.

Materials and molecular techniques

Standard molecular techniques were done according to manufacturer’s protocols or by standard protocols (Sambrook, Fritsch & Maniatis, 1989). The GeneJet Plasmid Miniprep kit (Thermo Fisher Scientific, Waltham, MA, USA) was used to purify plasmids and the GenElute Bacterial Genomic DNA kit (Millipore-Sigma, St. Louis, MO, USA) used to extracted genomic DNA. DNA was amplified using Phusion DNA polymerase and DreamTaq polymerase, and cloning done with FastDigest restriction enzymes and T4 ligase that were purchased from Thermo Fisher Scientific. Eurofins Genomics supplied all primers and sequencing services to confirm plasmids (Louisville, KY, USA) (Table 1).

Plasmid construction

The tetR gene was amplified from pASK-IBA3 (IBA Lifesciences GmbH, Göttingen, Germany) using Phusion DNA polymerase and cloned into the MluI or EcoRI and HindIII sites of pBBR1p264-SPpelB-streplong and pBBR1p452-ST such that there were 6 bp between tetR and its RBS, creating p452TetR and p264TetR (Table 1). P0169 was amplified from G. oxydans DNA and inserted into the SacI and EcoRI sites of p452TetR to create p0169TetR. The Ptet promotor (iGEM BBa_R0040), ribosomal binding site (iGEM BBa_B0034), a MCS region containing both BsaI restriction sites from pASK-IBA3 (IBA Lifesciences GmbH, Göttingen, Germany), and the iGEM BBa_B0010 transcriptional terminator was synthesized and cloned into pUC57 by GenScript (Piscataway, NJ, USA) (Table 1). This Ptet-MCS-terminator region was amplified using pTet_F and pTet_R primers and inserted into the PasI and Bst1107I sites of the p0169TetR, p264TetR, and p452TetR plasmids. Additionally, the uidA gene encoding the β-D-glucuronidase from E. coli DH5α was amplified and inserted into the BsaI sites of the p0169TetR, p264TetR, and p452TetR to create pTET0169-uidA, pTET264-uidA, pTET452-uidA, having 7 bp between uidA and its RBS. All plasmids were confirmed by sequencing.

The luxR gene (iGEM BBa_C0062) was synthesized by GenScript, amplified with Phusion DNA polymerase, and inserted into the MluI or EcoRI and BsaI of pBBR1p264-SPpelB-streplong or pBBR1p452-ST such that there were 9 bp between luxR and its RBS, creating p452LuxR and p264LuxR (Table 1). P0169 was amplified from G. oxydans DNA and inserted into the SacI and EcoRI sites of p452LuxR to create p0169LuxR. The Plux promotor (iGEM BBa_R0062), ribosomal binding site (iGEM BBa_B0034), MCS region containing two BsaI restriction sites derived from pASK-IBA3 (IBA GmbH), and the iGEM BBa_B0010 transcriptional terminator was synthesized by Eurofins Genomics (Louisville, KY, USA). The synthesized fragment was cut with PasI and Bst1107I and ligated into similarly cut p0169LuxR, p264LuxR, and p452LuxR. The uidA gene encoding the β-D-glucuronidase from E. coli DH5α was also amplified and inserted into the BsaI sites of p0169LuxR, p264LuxR, and p452LuxR, having 10 bp between uidA and its RBS to create pLUX0169-uidA, pLUX264-uidA, pLUX452-uidA and confirmed by sequencing.

The tetracycline-inducible bicistronic expression system was constructed based on pZH512 plasmid that uses the iGEM BBa_R0040 Ptet promoter, the rrnB iGEM BBa_B0010 terminator, and the GFPmut2 reporter (Hensel, 2017). The sequence derived from pZH512 was synthesized and cloned into pUC57-mini by GenScript (Piscataway, NJ, USA). The tetracycline-based bicistronic system was amplified using TetBicis_F/TetBicis_R primers and cloned into the VspI/SacI sites of pBBR1p452-ST such that there were 9 bp between gfpmut2 and its RBS and 7 bp between tetR and its RBS, creating pBICISTRON.

Reporter assay

Well grown cultures of G. oxydans were inoculated 1:50 in new 50 ml baffled shake flasks containing 10 ml YG or YM. Cultures were immediately induced by addition of either anhydrotetracycline (ATc) or N-(3-Oxohexanoyl)-L-homoserine lactone (AHL; Chemodex Ltd, St. Gallen, Switzerland) to the indicated final concentrations and grown to an OD600 of about 0.8. The β-D-glucuronidase (UidA) activity was monitored in Miller Units as previously described (Kallnik et al., 2010). Cells were permeabilized by adding 30 μl cells to a 96 well plate containing 100 μl Z-buffer (60 mM Na2HPO4 × 7H2O, 40 mM NaH2PO4 × H2O, 10 mM KCl, 1 mM MgSO4 × 7H2O, 3.5 mM 2-mercaptoethanol, 5% (v/v) chloroform, and 0.5% SDS, pH) and incubated for 10 min at 30 °C. Absorbance was monitored at 405 nm every minute on a BioTek EL808 plate reader after addition of 100 μl 4-nitrophenyl-β-D-glucuronide (4 mg/ml). All assays were done in at least three biological replicates each with three technical replicates and analyzed using BioTek Gen5 software.

Alternatively, expression was monitored by fluorescence using the GFPmut2 protein. Induced cultures were monitored for fluorescence in late log phase (OD600~0.8). Fluorescence was measured with a λex of 485/4 nm and λem 508/4 nm using a SpectraMax M3 plate reader (Molecular Devices, San Jose, CA, USA). Fluorescence was measured in relative fluorescence units (RFU) and normalized to the optical density of the culture.

Microscopy

G. oxydans pBICISTRON and wildtype were grown on YG to approximately 0.4 OD600. Anhydrotetracycline was added to 100 ng/ml and cultures were incubated overnight. Clean depression slides were preheated in a 37 °C incubator. Molten buffered agarose (25 mM Tris-Base pH 7.4, agarose 1.2%) was applied to the depression slide and a glass slide was placed on top to form an agar pad. The slide was removed once solidified and 5 µL of cells were placed onto the center of the pad. A Nikon Eclipse E600 fluorescence microscope (100×/1.40 numerical aperture oil immersion objective) with a Nikon DS-Qi2 camera. Fluorescence was measured using λex 460/40 nm / λem 510/50 nm filter. Digital images were acquired and analyzed with the NIS-Elements imaging software (version 5.20.01).

Statistical analysis

R Studio was used to perform statistical analyses and to generate all plots (R Core Team, 2021). Analyses can be found in Script S1.

Results

Regulation of the activation-dependent Luxr expression system in G. oxydans

The Plux promoter is a common system used to induce gene expression in many bacteria. The LuxR-Plux system was successfully used to control gene expression in K. rhaeticus (Florea et al., 2016). However, species and genera differences in regulation have been reported in the AAB (Fricke et al., 2021a; Fricke et al., 2020; Fricke et al., 2021b). Based on its reported high induction and with relatively lower leakiness in comparison to TetR-based expression control, a LuxR-Plux system was examined in G. oxydans. The luxR gene was cloned under the control of either the constitutive strong (P0169 and P264) or moderate (P452) promoters (Kallnik et al., 2010; Yuan et al., 2016). Induction by addition of AHL was monitored with the uidA reporter gene under the control of the Plux promoter (Fig. 1). Regardless of the promoter used to express luxR, induction ratios were similar having average induction of 4.3 ± 0.31, 3.5 ± 0.17, and 4.90 ± 0.45 when P0169, P264, and P452 promoters were used respectively (Fig. 2). Stronger absolute expression was observed when the P0169 promoter was used to control luxR gene expression. However, induction ratios were similar to P264, and P452 despite the higher absolute activity. However, the amount of AHL inducer from 0.1 to 10 μM did not influence induction regardless of the strength of the promoter used to express the luxR gene. As such, this system functions as an on-off switch in the AHL concentration range tested rather than a tunable induction system in G. oxydans. Importantly, the LuxR-Plux system has previously been reported as inducible with lower leakiness in the acetic acid bacterium K. rhaeticus (Florea et al., 2016). However, the condition-dependent induction was only 5-fold in free-living cells and 12-fold in cellulose pellicles. The moderate levels of induction are attributed to the leakiness of this system in AAB. Indeed, similar induction levels are observed in G. oxydans and are also attributed to the moderate leakiness of the induction system. These data suggests that while the LuxR-Plux system shows good induction for heterologous gene expression relative to previously described systems in acetic acid bacteria (Florea et al., 2016), it is limited by its functionality as an on/off switch. Furthermore, tight control of gene expression is not possible due to the high background expression when not induced.

Figure 1. Variants and regulation of the pBBR1MCS-2-based LuxR-Plux expression system with a UidA reporter gene.

Figure 1

(A) Plasmid map of pLUX0169-uidA, pLUX452-uidA, and pLUX264-uidA. LuxR is derived from A. fischeri iGEM part BBa_C0062 and is constitutively transcribed from either strong promoters P0169 or P264 or the moderate P452 promoter (Kallnik et al., 2010; Shi et al., 2014). LuxR is terminated by the E. coli lpp terminator (Nishi et al., 1984). The uidA reporter gene is expressed from the Lux promoter/operator region from iGEM BBa_0062 and is terminated by the rrnB terminator from iGEM BBa_B0010. The strong ribosomal binding site from iGEM BBa_B0034 is used for translation of both LuxR and UidA (Hentschel et al., 2013). (B) Regulation of the activation-dependent LuxR-Plux expression system. Binding of AHL allows binding of LuxR-AHL to the Plux promoter. UidA hydrolyzes pNPG to produce a yellow color that can be quantified colorimetrically.

Figure 2. Activity of the LuxR-Plux systems in G. oxydans.

Figure 2

Induction was constant regardless of the amount of inducer and effectively functions as an on-off switch using the concentrations tested. (A) The PLUX0169-uidA using the strong P0169 promoter to express the luxR gene had an induction ratio of 4.3 ± 0.31 (B) pLUX264-uidA using the strong P264 promoter to express the luxR gene had an induction ratio of 3.5 ± 0.17 (C) pLUX452-uidA using the moderate P452 promoter to express the luxR gene had an induction ratio of 4.90 ± 0.45. Data represent at least three biological replicates each with three technical repeats. An asterisk (*) indicates that the Kruskal-Wallis test had a p < 0.001.

Regulation of the constitutive repression TetR expression system in G. oxydans

Another common system used to control heterologous gene express in bacteria is the TetR-Ptet system. This system is a constitutive repression system, where TetR constitutively represses transcription of the target gene by binding the Ptet promoter in the absence of a TetR effector. This system was examined for functionality in K. rhaeticus where gene expression was hindered by high leakiness of the repressor resulting in only circa 1.5-fold induction (Florea et al., 2016). However, variable expression in different AAB hosts has been previously observed, highlighting the need to examine expression in different hosts (Teh et al., 2019). To investigate its functionality in G. oxydans, a TetR-Ptet system was examined. The tetR gene was cloned under the control of the constitutive P0169, P264, and P452 promoters (Kallnik et al., 2010; Shi et al., 2014). Induction was monitored by addition of ATc with the uidA reporter gene under the control of the Ptet promoter derived from Tn10 (Fig. 3). The TetR-Ptet had strong maximal induction of 19-fold, 18.6-fold, and 4-fold when P0169, P264, and P452 promoters were used to control tetR transcription respectively (Fig. 4). While promoters P0169 and P264 had similar induction ratios, absolute induction was 6-fold higher when the P0169 promoter was used. This disparity in absolute activity compared to induction ratio is attributed to the somewhat higher background expression when the P0169 promoter was used. Interestingly, the induction ratio of P452 was the lowest at 4-fold. This is likely due to the weaker expression of the TetR repressor. The lower amount of TetR in the cytoplasm likely is not sufficient to fully repress the Ptet promoter, resulting in the increased amount of leaky expression that leads to reduced induction ratios. Indeed, the absolute levels of induction when the P264 and P452 promoter was used are similar, suggesting that the differences in induction ratios is driven by differences in promoter strength. However, induction of the TetR-Ptet system using the P452 promoter to express tetR is similar to induction with the LuxR-Plux system in G. oxydans and in K. rheaticus (Florea et al., 2016). Notably, the TetR-Ptet system showed tunable expression in all cases, showing an increased response to increasing ATc concentrations in the concentration range examined. Interestingly, the TetR-Ptet system showed stronger induction than the LuxR-Plux system in G. oxydans, which differs from observations in K. rhaeticus (Florea et al., 2016). However, the TetR-Ptet system still had low levels of leaky expression when uninduced, limiting induction ratios.

Figure 3. Variants and regulation of the pBBR1MCS-2-based TetR-Ptet expression system with a UidA reporter gene.

Figure 3

(A) Plasmid map of pTET0169-uidA, pTET452-uidA, and pTET264-uidA. The tetR gene is derived from the pASK-IBA3 plasmid (IBA Lifesciences GmbH, Göttingen, Germany). It is constitutively transcribed from either strong promoters P0169 or P264 or the moderate P452 promoter (Kallnik et al., 2010; Shi et al., 2014). An E. coli lpp terminator was used to terminate tetR transcription (Nishi et al., 1984). The uidA reporter gene is expressed from the Tet promoter/operator region from iGEM BBa_0040 and is terminated by the rrnB terminator from iGEM BBa_B0010. The strong ribosomal binding site from iGEM BBa_B0034 is used for translation of both tetR and uidA (Hentschel et al., 2013). (B) Regulation of the constitutive repression TetR-Ptet expression system. TetR binds ATc, relieving repression of the UidA reporter, which hydrolyzes pNPG, producing a yellow color that can be quantified colorimetrically.

Figure 4. Activity of the TetR-Ptet systems in G. oxydans.

Figure 4

Background expression was low and induction was tunable with all three promoters. (A) The PTET169-uidA using the strong P0169 promoter to express the luxR gene had an induction ratio of 19-fold (B) pTET264-uidA using the strong P264 promoter to express the luxR gene had an induction ratio of 18.6-fold (C) pTET452-uidA using the moderate P452 promoter to express the luxR gene had an induction ratio of 4-fold. Data represent at least three biological replicates each with three technical repeats. An asterisk (*) indicates that the Kruskal-Wallis test had a p < 0.001.

Construction of a tunable bicistronic TetR expression system in G. oxydans

While the above described TetR-Ptet system showed strong induction and tunability, a low level of leakiness was still observed. This is similar to previously reported results of high basal level of expression of the Tet system in acetic acid bacteria in the absence of inducer (Florea et al., 2016; Fricke et al., 2021a). In E. coli, a bicistronic autoregulation Ptet system was predicted to have the lowest background noise and predicted to be tunable based on modeling of various gene configurations. These predictions were also validated experimental to show the optimal signal-to-noise ratio of a bicistronic gene arrangement (Hensel, 2017). We used this as a model to construct a bicistronic TetR system using a GFP reporter using the moderate strength RBS (aaagCCgagaaaggtaccgcATG, Hensel, 2017) in the 5′-UTR of the gfpmut2 gene (Fig. 5). Like the TetR-Ptet system, the bicistronic system showed a tunable response up to 200 ng/ml ATc addition (Fig. 6). The maximum GFP induction ratio was a 3,037-fold increase in fluorescence. Importantly, the bicistronic system was tightly controlled, having little to no fluorescence in the absence of inducer and signal only slightly above background levels of wildtype cells (Fig. 6). This is an approximately 160-fold improvement of induction compared to the TetR-Ptet constitutive repression system in G. oxydans (Figs. 3 and 4). This is attributed to the low leakiness of the bicistronic system that increases induction ratios dramatically. Consequently, the bicistronic TetR gene arrangement is a promising system for gene control in G. oxydans and other AAB.

Figure 5. Map and regulation of the bicistronic TetR-based autoregulation system.

Figure 5

(A) Plasmid map of pBICISTRON. The bicistronic gene arrangement was synthesized GenScript and is based on pZH512 (Hensel, 2017). These genes are transcribed by the Ptet derived from iGEM BBa_R0040 and are terminated by the rrnB terminator from iGEM BBa_B0010. (B) Regulation of the bicistronic autoregulated expression system. TetR binds ATc, relieving repression of both gfp and tetR.

Figure 6. Activity of the bicistronic TetR-based autoregulation system.

Figure 6

(A) The bicistronic TetR-based system had high induction ratios of 3,037-fold with low background expression. Data represent at least three biological replicates each with three technical repeats. An asterisk (*) indicates that the Kruskal-Wallis test had a p < 0.001. n.s., not significant. (B) Brightfield (BF) and fluorescence microscopy of uninduced and induced G. oxydans pBICISTRON. GFP was not detected when ATc was absent and was robust when induced (100 ng/ml ATc induction shown). A Nikon Eclipse E600 fluorescence microscope (100×/1.40 numerical aperture oil immersion objective) with a Nikon DS-Qi2 camera. Fluorescence was measured using GFP filter (λex 460/40 nm / λem 510/50 nm). Digital images were acquired and analyzed with NIS-Elements imaging software. Representive view is shown.

Discussion

We looked at the use of three regulatable expression systems in G. oxydans, one using the common LuxR-Plux system and two genetic arrangements of the TetR-Ptet system. The absolute induction of the LuxR-Plux system was high in G. oxydans, having and average activity of 9,750, 4,600, and 5,300 Miller Units with the P0169, P264, and P452 promoters respectively (Fig. 2). However, the induction ratio was only about 4-fold regardless of the constitutive promoter used to express the luxR gene. This is similar to the induction ratio of 5-fold reported in K. rhaeticus free-living cells (Florea et al., 2016). The low induction ratio maybe due to the presence of rare G. oxydans codons in luxR that lead to slower translation rates or inclusion body formation, which would decrease reporter activity and induction ratios. However, slower translation has also been shown to increase the ratio of folded protein relative to rapid translation using only common codons, which can increase total protein while decreasing the folding yield ratio (Rodriguez et al., 2018). The induction ratio was also limited because of the leakiness of the expression system. In Aliivibrio fischeri, AHL is produced by a synthase encoded by the luxI gene. The expression of the luxI gene, along with the other bioluminescence genes, is under the control of the activator, LuxR (Fuqua, Winans & Greenberg, 1994). Yet, basal levels of AHL are still produced. It may be that LuxR has weak binding affinity for Plux in the absence of AHL, causing leaky transcription in G. oxydans. In the absence of the luxR gene, UidA activity was not detected. Consequently, the difference in background expression is likely due to the increase in basal level of expression of LuxR from the different constitutive promoters, with the strongest P0169 promoter enhancing basal level expression due to the increased levels of LuxR. Furthermore, the presence of a GinI/GinR quorum sensing system has been reported to be present in most AAB (Iida, Ohnishi & Horinouchi, 2008). This system is Lux-like and responds to AHLs. However, homologs of GinI/GinR were not identified by blastp. Despite this, an unknown GinI-like AHL-synthase or other undescribed AHL-dependent regulatory system may be present in G. oxydans. This would produce low levels of AHLs that may interact with LuxR, causing basal levels of expression, which may also explain the increased leakiness when the strong P0169 promoter was used. Another drawback to this system is that it is not tunable with the AHL concentrations tested. Rather it functions as an on/off switch with equal induction ratios when using 0.1 µM AHL up to 10 μM of AHL (Fig. 2). Regardless of these shortcomings, the LuxR-Plux system is a promising candidate to control gene expression in G. oxydans, especially when high absolute levels of expression are desired or the basal-level expression is not of concern.

Alternatively, the TetR-Ptet system has much lower levels of leaky expression in G. oxydans and up to 19-fold induction, which is approximately four-times higher compared to the LuxR-Plux system. Additionally, the TetR-Ptet system was tunable, unlike the LuxR-Plux system. Interestingly, a similar TetR system was examined in K. rhaeticus but only had induction ratios of about 1.5-fold, despite both systems having a similar genetic arrangement (Florea et al., 2016). One difference in genetic arrangement is the presence of an intervening neo/kan cassette between the tetR gene and the Ptet promoter (Fig. 3). It was suggested that terminator read-through may cause high leakiness of the Ptet promoter in K. rhaeticus (Fricke et al., 2021b). Molecular simulations also showed that TetR dimerization is inhibited at low pH (Fricke et al., 2021b). K. rhaeticus is often grown in medium containing glucose or sucrose with an initial pH of 6.0, which decreases during growth (Florea et al., 2016; Hestrin & Schramm, 1954). The cytoplasmic pH of acetic acid bacteria can decrease to about 4.0 during growth (Menzel & Gottschalk, 1985), which may be responsible for the leakiness seen in high acid producing AAB like K. rhaeticus (Fricke et al., 2021b). Additionally, the separation of the tetR gene and the Ptet promoter in our G. oxydans expression system likely preclude terminator read-through as the cause of the leaky expression. Instead, the leakiness may be attributed to the choice of promoter controlling the transcription of tetR. K. rhaeticus contains the PJ23118 or PlacI promoters for expression of tetR rather than native host constitutive promoters (Florea et al., 2016). It may be that the choice of promoter is important for sufficient expression of TetR and the repression of the Ptet promoter, causing a tighter control of gene expression. Additionally, the promoter must not produce excessive TetR to avoid inclusion bodies that could reduce the concentration of functional TetR, resulting in leakiness. Indeed, the highest amount of uninduced leakiness was observed when the weaker P452 promoter controlled tetR expression (Fig. 4).

In an attempt to reduce the amount of leakiness and improve induction of the TetR-Ptet system, we engineered a bicistronic TetR expression system. This gene arrangement has the best signal-to-noise ratio of any gene arrangement for the TetR-controlled expression in E. coli (Hensel, 2017). In G. oxydans, this system exhibited very low uninduced expression with high induction ratios of >3,000-fold. Importantly, the system was highly tunable when up to 200 ng/ml of ATc was added. Recently, another TetR-based system was reported in G. oxydans. This system uses the native Tn10 gene orientation. This Tn10-based system was also tunable and had induction ratios up to 3,674-fold (Fricke et al., 2021b), which is similar to the bicistronic system reported here. Tunability is important in many instances. For example, membrane-bound dehydrogenases in AAB often require low-to-moderate gene expression for functional enzyme production (Mientus et al., 2017). Also, in some cases strong gene expression is known to produce inclusion bodies. Metabolic and genetic engineering often requires that genes are expressed at lower levels. Therefore, the ability to tune gene expression up or down as needed is essential in these applications. In these cases, the bicistronic or Tn10-based TetR-dependent systems may be preferred over the LuxR system that is not tunable and shows higher basal levels of uninduced expression.

Conclusions

It recently has become possible to control and tune gene expression in AAB and there are now multiple systems for gene control. In addition to the LuxR-Plux systems described here and in K. rhaeticus, there are two known tunable and highly inducible TetR-Ptet systems (Florea et al., 2016; Fricke et al., 2021b). Another promising system for regulatable gene expression in AAB is the AraC-PBAD system. This system had low leakiness and is inducible up to 480-fold in G. oxydans. Importantly, this system was also tunable by varying the amount of arabinose added to the medium (Fricke et al., 2020). The current development of multiple tunable expression systems in AAB is advantageous for future studies into not only basic biological questions, but also for engineering of new strains for industrial productions.

Supplemental Information

Supplemental Information 1. Example code used to analyze all data sets and plot promoter activities.
DOI: 10.7717/peerj.13639/supp-1
Supplemental Information 2. Promoter activity raw data.
DOI: 10.7717/peerj.13639/supp-2

Acknowledgments

We are grateful to Drs. Bonnie Bratina, Todd Osmundson, and Dan Bretl for helpful discussions and feedback during the experimentation and writing of this paper.

Funding Statement

This project was funded by the University of Wisconsin–La Crosse through startup funds and a Undergraduate Research and Creativity Grant. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Additional Information and Declarations

Competing Interests

The authors declare that they have no competing interests.

Author Contributions

Monica Bertucci performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft.

Ky Ariano performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft.

Meg Zumsteg performed the experiments, authored or reviewed drafts of the article, and approved the final draft.

Paul Schweiger conceived and designed the experiments, performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft.

Data Availability

The following information was supplied regarding data availability:

The script used for statistical analysis and figure generation are available in the Supplemental File.

References

  • Blank & Schweiger (2018).Blank M, Schweiger P. Surface display for metabolic engineering of industrially important acetic acid bacteria. PeerJ. 2018;6(4):e4626. doi: 10.7717/peerj.4626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Chung, Niemela & Miller (1989).Chung CT, Niemela SL, Miller RH. One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution. Proceedings of the National Academy of Sciences of the United States of America. 1989;86(7):2172–2175. doi: 10.1073/pnas.86.7.2172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Cleenwerck et al. (2009).Cleenwerck I, De Wachter M, González A, De Vuyst L, De Vos P. Differentiation of species of the family Acetobacteraceae by AFLP DNA fingerprinting: Gluconacetobacter kombuchae is a later heterotypic synonym of Gluconacetobacter hansenii. International Journal of Systematic And Evolutionary Microbiology. 2009;59(7):1771–1786. doi: 10.1099/ijs.0.005157-0. [DOI] [PubMed] [Google Scholar]
  • Condon, FitzGerald & O’Gara (1991).Condon C, FitzGerald RJ, O’Gara F. Conjugation and heterologous gene expression in Gluconobacter oxydans ssp. suboxydans. FEMS Microbiology Letters. 1991;80(2–3):173–177. doi: 10.1111/j.1574-6968.1991.tb04656.x. [DOI] [Google Scholar]
  • De Vuyst et al. (2008).De Vuyst L, Camu N, De Winter T, Vandemeulebroecke K, Van de Perre V, Vancanneyt M, De Vos P, Cleenwerck I. Validation of the (GTG)(5)-rep-PCR fingerprinting technique for rapid classification and identification of acetic acid bacteria, with a focus on isolates from Ghanaian fermented cocoa beans. International Journal of Food Microbiology. 2008;125(1):79–90. doi: 10.1016/j.ijfoodmicro.2007.02.030. [DOI] [PubMed] [Google Scholar]
  • Deppenmeier & Ehrenreich (2009).Deppenmeier U, Ehrenreich A. Physiology of acetic acid bacteria in light of the genome sequence of Gluconobacter oxydans. Journal of Molecular Microbiology and Biotechnology. 2009;16(1–2):69–80. doi: 10.1159/000142895. [DOI] [PubMed] [Google Scholar]
  • Deppenmeier, Hoffmeister & Prust (2002).Deppenmeier U, Hoffmeister M, Prust C. Biochemistry and biotechnological applications of Gluconobacter strains. Applied Microbiology and Biotechnology. 2002;60(3):233–242. doi: 10.1007/s00253-002-1114-5. [DOI] [PubMed] [Google Scholar]
  • Florea et al. (2016).Florea M, Hagemann H, Santosa G, Abbott J, Micklem CN, Spencer-Milnes X, de Arroyo Garcia L, Paschou D, Lazenbatt C, Kong D, Chughtai H, Jensen K, Freemont PS, Kitney R, Reeve B, Ellis T. Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain. Proceedings of the National Academy of Sciences of the United States of America. 2016;113(24):E3431–3440. doi: 10.1073/pnas.1522985113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Fricke et al. (2021a).Fricke PM, Klemm A, Bott M, Polen T. On the way toward regulatable expression systems in acetic acid bacteria: target gene expression and use cases. Applied Microbiology and Biotechnology. 2021a;105(9):3423–3456. doi: 10.1007/s00253-021-11269-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Fricke et al. (2020).Fricke PM, Link T, Gätgens J, Sonntag C, Otto M, Bott M, Polen T. A tunable L-arabinose-inducible expression plasmid for the acetic acid bacterium Gluconobacter oxydans. Applied Microbiology and Biotechnology. 2020;104(21):9267–9282. doi: 10.1007/s00253-020-10905-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Fricke et al. (2021b).Fricke PM, Lürkens M, Hünnefeld M, Sonntag CK, Bott M, Davari MD, Polen T. Highly tunable TetR-dependent target gene expression in the acetic acid bacterium Gluconobacter oxydans. Applied Microbiology and Biotechnology. 2021b;105(18):6835–6852. doi: 10.1007/s00253-021-11473-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Fuqua, Winans & Greenberg (1994).Fuqua WC, Winans SC, Greenberg EP. Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators. Journal of Bacteriology. 1994;176(2):269–275. doi: 10.1128/jb.176.2.269-275.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Hensel (2017).Hensel Z. A plasmid-based Escherichia coli gene expression system with cell-to-cell variation below the extrinsic noise limit. PLOS ONE. 2017;12(10):e0187259. doi: 10.1371/journal.pone.0187259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Hentschel et al. (2013).Hentschel E, Will C, Mustafi N, Burkovski A, Rehm N, Frunzke J. Destabilized eYFP variants for dynamic gene expression studies in Corynebacterium glutamicum. Microbial Biotechnology. 2013;6:196–201. doi: 10.1111/j.1751-7915.2012.00360.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Hestrin & Schramm (1954).Hestrin S, Schramm M. Synthesis of cellulose by Acetobacter xylinum. II. Preparation of freeze-dried cells capable of polymerizing glucose to cellulose. Biochemical Journal. 1954;58(2):345–352. doi: 10.1042/bj0580345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Iida, Ohnishi & Horinouchi (2008).Iida A, Ohnishi Y, Horinouchi S. Control of acetic acid fermentation by quorum sensing via N-acylhomoserine lactones in Gluconacetobacter intermedius. Journal of Bacteriology. 2008;190(7):2546–2555. doi: 10.1128/JB.01698-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Kallnik et al. (2010).Kallnik V, Meyer M, Deppenmeier U, Schweiger P. Construction of expression vectors for protein production in Gluconobacter oxydans. Journal of Biotechnology. 2010;150(4):460–465. doi: 10.1016/j.jbiotec.2010.10.069. [DOI] [PubMed] [Google Scholar]
  • Kiefler, Bringer & Bott (2015).Kiefler I, Bringer S, Bott M. SdhE-dependent formation of a functional Acetobacter pasteurianus succinate dehydrogenase in Gluconobacter oxydans--a first step toward a complete tricarboxylic acid cycle. Applied Microbiology and Biotechnology. 2015;99(21):9147–9160. doi: 10.1007/s00253-015-6972-8. [DOI] [PubMed] [Google Scholar]
  • Kiefler, Bringer & Bott (2017).Kiefler I, Bringer S, Bott M. Metabolic engineering of Gluconobacter oxydans 621H for increased biomass yield. Applied Microbiology and Biotechnology. 2017;101(13):5453–5467. doi: 10.1007/s00253-017-8308-3. [DOI] [PubMed] [Google Scholar]
  • Kosciow et al. (2014).Kosciow K, Zahid N, Schweiger P, Deppenmeier U. Production of a periplasmic trehalase in Gluconobacter oxydans and growth on trehalose. Journal of Biotechnology. 2014;189:27–35. doi: 10.1016/j.jbiotec.2014.08.029. [DOI] [PubMed] [Google Scholar]
  • Kovach et al. (1995).Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM, 2nd Peterson KM. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 1995;166:175–176. doi: 10.1016/0378-1119(95)00584-1. [DOI] [PubMed] [Google Scholar]
  • Liu et al. (2020).Liu D, Ke X, Hu ZC, Zheng YG. Combinational expression of D-sorbitol dehydrogenase and pyrroloquinoline quinone increases 6-(N-hydroxyethyl)-amino-6-deoxy-α-L-sorbofuranose production by Gluconobacter oxydans through cofactor manipulation. Enzyme and Microbial Technology. 2020;141:109670. doi: 10.1016/j.enzmictec.2020.109670. [DOI] [PubMed] [Google Scholar]
  • Menzel & Gottschalk (1985).Menzel U, Gottschalk G. The internal pH of Acetobacterium wieringae and Acetobacter aceti during growth and production of acetic acid. Archives of Microbiology. 1985;143(1):47–51. doi: 10.1007/BF00414767. [DOI] [Google Scholar]
  • Merfort et al. (2006).Merfort M, Herrmann U, Ha SW, Elfari M, Bringer-Meyer S, Görisch H, Sahm H. Modification of the membrane-bound glucose oxidation system in Gluconobacter oxydans significantly increases gluconate and 5-keto-D-gluconic acid accumulation. Biotechnology Journal. 2006;1:556–563. doi: 10.1002/(ISSN)1860-7314. [DOI] [PubMed] [Google Scholar]
  • Meyer, Schweiger & Deppenmeier (2013).Meyer M, Schweiger P, Deppenmeier U. Effects of membrane-bound glucose dehydrogenase overproduction on the respiratory chain of Gluconobacter oxydans. Applied Microbiology and Biotechnology. 2013;97(8):3457–3466. doi: 10.1007/s00253-012-4265-z. [DOI] [PubMed] [Google Scholar]
  • Mientus et al. (2017).Mientus M, Kostner D, Peters B, Liebl W, Ehrenreich A. Characterization of membrane-bound dehydrogenases of Gluconobacter oxydans 621H using a new system for their functional expression. Applied Microbiology and Biotechnology. 2017;101(8):3189–3200. doi: 10.1007/s00253-016-8069-4. [DOI] [PubMed] [Google Scholar]
  • Nishi et al. (1984).Nishi T, Saito A, Oka T, Itoh S, Takaoka C, Taniguchi T. Construction of plasmid expression vectors carrying the Escherichia coli tryptophan promoter. Agricultural and Biological Chemistry. 1984;48:669–675. doi: 10.1080/00021369.1984.10866202. [DOI] [Google Scholar]
  • Papalexandratou et al. (2009).Papalexandratou Z, Cleenwerck I, De Vos P, De Vuyst L. (GTG)5-PCR reference framework for acetic acid bacteria. FEMS Microbiology Letters. 2009;301(1):44–49. doi: 10.1111/j.1574-6968.2009.01792.x. [DOI] [PubMed] [Google Scholar]
  • Prust et al. (2005).Prust C, Hoffmeister M, Liesegang H, Wiezer A, Fricke WF, Ehrenreich A, Gottschalk G, Deppenmeier U. Complete genome sequence of the acetic acid bacterium Gluconobacter oxydans. Nature Biotechnology. 2005;23(2):195–200. doi: 10.1038/nbt1062. [DOI] [PubMed] [Google Scholar]
  • R Core Team (2021).R Core Team . Vienna, Austria: R Foundation for Statistical Computing; 2021. [Google Scholar]
  • Rodriguez et al. (2018).Rodriguez A, Wright G, Emrich S, Clark PL. %MinMax: a versatile tool for calculating and comparing synonymous codon usage and its impact on protein folding. Protein Science. 2018;27(1):356–362. doi: 10.1002/pro.3336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Sambrook, Fritsch & Maniatis (1989).Sambrook J, Fritsch ER, Maniatis T. Molecular cloning: a laboratory manual (2nd ed.) Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
  • Shi et al. (2014).Shi L, Li K, Zhang H, Liu X, Lin J, Wei D. Identification of a novel promoter gHp0169 for gene expression in Gluconobacter oxydans. Journal of Biotechnology. 2014;175:69–74. doi: 10.1016/j.jbiotec.2014.01.035. [DOI] [PubMed] [Google Scholar]
  • Siemen et al. (2018).Siemen A, Kosciow K, Schweiger P, Deppenmeier U. Production of 5-ketofructose from fructose or sucrose using genetically modified Gluconobacter oxydans strains. Applied Microbiology and Biotechnology. 2018;102(4):1699–1710. doi: 10.1007/s00253-017-8699-1. [DOI] [PubMed] [Google Scholar]
  • Teh et al. (2019).Teh MY, Ooi KH, Danny Teo SX, Bin Mansoor ME, Shaun Lim WZ, Tan MH. An expanded synthetic biology toolkit for gene expression control in Acetobacteraceae. ACS Synthetic Biology. 2019;8(4):708–723. doi: 10.1021/acssynbio.8b00168. [DOI] [PubMed] [Google Scholar]
  • Wang et al. (2016).Wang EX, Ding MZ, Ma Q, Dong XT, Yuan YJ. Reorganization of a synthetic microbial consortium for one-step vitamin C fermentation. Microbial Cell Factories. 2016;15(1):21. doi: 10.1186/s12934-016-0418-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Yuan et al. (2016).Yuan J, Wu M, Lin J, Yang L. Combinatorial metabolic engineering of industrial Gluconobacter oxydans DSM2343 for boosting 5-keto-D-gluconic acid accumulation. BMC Biotechnology. 2016;16(1):42. doi: 10.1186/s12896-016-0272-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Zeiser et al. (2014).Zeiser J, Mühlenbeck LH, Schweiger P, Deppenmeier U. Characterization of a periplasmic quinoprotein from Sphingomonas wittichii that functions as aldehyde dehydrogenase. Applied Microbiology and Biotechnology. 2014;98:2067–2079. doi: 10.1007/s00253-013-5016-5. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Information 1. Example code used to analyze all data sets and plot promoter activities.
DOI: 10.7717/peerj.13639/supp-1
Supplemental Information 2. Promoter activity raw data.
DOI: 10.7717/peerj.13639/supp-2

Data Availability Statement

The following information was supplied regarding data availability:

The script used for statistical analysis and figure generation are available in the Supplemental File.


Articles from PeerJ are provided here courtesy of PeerJ, Inc

RESOURCES