Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2001 Aug;67(8):3665–3670. doi: 10.1128/AEM.67.8.3665-3670.2001

Bacillus Spore Inactivation Methods Affect Detection Assays

Jessica L Dang 1,*, Karen Heroux 1, John Kearney 2, Ameneh Arasteh 3, Mark Gostomski 3, Peter A Emanuel 3
PMCID: PMC93069  PMID: 11472945

Abstract

Detection of biological weapons is a primary concern in force protection, treaty verification, and safeguarding civilian populations against domestic terrorism. One great concern is the detection of Bacillus anthracis, the causative agent of anthrax. Assays for detection in the laboratory often employ inactivated preparations of spores or nonpathogenic simulants. This study uses several common biodetection platforms to detect B. anthracis spores that have been inactivated by two methods and compares those data to detection of spores that have not been inactivated. The data demonstrate that inactivation methods can affect the sensitivity of nucleic acid- and antibody-based assays for the detection of B. anthracis spores. These effects should be taken into consideration when comparing laboratory results to data collected and assayed during field deployment.


Bacillus anthracis, the causative agent of anthrax, is an important zoonotic disease of domestic livestock. It is also associated with the waste from certain processing industries such as tanneries and can be found in the effluent from water processing plants (1). Cutaneous anthrax is associated with the handling of contaminated animal products and has a mortality rate of 5 to 20% when untreated. Inhalation of B. anthracis spores causes pneumonic anthrax that has a mortality rate approaching 100%. Antibiotic treatment is largely unsuccessful after the appearance of symptoms (11). From a military standpoint, B. anthracis has been described as the ultimate biological weapon because of its virulence and persistence on a battlefield when it is disseminated as a desiccated spore (13). Endospores are dormant forms of bacteria that are stable for great lengths of time and are resistant to inactivation from radiation and heat. Bacillus spores are so resistant and hardy that they have been revived from the abdominal cavity of an extinct bee entombed within Dominican amber 25 to 40 million years ago (2) and isolated from a brine inclusion dated at 250 million years old (14).

Driven by the desire to develop and optimize detection devices to monitor and track the spores of B. anthracis, researchers face the need to handle moderate amounts of spore antigens. However, biosafety containment and occupational exposure are of great concern and necessitate inactivating the spores by gamma irradiation with a cobalt source or by thermal treatment such as autoclaving. B. anthracis has two major virulence factors encoded by plasmids pX01 (77 kb) and pX02 (95 kb). The plasmid pX01 codes for the lethal factor, the edema factor, and protective antigen that together form a tripartite protein exotoxin (4, 7, 9, 12). Plasmid pX02 codes for the spore capsule (3). Laboratory detection assays often use inactivated spore preparations or nonpathogenic simulants to conduct development and testing of biosensors (6). The optimization of biodetection assays can necessitate handling moderate quantities of dangerous pathogens. Federal regulations limit the movement of pathogens and regulate safety controls that must be employed to protect laboratory personnel. Commonly, biodetection assays can be conducted with inactivated preparations of the pathogens so that parameters can be optimized prior to final testing of viable and virulent targets such as B. anthracis spores.

In this study, data are presented comparing the reactivity of inactivated spore preparations versus that of viable spore preparations in biodetection assays. We demonstrate the effects of inactivation on populations of Bacillus spores detected by assays such as enzyme-linked immunosorbent assay (ELISA), PCR, and fluorescence-activated cell sorting.

MATERIALS AND METHODS

Growth and processing of Bacillus cultures.

Inactivation and biodetection protocols were conducted using B. anthracis NNR1 (pX01+ pX02−), B. anthracis ΔAmes (pX01− pX02+), B. anthracis ΔSterne (plasmid free), and two negative controls, Bacillus subtilis strain 1031 and Bacillus thuringiensis subsp. kurstaki. Bacillus cultures were generously provided by Alvin Fox (University of South Carolina Medical School) and Bruce Harper (Dugway Proving Grounds, Utah). Frozen glycerol stock cultures were streaked for isolation onto Trypticase soy agar (TSA) plus 5% sheep blood (BD Biosciences, Cockeysville, Md.). Isolated colonies were streaked again for isolation onto TSA + 5% sheep blood and incubated at 37°C for approximately 6 h or until visible growth was evident. Growth in nutrient broth was suspended, and 1 ml was spread plated onto nutrient sporulation medium (containing, per liter, 3 g of yeast extract, 3 g of tryptone, 2 g of Bacto Agar, 23 g of Lab Lemco agar, and 1 ml of 1% MnCl2) sporulation agar. These plates were incubated at 37°C and monitored for spore formation by phase-contrast microscopy with the criteria that vegetative cells are dark and rod shaped and often present as chains of cells, while spores are highly refractile and appear as smaller, bright ovals either inside of vegetative cells or free floating. Cultures were harvested when the ratio of vegetative cells to spores became static. For all strains used in this study, cultures reached >90% spore content as determined by microscopic visual approximation.

Spore preparations were washed twice with 200 ml of cold deionized sterile water, resuspended in double-distilled water, and examined by phase-contrast microscopy to determine the extent of sporulation. Concentration (CFU/ml) was determined by serially diluting washed spore stock in phosphate-buffered saline (PBS) plus 0.05% Tween 20. Tween 20 was added to minimize clumping of spores and consequently improve the accuracy of spore counts. One hundred microliters of diluted spores was spread plated in triplicate, and the number of CFU/ml was calculated following overnight incubation at ambient temperature. Stock concentrations were diluted to 108 CFU/ml (concentration confirmed by plate count), split into three identical sets for inactivation, and stored in sterile water at 4°C.

Irradiation kill curve.

Fresh spore preparations of B. anthracis ΔAmes were diluted in cold, sterile water to a concentration of 108 CFU/ml. Six 3-ml aliquots in 4-ml Cryule vials were irradiated for time intervals of 30, 45, 60, 75, 90, and 105 min in a model 109 cobalt 60 irradiator (J. L. Shepherd & Associates). These aliquots, plus a nonirradiated control aliquot, were plated (10% of total volume spread plated onto TSA plus 5% sheep blood agar) and incubated for 48 h at 37°C. Because no bacterial growth was evident from 60 to 105 min of irradiation, all subsequent test aliquots were batch irradiated for 75 min (2.5 to 2.8 megarads). The control aliquot for the irradiation kill curve was plate counted and contained 1.1 × 108 CFU/ml. To determine whether or not soluble antigen contributed to the ELISA response, the irradiated spore preparations were centrifuged to pellet the spores, and ELISAs were also performed on the supernatants.

Autoclave kill curve.

The 108-CFU/ml suspension of B. anthracis ΔAmes was aliquoted into five 30-ml centrifuge tubes with 10 ml of spore suspension in each tube. The tubes were autoclaved for intervals of 10, 20, 30, 40, and 50 min in a Tomy SS-325 autoclave at 212°C, 15 lb/in2. Autoclaved aliquots plus a nonautoclaved control aliquot were plated onto TSA plus 5% sheep blood agar and incubated for 48 h at 37°C to confirm sterility. No growth was evident on plates from samples autoclaved from 20 to 50 min. All test aliquots were subsequently autoclaved for 20 min. The control aliquot for the autoclave kill curve was plate counted and contained 1.1 × 108 CFU/ml. One set of spores was stored in distilled water at 4°C without treatment. To determine whether or not soluble antigen contributed to the ELISA response, the autoclaved spore preparations were centrifuged to pellet the spores, and ELISAs were performed on the supernatants.

ELISA.

Untreated, autoclaved, and irradiated spore preparations were diluted in PBS (pH 7.4) (catalog no. 1000-3; Sigma Chemical Co., St. Louis, Mo.) to concentrations ranging from 107 to 105 CFU/ml, and 100 μl of each concentration was applied in quadruplicate to Maxisorp ELISA plates. After overnight incubation at 4°C, the coated wells were washed once with ELISA wash buffer (PBS [pH 7.4], 0.1% Tween 20, 0.001% thimerosal) using a Skatron plate washer (Molecular Devices, Chantilly, Va.). The plates were treated with rabbit anti-anthracis (Tetracore, Gaithersburg, Md.) or goat anti-anthracis (Antibodies, Inc., Davis, Calif.) polyclonal antibodies (PAb) or mouse anti-anthracis monoclonal antibodies (MAb).

MAb AB2 and BF1 were made by immunizing BALB/cJ mice with ΔAmes spores irradiated with 40 Gy of gamma irradiation. They were tested extensively against panels of spores including Bacillus cereus and B. thuringiensis and were found to be specific for strains of B. anthracis (data not shown). The epitopes detected by these antibodies have not yet been identified. BF1 and BD8 MAb [immunoglobulin G2a(κ) IgG2a(κ)] were purified from culture supernatants by affinity chromatography from protein G-Sepharose columns (Pharmacia). For assays in which the MAb was used as the primary antibody, the MAb was diluted to 20 μg/ml in ELISA dilution buffer (PBS [pH 7.4], 5% dry skim milk, 0.001% thimerosal) and applied to every well. The plates were incubated at 37°C at 400 rpm with an iEMS Incubator/Shaker (Thermo Labsystems, Helsinki, Finland) for 1 h. All plates were washed with ELISA wash buffer six times. The secondary antibody, KPL (Kirkegaard and Perry Laboratories, Gaithersburg, Md.) goat anti-mouse horseradish peroxidase (HRP) conjugate, was diluted 1:2,000 in ELISA dilution buffer from a stock concentration of 0.5 mg/ml, and 100 μl was added to every well. Plates were incubated at 37°C at 400 rpm for 1 h and then washed as previously described. To detect the enzyme label, KPL 2,2′-azinobis-(3-ethylbenzthiazolinesulfonic acid) (ABTS) substrate was prepared according to the manufacturer's instructions, and 100 μl was added to every well. Plates were read at 405 nm after incubation at room temperature for 15 min with a microtiter plate reader (Dynex, Chantilly, Va.).

Both goat (Antibodies, Inc.) and rabbit (Tetracore) anti-anthracis PAb used as primary antibodies were diluted in ELISA dilution buffer to a working concentration of 5 μg/ml. Washes and incubations were identical to those described above. Secondary HRP-labeled antibodies were KPL rabbit anti-goat and KPL goat anti-rabbit HRP conjugate, respectively. Each was diluted 1:2,000 and incubated as previously described. Detection of enzyme label and readings were conducted as for the monoclonal ELISA previously described.

Supernatants of centrifuged spore preparations were analyzed by ELISA in a manner identical to that for the treated and untreated spore suspensions.

Flow cytometry.

All antibodies were labeled with Alexa 488 dye (Molecular Probes, Eugene, Oreg.) according to the manufacturer's specifications. ΔAmes or NNR1 spores were stained by incubating 106 washed spores in 5 μg of Alexa 488-labeled mouse anti-B. anthracis spore MAb. BF1 and AB2/ml for 30 min in PBS at 4°C. Another aliquot was stained with purified goat anti-spore PAb and developed by Alexa 488-labeled donkey anti-goat antibody. Alexa 488-labeled IgG1 (not directed against B. anthracis) was used as a control in conjunction with MAb BF1 and AB2. Protein G-purified normal rabbit or goat IgG was used as a control for the PAb. Binding of the antibodies was quantitated by flow cytometry using a FACSCalibur (Becton Dickinson, Mountain View, Calif.) with forward- and side-scatter setting optimized to detect spores. Results were displayed as histograms with overlays of control antibody staining.

PCR.

The TaqMan probe and primer sequences were designed with the software program Primer Express (Applied Biosystems, Foster City, Calif.) according to the manufacturer's instructions. TaqMan assays utilize the 5′ nuclease activity of Taq DNA polymerase to cleave a nonextendible dually labeled hybridization probe during the extension phase of PCR (5). The increase in fluorescence as the reaction proceeds is interpreted by the machine and graphed as a change in the relative fluorescence versus the cycle number. The sequence of the probe was selected based on the following criteria: predicted cross-reactivity with currently available GenBank sequences, lack of predicted dimer formation with primers, self-annealing of the oligonucleotide, a 10°C-higher melting temperature of the probe than the primers, no stretches of identical nucleotides longer than four, and no guanine at the 5′ end of the probe. The fluorescent reporter dye at the 5′ end of the probe was 6-carboxy-fluorescein (FAM), and the quencher at the 3′ end was 6-carboxy-tetramethyl-rhodamine (TAMRA). Capsule primers specifically amplified a 199-bp fragment of the capsule A (capA) gene (forward, GTGTTTGACCAAGGTGGACAA; reverse, TTACTCCATAGAGCACCCTTGGA; probe, FAM-CCAAAACCAGTTGCCAGTGCATTGG-TAMRA), and lethal factor gene (lef) primers amplified a 137-bp fragment of the lef gene (forward, GCTTAAGGAACATCCCACAGACTT; reverse, TCCGGTGCATAAAGCTGTAAAAC; probe, FAM-TTGCATATTATATCGAGCCACAGCATCGTG-TAMRA).

PCRs were carried out in 50-μl volumes with AmpliTaq Gold Master mixture, which contained AmpliTaq Gold DNA polymerase, AmpErase uracyl-N-glycosylase (UNG), deoxynucleoside triphosphates with dUTP, a passive reference, and optimized buffer components (Applied Biosystems; 400 nM each primer; 200 nM fluorogenic probe; 0.5 U of UNG; 0.125 U of AmpliTaq Gold DNA polymerase per reaction mixture; and 15 μl of treated or untreated spore preparations diluted to deliver 106 spores per reaction mixture. Reaction plates were incubated at 50°C for 5 min so that UNG could degrade any uracil from possible contaminating templates, followed by 2 min at 94°C to activate the AmpliTaq Gold. The reaction mixtures were then amplified by 45 cycles of 94 and 60°C. Amplification, data acquisition, and data analysis were carried out with a Perkin-Elmer 7700 sequence detection system (Applied Biosystems).

RESULTS

Following repeated washes, the three B. anthracis spore preparations and the B. subtilis strain 1031 spore preparation approached 100% spore content with minimal cellular debris, while the B. cereus and B. thuringiensis subsp. kurstaki preparations were approximately 95% spores. Spore preparations that had been irradiated 60 min or more failed to grow when plated for viability following treatment. No growth was evident from spore preparations that had been autoclaved for 20 min or longer. All spore preparations were examined by phase-contrast microscopy. Spores inactivated by irradiation showed little visible change when compared to the untreated spore samples. However, autoclaved killed preparations showed an increase in the percentage of dark, nonrefractile spores.

Figure 1 depicts the results of a direct ELISA using spores that have been inactivated by the methods described. The ELISA response of B. anthracis ΔAmes and NNR1 strains was graphed at a single concentration (107 CFU/ml) of spores, although serial dilutions were performed in quadruplicate ranging from 108 to 105 CFU/ml (data not shown). Irradiation of spore preparations resulted in a decreased ELISA signal for all antibodies tested. Lower concentrations of spores showed similar effects, although the proportions were different as the signal approached background. Autoclave treatment resulted in a 83% decrease in ELISA signal when ΔAmes and NNR1 spores were probed with the mouse MAb BF1. In contrast to the MAb, both of the PAb showed a >3-fold increase in signal following autoclave treatment of ΔAmes spores. A 48.9% increase in ELISA signal was observed when NNR1 spores were probed with goat anti-anthracis PAb following thermal inactivation, and a 12.8% increase in signal was observed when the spores were probed with a rabbit anti-anthracis PAb.

FIG. 1.

FIG. 1

Direct ELISA analysis of B. anthracis ΔAmes and NNR1 spore preparations following inactivation. Serial dilutions of the ΔAmes spores were performed with PBS and tested by direct ELISA with goat, rabbit, or mouse antibodies as shown. Irradiation of spore preparations resulted in a decreased ELISA signal for all antibodies tested. Autoclave treatment resulted in a decrease in ELISA signal when ΔAmes and NNR1 spores were probed with the mouse MAb BF1. In contrast to the MAb, both of the PAb showed an increase in signal following thermal inactivation.

In a direct ELISA, PAb response with spore supernatants indicates that soluble antigens constitute a significant portion of the rabbit and goat PAb-based activity (Fig. 2). Again, the ELISA response increased in strength and proportion virtually identically to that seen with spore suspensions. Interestingly, the mouse MAb did not target an epitope in the supernatant whose signal increased in response to treatment.

FIG. 2.

FIG. 2

Direct ELISA analysis of the supernatants from 107-CFU/ml dilutions of B. anthracis ΔAmes spores. Spores were pelleted by centrifugation, and the supernatant was removed. Serial dilutions of the ΔAmes spore supernatants were performed with PBS and assayed by direct ELISA using goat, rabbit, or mouse antibodies as shown.

Flow cytometry analysis was performed using the same antibodies and spore preparations (Fig. 3). The analysis of inactivated spores showed that MAb BF1 and goat anti-spore antibodies produced a shift in fluorescence. A biphasic peak was observed with untreated NNR1 spores when the spores were probed with the MAb BF1. For these reasons, a second MAb, AB2, was tested against the same spore preparations by flow cytometry. Figure 3 shows that AB2 stained both strains in a similar manner with no resulting biphasic peak. Inactivation appeared to destroy the binding sites of NNR1 and ΔAmes spores, as evidenced by a decrease in signal shift when the spores were probed with either MAb AB2 or BF1. However, when NNR1 spores were irradiated, probed with MAb AB2, and analyzed by flow cytometry, a small peak remained (Fig. 3). This may be attributed to B. anthracis strain variability. It is important to note that the overall trend is toward an apparent destruction of the binding site for the MAb.

FIG. 3.

FIG. 3

Untreated, autoclaved, or inactivated ΔAmes or NNR1 spores were stained with mouse MAb AB2 and BF1 or goat antibody to spores. Fluorescence staining was measured by flow cytometry. The representative forward- and side-scatter profiles for treated and untreated spore samples are shown in the left panel. In the right panel of histograms, positive staining is revealed by the bold lines and negative control staining is shown by the light lines. It can be seen that both autoclaving and irradiation destroy the BF1 as well as the AB2 epitope. Under the same conditions of spore inactivation, the goat PAb staining remains intact.

In contrast, staining with goat antibodies still resulted in a strong signal after inactivation treatments. Rabbit PAb yielded results similar to those obtained with goat PAb (data not shown). These results agree with the ELISA results outlined above and indicate that the epitope detected by BF1 is sensitive to both methods of inactivation. Detection using the PAb, which would be expected to target multiple epitopes, showed minimal differences between treated and untreated spores.

To investigate the effects of spore inactivation on nucleic acid-based detection, the spore preparations were subjected to PCR. Two different PCR assays based on TaqMan chemistry were used, each one targeting a different virulence gene within B. anthracis. The lef and capA assays were tested against panels of nearest-neighbor DNAs and unrelated environmental isolate DNAs and were proved to be specific for only those samples containing gene segments for their respective genes. No adverse cross-reactions or false-positive responses were observed (data not shown). Untreated and treated spores were assayed using the capA and the lef genes as targets, and the data were plotted as the relative change in total fluorescence versus the cycle number (Fig. 4 and 5). A comparison with untreated ΔAmes spores reveals that treatment by irradiation results in an average 32% decrease in total end point fluorescence after 45 cycles for the capA gene assay and a 38% decrease for the lef gene assay. Autoclaved samples show an average decrease in end point fluorescence of 40% for capA assay and 38% for the lef gene assay when compared to untreated samples. B. anthracis NNR1 does not harbor the pX02 plasmid (pX01+ pX02−) containing the capA gene and was used as a negative control for the capA gene assay (data not shown). B. anthracis ΔAmes (pX01− pX02+) has been cured of pX01 and results in a negative PCR response when assayed for the lef gene (Fig. 5D). No PCR response was seen for negative control samples that included B. cereus 6E1, B. thuringiensis subsp. kurstaki, and B. subtilis 1031 (Fig. 4D to F and 5E to G).

FIG. 4.

FIG. 4

TaqMan PCR analysis targeting the capA gene of Bacillus spore preparations. Each tube was subjected to PCR amplification in triplicate with the Applied Biosystems model 7700 using equivalent numbers of spores from the indicated cell lines. The data are plotted as the relative change in total fluorescence (ΔRn) versus the cycle number. A, untreated B. anthracis ΔAmes spores; B, irradiated B. anthracis ΔAmes spores; C, autoclaved B. anthracis ΔAmes spores; D, untreated B. thuringiensis subsp. kurstaki spores; E, untreated B. subtilis 1031 spores; F, untreated B. cereus 6E1 spores.

FIG. 5.

FIG. 5

TaqMan PCR analysis targeting the lef gene of Bacillus spore preparations. The data are plotted as the relative change in total fluorescence (ΔRn) versus the cycle number. A, untreated B. anthracis ΔAmes spores; B, irradiated B. anthracis ΔAmes spores; C, autoclaved B. anthracis ΔAmes spores; D, untreated NNR1 B. anthracis spores; E, untreated B. subtilis spores; F, untreated B. cereus 6E1 spores; G, untreated B. thuringiensis subsp. kurstaki spores. H, double-distilled water.

Comparison of Ct values reveals that inactivation by either irradiation or autoclave treatment results in an increase in threshold value of four cycles using the capA assay. Ct value comparisons for the lef gene assay show that irradiation requires five additional cycles for detection of a positive sample and nine additional cycles for autoclaved samples compared with untreated spore samples. Assuming 100% efficiency, every additional cycle represents a doubling of the previous cycle's total molecules. Therefore, the five additional cycles needed for detection of a positive response in the irradiated sample correlates to a 32-fold-less-viable template, and nine additional cycles needed for detection of the autoclaved samples correlates to a 512-fold-less-viable template. Quantitative comparison of the total log reduction in target molecules is not meaningful due to wide variances in the endpoint efficiencies of TaqMan PCR.

DISCUSSION

The data demonstrate that inactivation methods can affect the sensitivity of nucleic acid-based detection and immunoassays for the detection of Bacillus spores. We have observed a differential effect based on the type of assay employed. The need to avoid handling and testing large amounts of potentially harmful spore preparations dictates that we understand the effects of inactivation procedures. We have studied two common spore inactivation procedures and demonstrated how they affect three types of biodetection assays. These effects should be taken into consideration when comparing laboratory results to data collected and assayed during field deployment.

The increase in the number of dark nonrefractile spores in the autoclaved spore preparations observed under phase-contrast microscopy may indicate a change in the spore structure. There is an association between increased numbers of dark spores and loss of ELISA signal generated with MAb AB2 and BF1. This is likely due to destruction of the epitope recognized by AB2 and BF1 during thermal inactivation. The epitopes recognized by the MAb were not released into the supernatant. MAb very likely detect only one epitope on the spore surface, which in this case is susceptible to alteration by all forms of spore inactivation. In contrast, the PAb may react with multiple epitopes, some of which are not altered by spore inactivation. Heat treatment may also cause conformational changes in the antigen that make certain epitopes more accessible for binding of PAb. We believe this phenomenon occurred in the autoclaved spores probed with PAb because of the significantly stronger signal. It is also possible that the antigen(s) has become more soluble and detached from the spore coat, making more antigen available for binding of the PAb in the ELISA format. The results of the direct ELISA using spore-free supernatants probed with both of the PAb and the MAb strongly indicate that distinct differences exist between the epitopes targeted by the MAb and the PAb anti-anthracis preparations.

The flow cytometry data show that irradiation and autoclaving disrupted the binding of MAb BF1 to B. anthracis epitopes. The reasons for the biphasic peak are unclear, although it is possible that the NNR1 preparation had a larger amount of nonrefractile dark spores. Alternatively, the biphasic peak could be due to a unique characteristic of the NNR1 strain, since it was not observed with the ΔAmes strain (Fig. 3).

Inactivation of spores resulted in a decrease in the total end point fluorescence using the PCR lef and the capA gene assays. Total endpoint fluorescence can be adversely affected by several factors, including limiting reagents and amplification efficiency, so threshold values (Ct) are often used to compare assay results (5). The thermocycler software interprets the threshold value (Ct) to be the point at which the ratio of the reporter (FAM) to the quencher (TAMRA) exceeds a set limit and the amplification reaction is considered to be statistically significant. The Ct is often 10 times the standard deviation of the baseline, or it can be set just slightly above the negative controls to compensate for degradation of the probe over the course of the run. The increase in Ct values seen in the inactivated PCR assays could translate into a loss of sensitivity at the lower end of detection, although absolute sensitivity would be determined by several factors including primer efficiency and sample preparation methodology. The alteration in threshold seen with the inactivated spore preparations would require additional thermal cycles, translating into longer cycling times in order to attain a positive response. If the increase in threshold was significant enough and extended beyond the testing window, it is possible that a false-negative response would be obtained for a sample that contained inactivated anthrax, although this has no implications for the false-positive responses.

Comparisons of inactivated and viable pathogen data suggest that although the use of inactivated preparations is clearly preferable to working with viable pathogens in many circumstances, there may be variations in the results depending on the inactivation methods employed. Data presented using inactivated B. anthracis spore preparations should take into account such effects as sensitivity limits when citing characteristics of biodetection assays. The variations in response of DNA and antibody-based detection systems strongly support final testing of the viable threat agent as a supplement to inactivated testing.

There is some evidence to suggest that polyclonal antispore preparations preferentially target soluble spore components and that these immunodominant targets leach out of the spore during prolonged storage (8). Immunoassays of supernatants devoid of spores support those data and suggest that a significant portion of the polyclonal response is directed towards these soluble antigens. Thermal inactivation by autoclaving may accelerate the leaching of these soluble antigens into the surrounding media that would account for the dramatic rise in signal seen with PAb-based ELISA. Inactivation by wet heat is not normally thought to target DNA (10), but the data show a stronger decrease in PCR response for autoclaved samples than is seen for irradiated samples. A decreased PCR response using autoclaved spores may be due to the release of inhibitors following autoclave treatment, or the difference between the two methods may not be statistically significant.

Irradiation should not physically disrupt the spores, but our ELISA results suggest that this treatment does destroy or inactivate some epitopes. The epitopes for the particular MAb used in this study are obviously affected by irradiation, but other MAb may not be affected by inactivation. By definition, a PAb consists of many antibodies recognizing multiple epitopes, and the binding of some antibodies within that population may be destroyed while others actually may bind their targets more efficiently. MAb are targeted to a specific epitope that, if denatured, can result in a loss of recognition with a corresponding loss of signal not compensated for by binding to other epitopes.

As the Chemical and Biological Treaty nears completion, these data have implications for the detection of weapons of mass destruction. The enforcement of any treaty relies upon the verification of compliance and the reliability of methods for determining if a facility has been or is engaged in the production of biological weapons. Our data show that inactivation can either diminish or enhance the ability to detect an agent of biological origin, depending on the assay or reagents employed. It should be noted that although inactivation of spores resulted in a reduction in detection signals for PCR-based assays, this technology is exquisitely sensitive and can detect as few as a single organism (9).

It is important to note that inactivation did not lead to false-positive signals. For issues surrounding treaty verification, this infers that decontamination of a facility makes the detection of the pathogen more difficult depending on the assay employed but that a positive reaction should be indicative of the presence of a biological agent. Additional work with biological agents that have been decontaminated by bactericidal agents such as bleach will contribute to our confidence in the current arsenal of biodetection options.

The inactivation of weapons of mass destruction has implications for laboratory-based research and development of field-based applications of the various detection technologies. Future work should be aimed at platform- and method-specific testing of biological agents and the effects of decontamination on sensitivity and cross-reactivity. These issues are likely to become increasingly important in the realm of global politics, and further study is warranted.

ACKNOWLEDGMENTS

We acknowledge the contribution of Peter Spaeth of SBCCOM for his technical assistance and expertise in sample irradiation, Patricia E. Anderson of Geo-Centers, Inc., for her technical consultation on flow cytometry, and Calvin Chue for his technical assistance with TaqMan PCR data.

This work was supported in part by DAAD 13-00-0-0015 (principal investigator, J. Kearney), MDA 972-96-K-003/P0003, and DAAD 19-00-1-0032.

REFERENCES

  • 1.Beyer W, Glöckner P, Otto J, Böhm R. A nested PCR method for the detection of Bacillus anthracis in environmental samples collected from former tannery sites. Microbiol Res. 1995;150:179–186. doi: 10.1016/S0944-5013(11)80054-6. [DOI] [PubMed] [Google Scholar]
  • 2.Cano R J, Borucki M K. Revival and identification of bacterial spores in 25- to 40-million-year-old Dominican amber. Science. 1995;268:1060–1063. doi: 10.1126/science.7538699. [DOI] [PubMed] [Google Scholar]
  • 3.Green B D, Battisti L, Koehler T M, Thorne C B, Ivins B E. Demonstration of a capsule plasmid in Bacillus anthracis. Infect Immun. 1985;49:291–297. doi: 10.1128/iai.49.2.291-297.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hacker J, Blum-Oehler G, Mühldorfer I, Tschäpe H. Pathogenicity islands of virulent bacteria: structure, function and impact on microbial evolution. Mol Microbiol. 1997;23:1089–1097. doi: 10.1046/j.1365-2958.1997.3101672.x. [DOI] [PubMed] [Google Scholar]
  • 5.Heid C A, Stevens J, Livak K J, Williams P M. Real time quantitative PCR. Genome Res. 1996;6:986–994. doi: 10.1101/gr.6.10.986. [DOI] [PubMed] [Google Scholar]
  • 6.Horan N J, Parr J, Naylor P J. Evaluation of tracers for the determination of the mixing characteristics of activated sludge reactors. Environ Technol. 1991;12:603–608. [Google Scholar]
  • 7.Lee C A. Pathogenicity islands and the evolution of bacterial pathogens. Infect Agents Dis. 1996;5:1–7. [PubMed] [Google Scholar]
  • 8.Lee W E, Thompson G, Kokko E. The antigenicity of Bacillus globigii spores. DRES-SM-1500. 1998. pp. 1–23. [Google Scholar]
  • 9.Makino S-I, Iinuma-Okada Y, Maruyama T, Ezaki T, Sasakawa C, Yoshikawa M. Direct detection of Bacillus anthracis DNA in animals by polymerase chain reaction. J Clin Microbiol. 1993;31:547–551. doi: 10.1128/jcm.31.3.547-551.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Nicholson W L, Munkata N, Horneck G, Melosh H J, Setlow P. Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiol Mol Biol Rev. 2000;64:548–572. doi: 10.1128/mmbr.64.3.548-572.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Penn C C, Klotz S A. Anthrax pneumonia. Semin Respir Infect. 1997;12:28–30. [PubMed] [Google Scholar]
  • 12.Reilly T J, Baron G S, Nano F E, Kuhlenschmidt M S. Characterization and sequencing of a respiratory burst-inhibiting acid phosphatase from Francisella tularensis. J Biol Chem. 1996;271:10976–10983. doi: 10.1074/jbc.271.18.10973. [DOI] [PubMed] [Google Scholar]
  • 13.Sherman L. A higher term of killing. Proc US Nav Inst. 1995;121:40–45. [Google Scholar]
  • 14.Vreeland R H, Rosenzweig W D, Powers D W. Isolation of a 250 million-year-old halotolerant bacterium from a primary salt crystal. Nature. 2000;407:897–900. doi: 10.1038/35038060. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES