Margetuximab conjugated-PEG-PAMAM G4 nano-complex: a smart nano-device for suppression of breast cancer

Abstract

Abstract

Breast cancer due to its high incidence and mortality is the second leading cause of death among females. On the other hand, nanoparticle-based drug delivery is one of the most promising approaches in cancer therapy, nowadays. Hence, margetuximab- and polyethylene glycol-conjugated PAMAM G4 dendrimers were efficiently synthesized for targeted delivery of quercetin (therapeutic agent) to MDA-MB-231 breast cancer cells. Synthesized nano-complexes were characterized using analytical devices such as FT-IR, TGA, DLS, Zeta potential analyzer, and TEM. The size less than 40 nm, – 18.8 mV surface charge, efficient drug loading capacity (21.48%), and controlled drug release (about 45% of drug release normal pH after 8 h) were determined for the nano-complex. In the biomedical test, the cell viability was obtained 14.67% at 24 h of post-treatment for 800 nM concentration, and IC₅₀ was ascertained at 100 nM for the nano-complex. The expression of apoptotic Bax and Caspase9 genes was increased by more than eightfolds and more than fivefolds after treatment with an optimal concentration of nanocarrier. Also, more than threefolds of cell cycle arrest was observed at the optimal concentration synthetics, and 27.5% breast cancer cell apoptosis was detected after treatment with 100 nM nano-complex. These outputs have been indicating the potential capacity of synthesized nano-complex in inhibiting the growth of breast cancer cells.

Graphic abstract

Introduction

Nowadays, cancer and cancer therapy are the most common issues related to human health. Among various cancers, diagnosis and treatment of breast cancer have been attracted the attention of scientists across the globe since its mortality is at a high level [1, 2]. According to reports, breast cancer, as the most common malignancy in the United States, is the second leading cause of death among females [3]. The incidence of breast cancer cases has been significantly increasing by aging and population growth, and based on statistics, the incidence rate of breast cancer will be increased by 50% in 2030 [3, 4]. On the other hand, conventional therapeutic approaches in breast cancer therapy, including chemotherapy, thermal therapy, surgery, hormone therapy, and so forth owing to their deficiencies such as considerable side effects on healthy tissues, non-specificity, usage of high drug dose, long term period of treatment, etc. are not appropriate types of breast cancer inhibition and eradication [5, 6]. As a result, in order to prevent the high incidence of breast cancer and its eradication, introducing novel effective therapeutic technologies is potentially needed. In the present time, the most practical approaches in the detection and treatment of cancer and as well as other diseases are nanoparticle-based methods [7–10]. Nanoparticles, with a size range of 1 to 100 nm, are the excellent candidate to act as a drug delivery system in the diagnosis and treatment of cancers. Nanoparticle-based drug delivery system can considerably accumulate high drug concentrations in cancer sites, enhances drug stability in human body serum, increases biocompatibility and biodegradability of bioactive, and eliminates adverse side effects of therapeutic agents [11, 12].

Polyamidoamine (PAMAM) dendrimers, as a kind of polymeric nanoparticles, have been considered as an appropriate nano-size vehicle for drug delivery goals. These nanoparticles have some merits such as three-dimensional and branched structure, high surface functional groups, globular shape, suitable biodegradability, suitable pharmacokinetics and pharmacodynamics, appropriate drug loading capacity, good serum stability, and so forth which make them a potential candidate for effective drug delivery to cancer site [13–15]. These nanocarriers can be utilized in both passive drug delivery systems, in which nanoparticle uptake into target cells through enhanced permeability and retention (EPR) effect, and active drug delivery systems by which nanoparticle effectively uptake into target cell via receptor-mediated internalization [15, 16]. However, these nanoparticles owing to their surface positive amino groups can lead to some cytotoxic effect on normal cells by activating reactive oxygen species (ROS) at the cellular levels. To eliminate this partial drawback, biocompatible molecules such as polyethylene glycol (PEG) can conjugate to the surface of dendrimers to cover those positive groups and make them biocompatible and non-toxic nanocarriers to effective drug delivery [17]. PEG can also increase biodegradability, stability, non-immunogenicity, and EPR effects of nanoparticles [18].

On the other hand, using active drug delivery systems can remarkably improve the efficiency of cancer therapy. In this type of drug delivery system which is also called targeting drug delivery systems, biocompatible ligands conjugate to the nanoparticle to efficiently uptake by cancer cells via receptor mediating internalization [19]. These ligands such as folic acid, transferrin, aptamer, antibody (Ab), etc. can attach to their receptor with high affinity on the surface of cancer cells and guarantee high accumulation of drug-loaded nanocarriers in cancer cells without any side effects on normal cells [20]. For instance, margetuximab, as a novel Fc-engineered HER2-targeted monoclonal Ab, can attach to the ectodomain of HER2 receptors on the surface of breast cancers and facilitates effective internalization of nanocarriers [21]. Since margetuximab has a higher affinity to its receptor, it shows Ab-dependent cell-mediated cytotoxicity on cancer cells [22]. Meanwhile, this Ab, as a practical type of anti-HER2 Ab, has a higher affinity to its receptor than that of other anti-HER2 monoclonal Abs such as pertuzumab and trastuzumab [23]. Therefore, margetuximab-conjugated nanoparticles not only can act as therapeutic agents but also can play a role as potential targeting biomolecules in active drug delivery systems in cancer therapy. Besides, various therapeutic agents like doxorubicin, paclitaxel, oxaliplatin, quercetin, etc. can load into nanocarrier to substantially suppress cancer cell growth as practical drug delivery system [16, 19]. Quercetin drug (D) which is a kind of natural flavonoid compounds, has several pharmaceutical applications such as anti-inflammatory and antitumor effects that make it an effective bioactive in cancer therapy [24]. This therapeutic agent can potentially inhibit cancer cell metastasis by blocking the Akt/mTOR/c-Myc signaling pathway, suppressing ribosomal protein S19 (RPS19)-activated epithelial-mesenchymal transition (EMT) signaling, and downregulating Wnt/β-catenin signaling pathway proteins [25].

In the present work, we synthesized smart PEG-modified and margetuximab-conjugated PAMAM G4 nano-complex as a nanocarrier of quercetin. Synthesized samples were characterized with analytical devices such as FT-IR, TGA, DLS, and TEM. Then, drug loading capacity and drug release manner of the nano-complex were studied. Afterward, in vitro biomedical approaches, including cell viability, apoptosis gene expression values, cell cycle arrest, and cell apoptosis assays were performed to investigate the breast cancer cell inhibition potency of nano-complexes.

Materials and methods

Materials and apparatus

The polyamidoamine G4 (PAMAM) dendrimer (molecular weight: 14.215 g mol^− 1), COOH-PEG-NH₂ (20,000 Da), quercetin bioactive (> 95% HPLC), di-methyl-sulphoxide (DMSO), dimethylformamide (DMF), N-hydroxysuccinimide (NHS), and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) were purchased from Sigma-Aldrich. Besides, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) salt, streptomycin, penicillin, foetal bovine serum (FBS), and cellulose dialysis membrane (cut-off 12,000 Da) were bought from Sigma-Aldrich. MDA-MB-231 breast cancer cell line was purchased from Pasteur Institute of Iran.

On the other hand, characterization of synthesized specimens was performed by NanoDrop 2000c UV–Vis spectrophotometer (Thermo scientific), Fourier transform infrared (FT-IR) spectrometer (Perkin-Elmer 843), thermogravimetric (TGA) STA 1500 (Rheometric Scientific), and dynamic light scattering (DLS) (NanoBrook 90 Plus (Brookhaven, USA)) devices. Moreover, transmission electron microscopy (TEM) images were taken by Philips EM 208 S (Netherlands).

Surface Modification of PAMAM G4

The surface of the PAMAM G4 dendrimer was modified with bi-functional PEG as the following method. Firstly, 18.29 mg of PAMAM G4 (2.57 × 10^− 7 mol) was dissolved in 10 mL of DMSO and stirred at 60 rpm and room temperature for 1 h. Secondly, 28 mg of COOH-PEG-NH₂ was suspended in 6 mL of DMSO, stirred at 70 rpm for 2 h. Then, 25 mg of EDC (1.3 × 10^− 4 mol) and 15 mg of NHS (1.3 × 10^− 4 mol; 1:1 molar ratio to EDC) were mixed in 5 mL of DMSO and vigorously stirred at room temperature for 3 h. Consequently, the NHS/EDC containing mixture was added to the prepared PEG solution and was stirred at 80 rpm for 5 h to activate PEG. This phase was carried out under dark conditions and a nitrogen atmosphere. The activated PEG was added to the prepared PAMAM G4 solution drop by drop under stirring at 60 rpm and 25 °C for 72 h. This experiment was also done in light-protected conditions. Ultimately, unreacted PEG molecules were filtered by a cut-off of 12,000 Da of dialysis tube at 1 L PBS buffer (3 times) and 1 L deionized water (3 times) for 3 days, respectively. This product is nominated as P-P in this paper.

Surface decoration of PAMAM G4

For the synthesis of margetuximab-decorated P-P, 0.1 mg/mL (500 µL) of margetuximab monoclonal Ab was dissolved in 5 mL of PBS. Then, 25 mg of EDC (1.3 × 10^− 4 mol) and 15 mg of NHS (1.3 × 10^− 4 mol; 1:1 molar ratio to EDC) were mixed in 5 mL of PBS under vigorous stirring at room temperature for 5 h. The Ab-containing solution was added to the EDC-NHS mixture and incubated at room temperature, and the reaction was continued for 4 h to activate the carboxylic acid groups of the Ab. Consequently, the P-P mixture was mixed with the Ab-containing solution, and the reaction was performed at room temperature and 60 rpm stirring overnight. The experiments were implemented in dark circumstances and nitrogen atmosphere. Eventually, the resultant was dialyzed by dialysis membrane at 1 L PBS buffer (3 times) to separate unreacted agents and the sample was saved at 4 °C.

Drug loading into PAMAM G4

In this phase, quercetin was loaded into P-P-Ab nano-complex; as 12 mg of this therapeutic agent was submerged in 4 mL of PBS under vigorous stirring which was followed by adding to the P-P-Ab nano-complex under stirred at 80 rpm for 48 h. In the following, the drug-loaded nano-complex (Ab-P-P-D) was dialyzed against a 12,000 Da dialysis tube for 1 h under stirring at 40 rpm and room temperature.

Characterization of syntheses

The quality and quantity of synthesized samples, including pure P, P-P, P-P-Ab, and Ab-P-P-D were verified via various analytical devices like the following: (1) The qualitative efficiency of PAMAM G4 conjugates was evaluated using FT-IR spectroscopy; (2) The thermal stability and drug loading efficiency were investigated by TGA; (3) The hydrodynamic size of conjugates was determined using DLS spectrophotometer; (4) The size, structure, and morphology of nano-complex were survived by means of TEM.

Drug release study

The drug release profile of quercetin from the Ab-P-P-D sample was studied under optimal conditions in PBS at pH of 7.4 and 5.0 to investigate the controlled-release manner of Ab-P-P-D. This experiment was done using the dialysis bag at 37 °C and shaking at 50 rpm [13, 15]. Practically, 3 mg of the quercetin-containing formulation was submerged in 4 mL of PBS and transferred into a prepared-dialysis bag (12,000 Da) which was followed by fastening its ends with clamps. Subsequently, the dialysis tube was immersed in 50 ml of PBS as a release medium and the system was placed in an incubator-shaker under shaking at 50 rpm and 37 °C. Then, 100 µL of the release medium was gathered at different predetermined time intervals (1 h, 2 h, 3 h, 4 h, 5 h, 24 h, 48 h, 72 h) and replaced with a fresh release medium. Ultimately, the collected aliquots were read by Nano-drop UV-visible spectrophotometer at 258 nm wavelength.

Cell culture

The human breast cancer cell line (MDA-MB-231) was bought from the Pasture Institute of Iran. This cell line was cultured in RPMI medium (Gibco, UK) supplemented with 10% FBS, 2 mM glutamine, 100 µg mL^− 1 streptomycin, and 100 IU mL^− 1 penicillin and incubated at 37 °C in a humidified atmosphere containing 5% CO₂ and 95% air.

Cell viability assay

The cytotoxic potency of the specimens, including pure P, P-P, P-P-Ab, Ab-P-P-D, and pure D were tested on the MDA-MB-231 breast cancer cell line. This investigation was performed by the MTT-based proliferation assay using various concentrations of samples (100 nM, 200 nM, 400 nM, and 800 nM), and mitochondrial dehydrogenase activity of cancer cells was measured. Briefly, the cells were seeded in each well of 96-well microtiter plates (5000 cells/100 µL of the MDA-MB-231 cell in each well) and allowed to attach overnight by incubating at 37 °C and 5% CO₂ and 95% air. Various concentrations of samples were prepared in a serum-supplemented culture medium which was sterilized by 0.2 mm filtration at pH 7.4. Then, the cancer cell inhibition ability of samples was evaluated at 24 h, 48 h, and 72 h of post-treatment as the following. The culture medium of the microtiter plates was replaced by 150 µL serial dilutions of the prepared sample, and the cells were incubated three different times in an incubator. Afterward, the content of each well was replaced with 200 µL of RPMI without serum and 0.5 mg MTT/mL salt prepared in PBS at pH 7.4 was added to wells. After 4 h of incubation of microtiter plates, the suspension liquid of wells was collected, and the MDA-MB-231 cells were re-suspended in 200 mL of DMSO, in the wake of this process, the optical density (OD) of the converted dye was read at 570 nm via ELISA reader to determine the number of viable cells.

$$\text{Cell}\text{viability}\text{(\% ) = OD}\text{value}\text{of}\text{test/OD}\text{value}\text{of}\text{control}\times \text{100}.$$ 1

Gene expression assay

The quantitative Real-Time PCR (qRT-PCR) technique was employed to quantify the relative expression level of Caspase-9 and Bax (apoptotic genes) at 5 h of post-treatment with 200 nM concentration of Ab-P-P-D in MDA-MB-231 cells applying ABI 7300 real-time PCR system (Applied Biosystems, Foster City, CA) device as the following method. The breast cancer cells were seeded into 6-well plates (5 × 10⁴ cells/well), incubated for 24 h, and were treated with Ab-P-P-D nano-complex for additional 24 h incubation. The total RNA of cancer cells was isolated: as MDA-MB-231 cells were immersed in RNX-PLUS solution and 200 µL of chloroform, and followed by centrifuging at 13,000 rpm for 4 min at 4 °C. After collecting the supernatant, it was mixed with isopropanol and centrifuged at 13,000 rpm for 15 min at 4 °C, the supernatant was throw away, and precipitation was submerged in 1 mL of ethanol 75%. Thereafter, 1000 ng of high-quality RNA was utilized for cDNA synthesis by the reverse transcription process. As 10 µL of Master mix real-time, 3 µL (10 ng) RNA, and 7 µL double distilled water were spilled in microtubes for synthesizing cDNA. Afterward, the qRT-PCR technique was carried out with a 14 µL of the reaction mixture, 1 µL of cDNA, 7 µL of low rox Master mix real-time, and 0.5 µL of forward primer (Caspase9: 5ʹTGGCTCCTGGTACGTTGA3ʹ; Bax: 5ʹTTTCTGACGGCAACTTCAACTG3ʹ) and 0.5 µL of reverse primer (Caspase9: 5ʹGAAACAGCATTAGCGACCCT3ʹ; Bax: 5ʹTCCAATGTCCAGCCCATGA3ʹ). The PCR temperature was also optimized by RT-qPCR set: heating at 95 °C for 10 min, 45 cycles at 95 °C for 15 s, annealing at 59 °C for 25 s, and elongation at 72 °C for 30 s. Consequently, the gene expression was determined using a comparative threshold cycle (Ct), and relative gene expression values were normalized to glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and data were calculated as fold change relative to the control.

Cell cycle arrest

In this experiment, the cycle arrest assay was carried out to scrutinize the breast cancer cells’ growth inhibition values after treatment with a 200 nM concentration of Ab-P-P-D sample. This test was implemented as the following procedure: 2 × 10⁵ cells/well of MDA-MB-231 cells were seeded in a 6-well plate which continued by incubating under 37 °C and 5% CO₂ for 24 h. Then, the culture medium of each well of the plate was removed and the prepared Ab-P-P-D specimen was added to the well which followed by further incubation at 37 °C and 5% CO₂ for 5 h. The cancer cells were washed with PBS three times and after trypsinizing were washed with PBS again. Thereafter, breast cancer cells were collected in a falcon tube and were centrifuged at 3000 rpm, in the wake of this process, the cells were stained with PI at 4 °C and light-protected conditions for 40 min. Eventually, MDA-MB-231 breast cancer cells were exposed to flow cytometry for monitoring their cycle arrest values.

Apoptosis assay

The cell apoptosis assay was performed by using a flow cytometer for more evaluation of Ab-P-P-D sample potency in inducing cell apoptosis in breast cancer cells. Briefly, 2 × 10⁵ cell/1mL of MDA-MB-231 cells were seeded in each well of a six-well plate and incubated at 37 °C and 5% CO₂ overnight. After growing cancer cells, they were treated with 200 nM of the Ab-P-P-D formulation and incubated for 5 h. Then, MDA-MB-231 cells were washed with PBS (three times) and were trypsinized. Afterward, MDA-MB-231 cells were washed with PBS and centrifuged at 4000 rpm for 2 min to collect the detached cancer cells, in the wake of this process, the cells were stained with the Annexin V-FITC and PI dye which followed by incubating at dark conditions for 15 min. Ultimately, breast cancer cells were subjected to a flow cytometer for attaining the cell apoptosis quantitative values.

Statistical analysis

The one-way analysis of variance (ANOVA) followed by a t test was used for statistical analyses of data. All experiments were repeated at least three times and results were expressed as mean ± SEM and p values less than 0.05 were considered to be statistically significant.

Results and discussion

Characterization of synthetics

FT-IR analysis

The quality of conjugates, including pure P, P-P, P-P-Ab, and Ab-P-P-D samples was investigated using the FT-IR technique (Fig. 1). Based on results, the characteristic peaks of pure P are earned at about 1112 cm^− 1 and 1252 cm^− 1 due to the presence of C–C bending and C–O stretching vibration, respectively. The peaks observed at around 1574 cm^− 1, 1485 cm^− 1, and 1326 cm^− 1 are attributed to N–H bending of N substituted amide in pure P. Moreover, the characteristic peaks at about 3306 cm^− 1 and 3180 cm^− 1 are indicative of the N–H stretch of amines and anti-symmetric N–H stretch of substituted primary amine in the structure of PAMAM G4, respectively [26, 27]. The absorption peaks of the P-P sample are attained at around 1317 cm^− 1, 1407 cm^− 1, 3150 cm^− 1, and 3272 cm^− 1 which are an indicator of the –C=O stretch, C=O stretch of carbonyl group, C–H stretch, and N–H stretch of amide [28]. Additionally, the upshift of the C=O stretch of conjugated-PEG (amide bond) in the structure of P-P formulation is assigned to formations of the covalent bond [15]. For P-P-Ab formulation, the bonds from 3502 cm^− 1 to 3394 cm^− 1 are owing to amide N–H and C = O stretching, 1643 cm^− 1 is due to –C=O stretch, and 1460 cm^− 1 is corresponding to the conjugation of margetuximab Ab to PAMAM G4 [29, 30]. Besides, the characteristic peaks at around 1241 cm^− 1 and 1396 cm^− 1 (stretching vibrations of the C=O), 1460 cm^− 1 to 1496 cm^− 1 (CH–NH–C=O amides bending), and at around 1651 cm^− 1 and 3370 cm^− 1 (stretching vibrations of C–O and amide, respectively) are indicative of Ab in nano-composite structure [30]. On the other hand, the major absorption peaks of Ab-P-P-D conjugate are obtained at around 1639 cm^− 1 to 1660 cm^− 1 (aromatic ketonic carbonyl stretching) and 1130 cm^− 1 to 1168 cm^− 1 which is related to stretching vibration of the ether linkage (C–O–C) in the carbon ring of quercetin [16]. Furthermore, the characteristic bands at around 3400 cm^− 1 to 3280 cm^− 1 are owing to the OH groups stretching, and 1687 cm^− 1 absorption peak is related to C =O aryl ketonic stretch in the drug-loaded formulation. The C=C aromatic ring stretch bands of quercetin are detected in 1548 cm^− 1, and 1517 cm^− 1 and C–H in aromatic hydrocarbon are observed at 937 cm^− 1, 667 cm^− 1, and 593 cm^− 1 [31].

Fig. 1.

The FT-IR spectra of pure P, P-P, P-P-Ab, and Ab-P-P-D conjugates. The characteristic peaks of PAMAM derivatives are verified the appropriate conjugation of PEG and Ab to PAMAM G4. Also, the curve of quercetin-loaded nano-complex potentially approves the presence of the drug in the structure of Ab-P-P-D

DLS and TEM analyses

The DLS and TEM analyses were employed to evaluate the size, morphology, and zeta potential of dendrimer derivatives (Fig. 2). Applying the DLS technique, the hydrodynamic average size and surface charge of P, P-P, P-P-Ab, and Ab-P-P-D nano-complexes were measured. According to these outputs, the size of pure P and P-P was determined at 4.49 and 66.9 nm. On the other hand, the hydrodynamic size of P-P-Ab formulation was measured at 101.0 nm whereas a slight enhancement in size was observed for drug-loaded nano-complex, 121.0 nm. These increases in size based on conjugating elements or drug loading are potentially approving successful synthesis of PAMAM derivatives and drug loading. Moreover, a slight increase in size after loading of quercetin could be due to the formation of intermolecular interaction between drug and surface of P-P-Ab. On the other hand, TEM images of P-P-Ab and Ab-P-P-D nano-complexes are obtained below 40 nm in diameter with globular shape and morphology which verifying the appropriate size of nano-complexes for drug delivery goals (Fig. 2). PEG and Ab are demonstrated as gelatinous layers around the core of the particle which further approve the successful conjugation of PEG and Ab. According to reports, the size range between 10 and 100 nm is desirable size spectrum for appropriate drug delivery to cancer tissues due to its potential permeation and disperse in cancer tissues and cells. Actually, the vasculature size of cancer tissues is between 200 and 700 nm and a size less than 200 nm can be effectively internalized into the cancer site [32, 18]. Therefore, the synthesized Ab-P-P-D sample can use as an excellent candidate for the delivery of bioactive. Furthermore, Zeta potential data of DLS for P, P-P, P-P-Ab, and Ab-P-P-D nano-complexes are attained + 25.3 mV, + 7.3 mV, – 3.7 mV, and – 18.8 mV, respectively. Since pure P has a positive surface charge owing to amino functional groups on its surface, the PEGylation leads to the elimination of surface positive charges which is appropriate for drug delivery systems. Additionally, the charge of the Ab-P-P-D sample is negative may be owing to the ionization of quercetin. As a result, the antibody and drug are two elements in eliminating the positive charge of nano-complex. According to the literature, the positive charge of nanocarrier results in cytotoxicity for human body normal cells since they can interact with the negative surface charge of normal cells (related to proteoglycans), internalizes into them, and induces apoptosis pathways [33]. Hence, the negative and neutral charges are safer than the positive charge for effective drug delivery.

Fig. 2.

The TEM images of P-P-Ab and Ab-P-P-D synthetics. The TEM images are presented the globular morphology with a size of less than 40 nm for both synthetics. These sizes are appropriate for nanocarriers to act as potential drug delivery systems. The scale bar is 50 nm

TG analysis and drug loading

The thermal stability, physical status, and drug loading capacity of P-P-Ab and Ab-P-P-D samples were measured using a TG device based on the heating-cooling process [34]. According to the data (Fig. 3), the P-P-Ab is demonstrated three weight loss phases: (1) weight loss phase at around 80 to 90 °C (approximately 3% weight loss) is due to water evaporation from the P-P-Ab nano-complex. (2) the second phase of weight loss is recorded at around 190 to 250 °C (about 12% weight loss). (3) Third weight loss is earned at 380 to 420 °C (about 7% weight loss). For Ab-P-P-D nano-complex, two main weigh losses were observed at around 70 to 140 °C (nearly 5% weight loss) and 280 to 370 °C (about 13% weight loss). These results have been depicted the appropriate thermal stability of nano-complexes which is one of the most significant issues at the industrial level. On the other hand, the drug loading capacity of the Ab-P-P-D was calculated at about 21.48% by comparing the weight loss amounts of P-P-Ab and Ab-P-P-D samples [28, 34]. This value is obtained by comparing the amount of weight loss in Ab-P-P-D and P-P-Ab samples. This high level of drug content has been indicating the appropriate capacity of polymeric nanoparticles in carrying the bioactive to cancer cells which makes it as a potential candidate for drug delivery goals [35].

Fig. 3.

The TG analysis of P-P-Ab and Ab-P-P-D specimens. For the Ab-P-P-D nano-complex, two main weight loss phases were observed at around 70 °C to 140 °C (nearly 5% weight loss) and 280 °C to 370 °C (about 13% weight loss). The thermal stability of the sample is appropriate for the industrial process. By comparing the weight loss values of the two samples, the drug content was calculated about 21.48% which is an appropriate loading capacity

Drug release profile

The drug release profile of quercetin, as a therapeutic agent, was evaluated in the normal and acidic pHs to investigate the controlled release manner of Ab-P-P-D (Fig. 4). The controlled and sustained drug release are the prominent issues for nanoparticle-based targeted drug delivery systems in the human body. The controlled release of bioactive using the novel drug delivery systems can be an appropriate substitute for conventional therapeutic approaches [18, 28]. Based on Fig. 4, the release value of quercetin from nanocarrier was determined about 23% within the first 4 h at pH 7.4 while it was 68% for pure drug at the same condition which is remarkably higher than nanocarrier drug release value. Moreover, less than 50% of the nano-complex drug was released at normal pH after 8 h whereas it was about 85% for the pure drug. On the other hand, by reducing the pH of the release medium, the quercetin release was considerably increased at all times which can be due to the protonation of dendrimer at acidic pHs. For example, in comparison to normal pH, the drug release values of nano-complex were more than twofolds at both acidic pHs within 2 h. This issue is showing the pH-sensitive release manner of nanocarrier which is good for the fast drug release at acidic microenvironment and endosomes of cancer cells [36]. Generally speaking, the controlled drug release at normal pH and as well as the fast drug release at acidic environment are the prominent properties of nanoparticle based drug delivery systems which is favorable for effective cancer therapy.

Fig. 4.

The drug release profile of Ab-P-P-D and pure drug at pHs 7.4, 6.0, and 5.0. The controlled drug release manner is depicted for nanocarrier at normal pH. The drug release from nanocarrier is indicated about 23% within the first 4 h at pH 7.4 while it is 68% for pure drug at the same condition which is remarkably higher than Ab-P-P-D drug release value. The acidic microenvironment can protonate the nanocarrier and subsequently, leads to fast drug release which is desirable for efficient drug delivery

MTT analysis

The MTT assay was used to evaluate the cytotoxicity of P, P-P, P-P-Ab, Ab-P-P-D, and pure drug against the MDA-MB-231 cell line (Fig. 5). All formulations with various concentrations (100 nM, 200 nM, 400 nM, and 800 nM) at different times (24 h, 48 h, and 72 h) were investigated on breast cancer cells. In various reports, it was indicated that electrostatic interactions between nano-complex and biomolecules on the surface of human body cells led to cytotoxicity in the whole body [37, 38]. On the other hand, nanoparticle-based targeted drug delivery system can substantially lead to accumulation of high drug concentrations in cancer cells, enhances drug stability in human body serum, increases biocompatibility and biodegradability of bioactive, and eliminates adverse side effects of therapeutic agents [19, 28]. As a result, using novel nanoparticle-based targeted drug delivery systems in cancer therapy is the crucial issue in new therapeutic approaches. Based on results, pure P, Ab-P-P-D, and pure drug (D) were demonstrated concentration-dependent cytotoxicity on breast cancer cells in which the toxicity enhances by increasing sample concentrations. To put it in a more vivid picture, cell viability of pure P was observed 69.39% and 46.35% for 100 nM and 800 nM concentrations after 24 h of treatment, respectively. This cytotoxicity is due to the surface positive amino groups of dendrimer which are prone to joining in intermolecular interactions with negatively charged biomolecules (such as proteoglycans) on the surface of cancer cells. For the pure D sample, the cytotoxicity values were higher than pure P: as 53.82% and 35.8% of the cell viabilities were obtained for lower and higher concentrations at 24 h of post-treatment. Pure drug cytotoxicity is owing to the antitumor effects of quercetin which induces cell apoptosis in the cancer cell line. The excellent cytotoxicity against the MDA-MB-231 breast cancer cell line was detected for Ab-P-P-D nano-complex among the synthetics. As data have been showing 44.39%, 36.12%, 31.85%, and 14.67% of cell viability for 100 nM, 200 nM, 400 nM, and 800 nM after 24 h of treatment, respectively. This high value of cancer cell growth inhibition has been indicating that controlled drug release outside of the cell and immediate drug release inside of endosomes lead to activation of cell death signaling pathway and consequently, inducing cell apoptosis in cancer cells. The IC₅₀ dose (a dose that kills 50% of cells) values for pure P, pure D, and Ab-P-P-D nano-complex were earned at 400 nM, 200 nM, and 100 nM at 24 h of post-treatment, respectively. On the other hand, P-P and P-P-Ab samples have been indicated less cytotoxicity than other samples. For instance, P-P formulation was indicated a cell viability range between 80 and 95% for various concentrations from 100 nM to 800 nM. By increasing the concentration sample, the toxicity values were decreased. This low cytotoxicity is due to the presence of PEG which effectively is covered surface toxic groups of dendrimer and resulted in excellent biocompatibility and biodegradability in cells [18]. For the P-P-Ab sample, cytotoxicity values were a little bit more than the P-P sample which is because of the high level of internalization of the sample which, in turn, leads to accumulation of high dose nano-complex and toxicity on cells. As a matter of fact, receptor-mediated targeted internalization of P-P-Ab which is owing to the presence of Ab results in high values of cellular uptake. Moreover, margetuximab Ab is one of the therapeutic agents in cancer therapy which can block the HER2 receptor on breast cancer cells and induces programmed cell death pathways [22, 23].

Fig. 5.

Cell viability test outputs for dendritic conjugates, including P, P-P, P-P-Ab, Ab-P-P-D, and pure drug, on MDA-MB-231 breast cancer cell line after 24 h, 48 h, and 72 h of treatment with 100 nM, 200 nM, 400 nM, and 800 nM concentrations. Modification of dendrimer with PEG has remarkably reduced the cytotoxicity of the dendrimer since PEG is a biocompatible and biodegradable biomolecule. P-P-Ab nano-complex shows concentration-dependent toxicity on cancer cells which is due to the therapeutic performance of margetuximab and receptor-mediated internalization of the sample. The excellent cancer cell growth inhibition performance is related to the Ab-P-P-D nano-complex

Gene expression analysis

The inhibitory effects of P-P-Ab and Ab-P-P-D nano-complexes on the regulation of apoptotic genes were investigated via Quantitative Real-Time PCR (qRT-PCR). To achieve this, 100 nM (Ab-P-P-D) and 800 nM (P-P-Ab) concentrations of samples were used to evaluate the up-regulation of Bax and Caspase9 apoptotic genes in MDA-MB-231 breast cancer cells. Figure 6 presents the relative expression values of these genes. The quercetin in the compartment of Ab-P-P-D could induce the expression of Bax and Caspase9 apoptotic genes in breast cancer cells. Bax can involve in apoptosis by forming oligomers and puncturing the outer membrane of mitochondria which, in turn, induces apoptosis in cancer cells [39]. On the other hand, the Caspase9 gene can cause apoptosis in cells by the mitochondria-dependent pathway which is based on cytochrome c release. Caspse9 gene results in apoptotic chromatin condensation and DNA fragmentation which consequently, triggers the formation of apoptotic bodies [40]. Based on the results of our experiment, P-P-Ab formulation was not indicated a considerable change in expression of both genes while the breast cancer cells treated with Ab-P-P-D conjugate were demonstrated a remarkable increase in expression values of Bax (nearly eightfolds) and Caspase9 (more than fivefolds) genes. These data have been expressing the potential ability of drug content dendritic nanocarrier in inducing apoptosis in breast cancer cells.

Fig. 6.

The relative expression values of apoptotic genes (Bax and Caspase9) in MDA-MB-231 breast cancer cells after treatment with 100 nM of P-P-Ab and Ab-P-P-D specimens. While P-P-Ab does not show the change in expression values of apoptotic genes, the cells treated with Ab-P-P-D specimen indicate a remarkable enhancement in the expression values of Bax (more than eightfolds) and Caspase9 (more than fivefolds) genes

Cell cycle arrest analysis

The cell cycle arrest assay was performed with 100 nM and 800 nM concentrations of Ab-P-P-D and P-P-Ab samples on MDA-MB-231 breast cells using a flow cytometry approach (Fig. 7). According to outputs, the cell suppression effect of margetuximab and quercetin causes shifting towards a Sub-G1 cell cycle phase. As 3.83% and 6.3% of MDA-MB-231 breast cancer cells were in the Sub-G1 phase for P-P-Ab (800 nM) and Ab-P-P-D (100 nM) nano-complexes, respectively. As a matter of fact, in comparison to control, P-P-Ab and Ab-P-P-D samples indicate nearly twofolds and more than threefolds of cell cycle arrest in breast cancer cells which is due to the effective performance of margetuximab and quercetin in the compartment of nano-complex. These data have been also demonstrating the apoptosis-inducing potency of synthetics in cancer cells [15]. Margetuximab, can effectively bind to the ectodomain of HER2 receptors on the surface of breast cancers and facilitates effective internalization of nanocarriers and cell apoptosis due to receptor blocking performance [22]. On the other hand, quercetin in the body of nano-complex can considerably inhibit cancer cell metastasis by blocking the Akt/mTOR/c-Myc signaling pathway, suppressing ribosomal protein S19 (RPS19)-activated epithelial-mesenchymal transition (EMT) signaling, and downregulating Wnt/β-catenin signaling pathway proteins [25]. These data are in agreement with the outputs of the cell viability test in the previous section.

Fig. 7.

Cell cycle arrest results of MDA-MB-231 breast cancer cell after treatment with 800 nM and 100 nM of P-P-Ab (b) and Ab-P-P-D (c) nano-complexes, respectively. In comparison to control (a), P-P-Ab and Ab-P-P-D samples show nearly twofolds and more than threefolds of cell cycle arrest in breast cancer cells with is due to the effective performance of margetuximab and quercetin in the compartment of nano-complex. The cells in the Sub-G1 phase refer to apoptosis cells

Apoptosis analysis

Apoptosis assay was implemented to figure out the apoptosis-inducing potency of dendritic conjugates on MDA-MB-231 breast cancer cells using a double staining approach based on annexin V-FITC and PI. The cancer cells were treated with 800 nM and 100 nM of P-P-Ab and Ab-P-P-D nano-complexes respectively, which followed by 5 h of incubation (Fig. 8). In apoptotic cells, the inner membrane phospholipid phosphatidylserines (PSs) translocate to the outer layer of the plasma membrane [41, 42]. After double staining, the annexin V can bind to PS in apoptotic cells and the PI stain the DNA fragmentations by intercalating in the DNA structure of dead cells. After exposure to the flow cytometer, the quantitative values of necrotic, apoptotic, and live cells can be counted [43]. As a result, according to the results indicated in Fig. 8c, the quantitative values of total apoptosis (early (Q3) and late apoptosis (Q2)) are raised by 27.5% after treatment with 100 nM of Ab-P-P-D sample while the necrotic cells value is 3.15%. On the other hand, P-P-Ab sample (B) leads to 9.91% late apoptosis and 12.8% early apoptosis which are lower than apoptosis values of drug-contain nano-complex. In comparison to the control (A) group which contains 83.7% (Q4) live cells, synthesized specimens are showed the lower live-cell values (73.8% and 69.3% live cells after treatment with P-P-Ab and Ab-P-P-D). These higher apoptotic values after treatment with Ab-P-P-D specimen are due to receptor-mediated internalization of nano-complex which can induce apoptosis by blocking the Akt/mTOR/c-Myc signaling pathway, suppressing ribosomal protein S19 (RPS19)-activated, and downregulating Wnt/β-catenin signaling pathway proteins [24].

Fig. 8.

Apoptosis potency of P-P-Ab (b) and Ab-P-P-D (c) nano-complexes on breast cancer cells by staining with Annexin VFITC and PI. As depicted, total apoptosis (early (Q3) and late apoptosis (Q2)) is obtained 27.5% after treatment with 100 nM of Ab-P-P-D sample while it is 22.71% for P-P-Ab at 800 nM concentration. Plate A indicates control

Conclusions

In this study, margetuximab- and polyethylene glycol-conjugated PAMAM G4 dendrimers were efficiently synthesized to targeted delivery of quercetin to MDA-MB-231 breast cancer cells. Synthetics were characterized using analytical devices such as FT-IR, TGA, DLS, Zeta potential analyzer, and TEM to the qualification and quantification of syntheses and conjugations. The nanometric size, efficient drug loading capacity, and controlled drug release were observed for nano-complex. The biomedical assays, including cell viability, gene expression, apoptosis, and cell cycle arrest were implemented to scrutinize the breast cancer cell inhibition potency of synthesized nano-complex. The results have been substantially confirming the breast cancer cell growth suppression ability of targeted nano-complex.

Abbreviations

PAMAM

Polyamidoamine

PEG

Polyethylene glycol

Ab

Margetuximab

D

Quercetin

FT-IR

Fourier transform infrared

TGA

Thermogravimetric analysis

DLS

Dynamic light scattering

TEM

Transmission electron microscopy

Funding

The authors have not disclosed any funding.

Declarations

Conflict of interest

The authors declare that they have no conflict of interest.

Ethical statement

We undersigned declare that this manuscript is original, has not been published before and is. not currently being considered for publication elsewhere. We confirm that the manuscript has been read and approved by all named authors and that there are no other persons who satisfied the criteria for authorship but are not listed. We further confirm that the order of authors listed in the manuscript has been approved by all of us. We understand that the Corresponding Author is the sole contact for the Editorial process. He/she is responsible for communicating with the other authors about progress, submissions of revisions and final approval of proofs Signed by all authors as follows: Yasaman Khakinahad, Saeedeh Sohrabi, Shokufeh Razi, Asghar Narmani, Sepideh Khaleghi, Mahboubeh Asadiyun, Hanieh Jafari, Javad Mohammadnejad.

Ethical approval

This article does not contain any studies with human participants or animals performed by any of the authors.