Skip to main content
NCBI home page
Elsevier - PMC COVID-19 Collection logoLink to Elsevier - PMC COVID-19 Collection
. 2022 Jul 26;45:102590. doi: 10.1016/j.nano.2022.102590

Proof-of-concept for speedy development of rapid and simple at-home method for potential diagnosis of early COVID-19 mutant infections using nanogold and aptamer

Satheesh Ellipilli 1,2,3,4,5,1, Hongzhi Wang 1,2,3,4,5,1, Wen-Jui Lee 1,2,3,4,5, Dan Shu 1,2,3,4,5,⁎, Peixuan Guo 1,2,3,4,5,⁎
PMCID: PMC9315840  PMID: 35905841

Abstract

The positive single-stranded nature of COVID-19 mRNA led to the low proof-reading efficacy for its genome authentication. Thus mutant covid-19 strains have been rapidly evolving. Besides Alpha, Beta, Gamma, Delta, and Omicron variants, currently, subvariants of omicron are circulating, including BA.4, BA.5, and BA.2.12.1. Therefore, the speedy development of a rapid, simple, and easier diagnosis method to deal with new mutant covid viral infection is critically important. Many diagnosis methods have been developed for COVID-19 detection such as RT-PCR and antibodies detection. However, the former is time-consuming, laborious, and expensive, and the latter relies on the production of antibodies making it not suitable for the early diagnosis of viral infection. Many lateral-flow methods are available but might not be suitable for detecting the mutants, Here we proved the concept for the speedy development of a simple, rapid, and cost-effective early at-home diagnosis method for mutant Covid-19 infection by combining a new aptamer. The idea is to use the current lateral flow Covid-19 diagnosis system available in the market or to use one existing antibody for the Lateral Flow Nitrocellulose filter. To prove the concept, the DNA aptamer specific to spike proteins (S-proteins) was conjugated to gold nanoparticles and served as a detection probe. An antibody that is specific to spike proteins overexpressed on COVID viral particles was used as a second probe immobilized to the nitrocellulose membrane. The aptamer conjugated nanoparticles were incubated with spike proteins for half an hour and tested for their ability to bind to antibodies anchored on the nitrocellulose membrane. The gold nanoparticles were visualized on the nitrocellulose membrane due to interaction between the antigen (S-protein) with both the aptamer and the antibody. Thus, the detection of viral antigen can be obtained within 2 h, with a cost of less than $5 for the diagnosis reagent. In the future, as long as the mutant of the newly emerged viral surface protein is reported, a peptide or protein corresponding to the mutation can be produced by peptide synthesis or gene cloning within several days. An RNA or DNA aptamer can be generated quickly via SELEX. A gold-labeled aptamer specific to spike proteins (S-proteins) will serve as a detection probe. Any available lateral-flow diagnosis kits with an immobilized antibody that has been available on the market, or simply an antibody that binds COVID-19 virus might be used as a second probe immobilized on the nitrocellulose. The diagnosis method can be carried out by patients at home if a clinical trial verifies the feasibility and specificity of this method.

Keywords: Oligonucleotide aptamer, Spike protein, Lateral flow assay, Early-stage COVID-19 diagnosis

Graphical abstract

Unlabelled Image

Open in a new tab

Background

COVID-19 emerged in 2019 and rapidly progressed to a pandemic stage within 4–6 months and caused severe repercussions on human health. COVID-19 is named Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-Cov-2) based on its phylogeny and taxonomy.1 COVID-19 is highly infectious with high transmissibility, and pathogenicity.2, 3, 4, 5 It's positive sense single (ss-plus) stranded nature of the genome led to the low proof-reading rate for genome authentication. Thus new mutant strains have been rapidly evolving. Besides Alpha, Beta, Gamma, Delta, and Omicron variants, recently, subvariants of Omicron such as BA.4, BA.5, and Ba.2.12.1 also emerged.30, 31, 32, 33, 34 Therefore, many diagnosis methods have been developed for COVID-19 detection.6, 7, 8 Viral culture is the gold standard for viral infection diagnosis. However, it is time-consuming and requires a high biosafety laboratory. Real-time reverse transcriptase-polymerase chain reaction (RT-PCR) is a widely used diagnostic method for detecting specific viral nucleic acid sequences.9, 10, 11, 12 Though the RT-PCR method is useful for early detection of the Covid-19, it has its own limitations such as difficulty in sample collection, transportation, and RNA extraction.13 , 14 , 35 On the other hand, the ELISA test is used for the COVID-19 diagnosis, but its non-specificity limits it due to conserved antigens among different Corona viral species used in the ELISA test. Besides, the method needs at least two weeks post-infection to detect antibodies.15, 16., 17 Therefore, developing a simple, rapid, reliable, and point of care COVID-19 diagnosis kit would be helpful to diagnose and isolate the infected people, thus reducing the spread of the viral infection. Lateral flow method has been used in COVID-19 diagnosis.36, 37, 38, 39, 40, 41, 42 Serological assays based on recombinant antigens derived viral surface proteins such as Spike (S) and Nucleocapsid (N) proteins are also used in laboratory diagnostics.18 , 19 Unlike other methods, the serological test does not need special technical requirements, on top of that, it requires less time, a lower sample, and has a high detection sensitivity.35, 43 Therefore, serological testing can be used as an adjuvant to rRT-PCR for COVID-19 detection.39 Most of the serological methods utilize protein antigens, however, compared with protein antigens, aptamers are easy to obtain in large quantities at a low cost and are considered as useful diagnoistic agents.44 DNA/RNA aptamers (artificial antibodies) are selected by an in vitro procedure called SELEX (systematic evolution of ligands by exponential enrichment).20 , 45 The selected aptamers can adopt unique tertiary structures and can recognize target molecules with novel applications. RNA or DNA aptamers have been used in the application of lateral flow to replace the antibodies.42, 46, 47, 48 The motifs and rubbery nature of RNA and aptamers have been utilized for various applications ranging from diagnosis to therapy.21, 49, 50, 51 In this study, we used a DNA aptamer that is specific to SARS-Cov-2 S-protein with high affinity (Kd ~ 5.8 nM).22

Here, we propose an alternative lateral flow diagnosis method for the early diagnosis of COVID-19. The approach is based on the use of aptamers that can bind to viral proteins such as spike protein or nucleocapsid protein present on the virus's surface.24, 25, 26 The DNA aptamers are conjugated to gold nanoparticles via direct covalent conjugation using thiol chemistry or streptavidin and biotin interaction. Gold conjugation to oligonucleotides allowed for various applications in nanotechnology and diagnostics due to their unique physicochemical properties.27 , 28 The aptamer-gold complex acts as a detection probe and specifically binds to viral particles and exhibits color when the samples run against the respective antibodies pre-anchored on the nitrocellulose membrane, as shown in Fig. 1 . The gold-aptamer conjugate binds to the S-protein and is concentrated into a band upon binding to the pre-anchored antibody and exhibited red color. Patients can carry out this diagnosis method at home if a clinical trial verifies the feasibility of this method. The developed method can also be extended to detect mutated SARS-CoV2 particles by cloning the mutated antibody and selecting an appropriate oligonucleotide aptamer for spike or nucleocapsid proteins using SELEX. The antibody (Ab) can be from the wild-type virus or it can be any one of the high-title Ab that is currently available in the market. Any available antibody that can bind the wild-type COVID virus can be used as a second probe that is immobilized to the nitrocellulose. The only component that is needed is the aptamer. As long as the mutant sequence of the newly emerged viral surface protein is reported, a peptide or protein corresponding to the mutation can be produced by peptide synthesis or gene cloning and an RNA or DNA aptamer for the protein can be generated quickly via SELEX. Suppose a clinical trial verifies the feasibility of this method, the diagnosis method can be carried out by patients at home, similar to nitrocellulose for the diagnosis of pregnancy.

Fig. 1.

Fig. 1

Open in a new tab

Illustration of the design of a fast diagnosis device for COVID-19 infection using a combination of DNA/RNA aptamer and antibodies on a nitrocellulose membrane.

Materials and methods

Materials for lateral flow study

The DNA aptamer for S-protein sequence was derived from42 5′- CAGCACCGACCTTGTGCTTTGGGAGTGCTGGTCCAAGGGCGTTAATGGACA-3′.

The DNA strands were purchased from IDT. The bare gold nanoparticles and streptavidin-coated gold nanoparticles were purchased from Sigma-Aldrich, and the commercially available antibody, Rabbit anti-SARS-CoV-2-S2 purchased from Sino Biotech. The nitrocellulose membrane FF120HP Plus was used for the lateral flow study obtained from Cytiva.

DNA-aptamer conjugation to gold nanoparticles

DNA-aptamer conjugation to gold nanoparticles was achieved in two methods. i) DNA-aptamer with 5′-end thiol group conjugation to gold nanoparticles. ii) DNA-aptamer with 5′-biotin conjugations to streptavidin-coated gold nanoparticles.

i. DNA-aptamer with 5′-end thiol group conjugation to gold nanoparticles: The DNA aptamer with a 5′-end thiol group (50 to 100 μM of 100 μl) was treated with TCEP solution at a final concentration of 5.0 mM for 1 h. To the reaction mixture, gold nanoparticles (10×) and dATP (0.1 mM at final concertation) were added and incubated for 45.0 min. The addition of dATP helps to prevent nonspecific interaction of DNA aptamer to the gold surface. Then, 20.0 mM sodium chloride solution is added to the above reaction mixture and incubated at room temperature overnight. The addition of sodium chloride is to reduces the repulsions between DNA strands and facilitates higher conjugation. The sodium chloride concertation gradually increased to 100.0 mM for 24 h. The aptamer conjugated gold nanoparticles were purified by centrifuging at 10,000 rpm for 10.0 min under cold conditions (4 °C). The gold pellet was washed by repeating it twice by adding 100 to 200 μl of deionized water. The gold nanoparticles were stored in deionized water having 1 % BSA, 0.1 % triton, 2 % sucrose, and 0.02 % NaN3.

ii. DNA-aptamer with 5′-biotin conjugations to streptavidin-coated gold nanoparticles: Biotin conjugated DNA aptamers were incubated with the S-protein for 30 min at room temperature, then the mixture was incubated with Streptavidin-coated gold nanoparticles for one hour at room temperature. Then, the gold-nanoparticles with the S-proteins were purified from the excess DNA aptamer removed by centrifugation at 1000 rpm. The gold pellet was redissolved in deionized water. The protein labeled gold nanoparticle samples was run against the spike antibody pre-anchored on the nitrocellulose membrane at 250.0 ng/μl.

Assembly of lateral flow assay strips

The components needed for the lateral flow assay were assembled on the PVC backing in the order of sample pad, conjugate pads, nitrocellulose membrane, and absorbent pad. Anti-SARS-CoV-2 antibodies were striped onto the nitrocellulose cards using a lateral flow reagent dispenser (LFRD, Claremont BioSolutions, Upland, CA, USA) set to a head speed of 4.5 V voltage and Hamilton 100 μl syringe using a syringe pump set to a flow rate of 0.2 ml/min. After the four antibodies were striped on the card, the card was dried at room temperature overnight. The strips were cut to 3.3 mm wide and stored under room temperature drying conditions.

Lateral flow assay procedure

The standard S protein samples of 0.25 mg/ml were diluted to different concentrations (0.0, 2.0, 3.9, 7.8, 15.6, 31.3, 62.5, 125, and 250 μg/ml) with 0.1 M PBS buffer solution (pH 7.4). Before each test, 5 μl of S protein samples with different dilutions were added to a 0.6 ml test tube, then 5 μl 20 μM Biotinylated DNA aptamer was aliquoted to the tube. The complex was incubated at room temperature for 30 min followed by adding 15 μl Streptavidin-Gold nanoparticles. The complex was further incubated at room temperature for 1 h and dropped on the conjugation pad. 100 μl running buffer (0.1 M PBS, 1 % BSA, 0.1 % Triton × 100) was dropped on the sample pad, and the detection results were observed after 15 min. Furthermore, to evaluate the feasibility of nitrocellulose membrane strip in detecting real patient samples, S-protein pre-mixed with physiological buffer was used for analysis. In a typical experiment, we collected urine and blood sample from mice. The same analysis was applied.

Results

Two methods for the conjugation of the aptamer to gold nanoparticles

Aptamers are DNA/RNA sequences with a secondary structure with a high affinity towards their respective analytes with antibody-like specificity. The aptamers are widely used to develop biosensors and diagnostic tools due to their ease of synthesis and cost-effective production. The DNA aptamer selective for S-protein was conjugated to gold nanoparticles using two approaches: i) Conjugation of DNA aptamer for S-protein(spike-aptamer) to gold nanoparticles by thiol-chemistry. ii) Synthesis of the biotin-labeled aptamer and conjugation of the DNA aptamer for S-protein the commercially available streptavidin-coated gold nanoparticles using biotin-streptavidin interaction.

Conjugation of DNA aptamer for S-protein(spike-aptamer) to gold nanoparticles by thiol-chemistry

The DNA aptamer with a 5′-end thiol group was conjugated to gold nanoparticles using reduction chemistry. The DNA aptamer was incubated with TCEP to break disulfide bonds. The DNA aptamer was incubated with gold nanoparticles in the presence of dATP and sodium chloride to facilitate the aptamer conjugation to gold with high fidelity. The aptamer conjugated gold nanoparticles were purified by centrifugation to remove unbound DNA. To confirm the DNA aptamer conjugation to gold nanoparticles, a Cy3-conjugated small complementary DNA fragment was used. The aptamer labeled gold nanoparticles were characterized using 1 % agarose gel by hybridizing with its complementary strand harboring Cy3 fluorophore, as shown in Fig. 2 .

Fig. 2.

Fig. 2

Open in a new tab

S-DNA-aptamer conjugation to gold nanoparticles: A) Snap of the gold-nanoparticle gel; B) Ethidium bromide channel; C) Cy3-channel. 1. 1 kb ladder; 2. Bare gold nanoparticles; 3. Gold + Cy3-DNA; 4. Gold-DNA-aptamer for spike protein; 5. Gold-DNA-aptamer + Cy3-DNA; 6. Gold-DNA-aptamer for nucleocapsid-protein; Gold-DNA-aptamer for nucleocapsid protein + Cy3-DNA.

Synthesis of the biotin-labeled aptamer and conjugation of the DNA aptamer for S-protein to the commercially available streptavidin-coated gold nanoparticles using biotin-streptavidin interaction

Using phosphoramidite chemistry, the biotin can be conveniently conjugated to DNA aptamer during solid-phase DNA synthesis. Conjugation of the aptamer to gold-nanoparticles is achieved through biotin-streptavidin interaction. The DNA aptamer with 5′-biotin was incubated with streptavidin-coated gold nanoparticles at room temperature to facilitate the DNA conjugation to gold nanoparticles. The DNA conjugated gold nanoparticles were purified from free DNA using centrifugation. The gold nanoparticles bearing the DNA aptamer were redissolved in deionized water for further use.

Immobilization of the commercially available anti-covid 19 antibodies to the nitrocellulose and design of lateral flow method for COVID-19 diagnosis

The proposed method requires two probes, as shown in Fig. 1. One is a detection probe conjugated to gold nanoparticles using either thiol chemistry or biotin-streptavidin interaction. A DNA aptamer is specific to the SARS-CoV-2 virus S-protein used as a detection probe. The second is a capture probe that is the antibody to the S-protein pre-anchored on the nitrocellulose membrane by placing the antibody on the nitrocellulose membrane at 250.0 ng/μl concentration. Then, the viral samples such as saliva, blood serum, or nasal swabs can be incubated with the detection probe and run over the Spike-antibody pre-immobilized on the nitrocellulose membrane. The complex of viral particles and the detection probe binds to the capture probe, concentrates the viral particles into a thick band, and exhibits red color. The visible color can serve as a positive signal for virus detection. As the SARS-CoV-2 viruses are highly infectious and transmissible, we were restricted to using S-proteins instead of specimen samples.

Demonstration of lateral flow using aptamer conjugated gold nanoparticles for spike proteins

The importance for Point of Care Diagnosis (POCD) of human diseases increases as it is simple to perform, specific, low cost, robust, and equipment free. Nanosensing platforms revolutionized molecular diagnostics due to their unique physical and chemical properties, particularly gold nanoparticles are suitable for POCD. The gold nanoparticles are widely used for diagnosis due to their unique optical properties arising from their surface plasmon resonance. Besides, the gold nanoparticles are easy to functionalize which allows them to conjugate various molecular recognition elements needed for diagnosis. Therefore, we chose gold nanoparticles to develop a detection probe for COVID-19 diagnosis. The selected DNA aptamer is conjugated to gold nanoparticles using thiol chemistry and biotin-streptavidin interaction and serves as a detection probe. The detection probe was incubated with varying concentrations of SARS-CoV-2 spike proteins. And, the capture probe (viz., antibody to the spike protein) is anchored on the nitrocellulose membrane. Then, a lateral flow test was performed by running the spike-protein detection samples, pre-incubated with the detection probe against the spike-antibodies, which are pre-immobilized on the nitrocellulose membrane. The complex of spike-protein and the gold-nanoparticles binds to the capture probe and concentrates the S-protein into a thick band, exhibiting red color.

Lateral flow test for S-protein using aptamer conjugated gold nanoparticles through thiol chemistry

DNA aptamer conjugated gold nanoparticles incubated with the respective S-proteins at different concentrations starting from 250.0 ng/μl to 0.0 ng/μl in a serial dilution to detect the minimum detection limit by visualizing the changes of intensity in optical signals at the Test line on nitrocellulose membrane is shown in Fig. 3 . The results indicated that the minimum concentration of S-protein that can be detected on nitrocellulose membrane was 7.8 ng/μl. Upon increasing the S-protein concentration, the brightness at the test line is gradually increased.

Fig. 3.

Fig. 3

Open in a new tab

Concertation limit determination: S-antibody anchored on the nitrocellulose membrane is titrated against S-aptamer conjugated gold nanoparticles through thiol chemistry, after their incubation with s-protein solution from 250 ng/μl to 0 ng/μL.

Lateral flow test for S-protein using aptamer conjugated gold nanoparticles through biotin-streptavidin interaction

Aptamer-conjugated gold nanoparticles through biotin-streptavidin interaction were incubated with the respective S-proteins at different concentrations starting from 250.0 ng/μl to as low as 0.0 ng/μl and then applied to the LFA test (Fig. 4 , lanes 1–9, & 11). The detection limit was determined by visualizing the optical signal change on the Test line, and it was found to be 2.0 ng/μl. To further demonstrate that the S-protein concentrates at the test line by binding to its antibody with specificity, the S-proteins are covalently linked to the gold nanoparticles using a commercially available protein labeling kit and used as a positive control (Fig. 4, lane 10). Thus, the results demonstrate that the LFA test using DNA aptamer indeed binds to S-proteins, which in turn binds to spike-antibody, showing the aptamers' potential for the development of an early diagnosis kit. Besides sensitivity, the specificity evaluation of the detection probe binding to spike protein is also an important parameter. There was no coloration at the test line when BSA (250.0 ng/μl) was used instead of spike-proteins, suggesting that the spike-protein binding to its antibodies is specific.

Fig. 4.

Fig. 4

Open in a new tab

Concertation limit determination: S-antibody anchored on the nitrocellulose membrane is titrated against S-aptamer conjugated gold nanoparticles through biotin and streptavidin interaction, after their incubation with s-protein solution from 250 ng/μl to 0 ng/μL.

Lateral flow test in different physiological buffers

The gold nanoparticle usually undergoes aggregation in the presence of physiological buffers such as phosphate buffer saline, Fetal bovine serum, saliva, etc. Therefore, the aptamer conjugated gold nanoparticles were tested for their feasibility and stability in different physiological buffers. The gold-nanoparticles and S-protein complex were prepared in phosphate buffer, fetal bovine serum (FBS), and cell culture serum at 125.0 ng/μl concentration. The spike-protein bound gold nanoparticles ran against S-antibody pre-anchored on the nitrocellulose membrane. The results showed that the gold nanoparticles are stable and could successfully bind the S-anybody on the nitrocellulose membrane as evident from the red color exhibited by gold nanoparticles as seen in Fig. 5 . Therefore, the developed method would be simple, fast, cost-effective, and reliable and might be beneficial for the early detection of the SARS-Cov-2 virus from patient samples.

Fig. 5.

Fig. 5

Open in a new tab

Photographs of LFA strips used to test S-protein samples using DNA-aptamer conjugated gold nanoparticles in physiological buffers. A) LFA result of S-protein samples in various physiological buffers (1. 1× PBS, 2. 20 % FBS, 3. Cell culture media, respectively) using gold nanoparticle conjugated to DNA aptamer through thiol chemistry. B) LFA result of S-protein samples in various physiological buffers (4. 1× PBS, 5. 20 % FBS, 6. Cell culture media, respectively) using gold nanoparticle conjugated to DNA aptamer through biotin-streptavidin interaction.

Method to produce the surface proteins of the mutant virus

Wildtype S-proteins are used in this study instead of viral particles as a proof of concept for developing an at-home COVID-19 diagnosis kit. As long as the mutant of the newly emerged viral surface protein is reported, the method can be further extended for mutant strains by producing corresponding proteins to the mutation via gene cloning within a few days.

Production of the aptamer against the S-proteins of the mutant virus

A DNA aptamer is used in the current study for the development of a COVID-19 diagnosis kit as a proof of concept. And the method would be extended to mutant S-proteins and viruses by developing corresponding DNA/RNA aptamers against respective mutant S-proteins using SELEX. The SELEX is a well-known method for the development of aptamers which is a relatively easier and cost-effective method.

Discussion

Many lateral flow diagnosis methods have been developed for COVID-19 detection.52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62 The aptamer-based lateral flow method would be advantageous since the aptamers can be prepared quickly to recognize the S-proteins as targets. Moreover, the aptamers can differentiate structurally similar CoV-related proteins due to their unique tertiary structures of versitiality, a diversity that protein-antibody might not be lacking.21, 49, 51 The rapid growth of RNA nanotechnology will offer new approaches to generate special RNA probes with easy-detection-markers.49, 51 The developed method for detecting S-proteins using the combination of aptamer and antibody on the nitrocellulose membrane can serve as a proof of concept. And the method would be adopted to diagnose COVID and its mutant strains by cloning respective antibodies and selecting aptamers for mutated spike proteins. A gold-labeled aptamer specific to the mutant S-proteins can serve as a detection probe. Antibodies that can bind to the mutant COVID virus can be used as a probe that is immobilized to the nitrocellulose. As the aptamer conjugated gold nanoparticles are bright in color and exhibit visible red color upon binding to the antibody on the nitrocellulose membrane thus, they can be visualized by naked eye without the need for any sophisticated instrumentation. The developed diagnostic method might be applicable for patient samples and reduce the burden, time, and cost of adjusting diagnosis methods.

Conclusion

The concept of the rapid development of new diagnostic systems to meet the rapid evolution of COVID-19 mutations was reported. The approach is to quickly produce a new RNA or DNA aptamer when the sequence of the new mutant has been reported and to combine it with the existing common antibody. The designed and developed COVID-19 detection method using the lateral flow method would be a simple, low-cost, and reliable point of care diagnosis method. The nucleic acid aptamers could specifically find and bind to mutant S-proteins strongly. The aptamer-gold conjugate could bind to SARS-CoV-2 S-protein even at low concentrations (~2.0 ng/μl) and exhibit red color upon binding to the spike-antibody present on the nitrocellulose membrane. Thus, the developed method might be applicable to detect SARS-CoV-2 viruses and would be visualized on the LFA strip without the need for any sophisticated instrumentation. The diagnostic method could be extended to the detection of the new mutant COVID strains.

CRediT authorship contribution statement

Peixuan Guo and Dan Shu were in charge of the project design and grant proposal in early 2020 at the beginning of the COVID-19 pandemic. Dan Shu is the principal investigator of this project and the PI who received the funding for this project. Hongzhi Wang, Satheesh Ellipilli, and Dan Shu all equally contributed to the experimental conduct of the project led by Dan Shu. All authors discussed and analyzed the results. Hongzhi Wang and Dan Shu prepared the first draft of the manuscript under the advice of Peixuan Guo; Sateesh Ellipilli and Peixuan Guo participated in the revision of this manuscript.

Declaration of competing interest

P.G. is the lisencor, grantee, and consultant of Oxford Nanopore Technologies; and the co-founder and Board member of ExonanoRNA.

Acknowledgments

The work was mainly supported by The Ohio State University Office of Research's Covid-19 Seed Grant to D.S. and partially supported by NIH Grant R01CA257961 to Dan Shu and Daniel W. Binzel. The authors are grateful to Dr. Hongran Yin for her technical support. P.G.'s Sylvan G. Frank Endowed Chair position in Pharmaceutics and Drug Delivery from the CM Chen Foundation.

References

  • 1.Wiersinga W.J., Rhodes A., Cheng A.C., Peacock S.J., Prescott H.C. Pathophysiology, transmission, diagnosis, and treatment of coronavirus disease 2019 (covid-19): a review. JAMA. 2020;324:782–793. doi: 10.1001/jama.2020.12839. [DOI] [PubMed] [Google Scholar]
  • 2.Bai Y., Yao L., Wei T., Tian F., Jin D.Y., Chen L., et al. Presumed asymptomatic carrier transmission of covid-19. JAMA. 2020;323:1406–1407. doi: 10.1001/jama.2020.2565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Long Q.X., Tang X.J., Shi Q.L., Li Q., Deng H.J., Yuan J., et al. Clinical and immunological assessment of asymptomatic sars-cov-2 infections. Nat Med. 2020;26:1200–1204. doi: 10.1038/s41591-020-0965-6. [DOI] [PubMed] [Google Scholar]
  • 4.Wang W., Xu Y., Gao R., Lu R., Han K., Wu G., et al. Detection of sars-cov-2 in different types of clinical specimens. JAMA. 2020;323:1843–1844. doi: 10.1001/jama.2020.3786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Wynants L., Van Calster B., Collins G.S., Riley R.D., Heinze G., Schuit E., et al. Prediction models for diagnosis and prognosis of covid-19: systematic review and critical appraisal. BMJ. 2020;369 doi: 10.1136/bmj.m1328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ayouba A., Thaurignac G., Morquin D., Tuaillon E., Raulino R., Nkuba A., et al. Multiplex detection and dynamics of igg antibodies to sars-cov2 and the highly pathogenic human coronaviruses sars-cov and mers-cov. J Clin Virol. 2020;129 doi: 10.1016/j.jcv.2020.104521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Dobano C., Vidal M., Santano R., Jimenez A., Chi J., Barrios D., et al. Highly sensitive and specific multiplex antibody assays to quantify immunoglobulins m, a, and g against sars-cov-2 antigens. J Clin Microbiol. 2021;59 doi: 10.1128/JCM.01731-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.von Rhein C., Scholz T., Henss L., Kronstein-Wiedemann R., Schwarz T., Rodionov R.N., et al. Comparison of potency assays to assess sars-cov-2 neutralizing antibody capacity in covid-19 convalescent plasma. J Virol Methods. 2021;288 doi: 10.1016/j.jviromet.2020.114031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Bwire G.M., Majigo M.V., Njiro B.J., Mawazo A. Detection profile of sars-cov-2 using rt-pcr in different types of clinical specimens: a systematic review and meta-analysis. J Med Virol. 2021;93:719–725. doi: 10.1002/jmv.26349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sule W.F., Oluwayelu D.O. Real-time rt-pcr for covid-19 diagnosis: challenges and prospects. Pan Afr Med J. 2020;35:121. doi: 10.11604/pamj.supp.2020.35.24258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Lisboa Bastos M., Tavaziva G., Abidi S.K., Campbell J.R., Haraoui L.P., Johnston J.C., et al. Diagnostic accuracy of serological tests for covid-19: systematic review and meta-analysis. BMJ. 2020;370 doi: 10.1136/bmj.m2516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Silva Junior J.V.J., Merchioratto I., de Oliveira P.S.B., Rocha Lopes T.R., Brites P.C., de Oliveira E.M., et al. End-point rt-pcr: A potential alternative for diagnosing coronavirus disease 2019 (covid-19) J Virol Methods. 2021;(288) doi: 10.1016/j.jviromet.2020.114007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Kruttgen A., Cornelissen C.G., Dreher M., Hornef M.W., Imohl M., Kleines M. Comparison of the sars-cov-2 rapid antigen test to the real star sars-cov-2 rt. pcr kit. J Virol Methods. 2021;288 doi: 10.1016/j.jviromet.2020.114024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Tahamtan A., Ardebili A. Real-time rt-pcr in covid-19 detection: issues affecting the results. Expert Rev. Mol Diagn. 2020;20:453–454. doi: 10.1080/14737159.2020.1757437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Muller K., Girl P., von Buttlar H., Dobler G., Wolfel R. Comparison of two commercial surrogate elisas to detect a neutralizing antibody response to sars-cov-2. J Virol Methods. 2021;292 doi: 10.1016/j.jviromet.2021.114122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Petherick A. Developing antibody tests for sars-cov-2. Lancet. 2020;395:1101–1102. doi: 10.1016/S0140-6736(20)30788-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Woloshin S., Patel N., Kesselheim A.S. False negative tests for sars-cov-2 infection - challenges and implications. N Engl J Med. 2020;383 doi: 10.1056/NEJMp2015897. [DOI] [PubMed] [Google Scholar]
  • 18.Amanat F., Stadlbauer D., Strohmeier S., Nguyen T.H.O., Chromikova V., McMahon M., et al. A serological assay to detect sars-cov-2 seroconversion in humans. Nat Med. 2020;26:1033–1036. doi: 10.1038/s41591-020-0913-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Krammer F., Simon V. Serology assays to manage covid-19. Science. 2020;368:1060–1061. doi: 10.1126/science.abc1227. [DOI] [PubMed] [Google Scholar]
  • 20.Darmostuk M., Rimpelova S., Gbelcova H., Ruml T. Current approaches in selex: an update to aptamer selection technology. Biotechnol Adv. 2015;33:1141–1161. doi: 10.1016/j.biotechadv.2015.02.008. [DOI] [PubMed] [Google Scholar]
  • 21.Park K.S. Nucleic acid aptamer-based methods for diagnosis of infections. Biosens Bioelectron. 2018;102:179–188. doi: 10.1016/j.bios.2017.11.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Song Y., Song J., Wei X., Huang M., Sun M., Zhu L., et al. Discovery of aptamers targeting the receptor-binding domain of the sars-cov-2 spike glycoprotein. Anal Chem. 2020;92:9895–9900. doi: 10.1021/acs.analchem.0c01394. [DOI] [PubMed] [Google Scholar]
  • 24.Du L., He Y., Zhou Y., Liu S., Zheng B.J., Jiang S. The spike protein of sars-cov–a target for vaccine and therapeutic development. Nat Rev. Microbiol. 2009;7:226–236. doi: 10.1038/nrmicro2090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Marien J., Ceulemans A., Michiels J., Heyndrickx L., Kerkhof K., Foque N., et al. Evaluating sars-cov-2 spike and nucleocapsid proteins as targets for antibody detection in severe and mild covid-19 cases using a luminex bead-based assay. J Virol Methods. 2021;288 doi: 10.1016/j.jviromet.2020.114025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Premkumar L., Segovia-Chumbez B., Jadi R., Martinez D.R., Raut R., Markmann A., et al. The receptor binding domain of the viral spike protein is an immunodominant and highly specific target of antibodies in sars-cov-2 patients. Sci Immunol. 2020;5 doi: 10.1126/sciimmunol.abc8413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Yeh Y.C., Creran B., Rotello V.M. Gold nanoparticles: preparation, properties, and applications in bionanotechnology. Nanoscale. 2012;4:1871–1880. doi: 10.1039/c1nr11188d. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Guo P. The emerging field of rna nanotechnology. Nat Nanotechnol. 2010;5:833–842. doi: 10.1038/nnano.2010.231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Phan T., Boes S., McCullough M., Gribschaw J., Marsh J.W., Harrison L.H., et al. First detection of sars-cov-2 omicron BA.4 variant in western pennsylvania, united states. J Med Virol. 2022;94(9):4053–4055. doi: 10.1002/jmv.27846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tuekprakhon A., Nutalai R., Dijokaite-Guraliuc A., Zhou D., Ginn H.M., Selvaraj M., et al. Antibody escape of sars-cov-2 omicron BA.4 and BA.5 from vaccine and BA.1 serum. Cell. 2022;185(14):2422–2433 e13. doi: 10.1016/j.cell.2022.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wang Q., Guo Y., Iketani S., Nair M.S., Li Z., Mohri H., et al. Antibody evasion by sars-cov-2 omicron subvariants BA.2.12.1, BA.4, & BA.5. Nature. 2022 doi: 10.1038/s41586-022-05053-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Tegally H., Moir M., Everatt J., Giovanetti M., Scheepers C., Wilkinson E., et al. Emergence of sars-cov-2 omicron lineages BA.4 and BA.5 in South Africa. Nat Med. 2022 doi: 10.1038/s41591-022-01911-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Cao Y., Yisimayi A., Jian F., Song W., Xiao T., Wang L., et al. BA.2.12.1, BA.4 and BA.5 escape antibodies elicited by omicron infection. Nature. 2022 doi: 10.1038/s41586-022-04980-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Liu D., Shen H., Zhang Y., Shen D., Zhu M., Song Y., et al. A microfluidic-integrated lateral flow recombinase polymerase amplification (mi-if-rpa) assay for rapid covid-19 detection. Lab Chip. 2021;21(10):2019–2026. doi: 10.1039/d0lc01222j. [DOI] [PubMed] [Google Scholar]
  • 36.Kahn M., Schuierer L., Bartenschlager C., Zellmer S., Frey R., Freitag M., et al. Performance of antigen testing for diagnosis of covid-19: a direct comparison of a lateral flow device to nucleic acid amplification based tests. BMC Infect Dis. 2021;21(1):798. doi: 10.1186/s12879-021-06524-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Higgins R.L., Rawlings S.A., Case J., Lee F.Y., Chan C.W., Barrick B., et al. Longitudinal sars-cov-2 antibody study using the easy check covid-19 igm/igg lateral flow assay. PLoS One. 2021;16(3):e0247797. doi: 10.1371/journal.pone.0247797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Moshe M., Daunt A., Flower B., Simmons B., Brown J.C., Frise R., et al. Sars-cov-2 lateral flow assays for possible use in national covid-19 seroprevalence surveys (react 2): diagnostic accuracy study. BMJ. 2021;372:n423. doi: 10.1136/bmj.n423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Chan C.W, Shahul S., Coleman C., Tesic V., Parker K., Yeo K.J. Evaluation of the truvian easy check covid-19 igm/igg lateral flow device for rapid anti-sars-cov-2 antibody detection. Am J Clin Pathol. 2021;155(2):286–295. doi: 10.1093/ajcp/aqaa221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Roda A., Cavalera S., Di Nardo F., Calabria D., Rosati S., Simoni P., et al. Dual lateral flow optical/chemiluminescence immunosensors for the rapid detection of salivary and serum iga in patients with covid-19 disease. Biosens Bioelectron. 2021;172:112765. doi: 10.1016/j.bios.2020.112765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Lee W., Straube S., Sincic R., Noble J.A., Montoy J.C., Kornblith A.E., et al. Clinical evaluation of a covid-19 antibody lateral flow assay using point of care samples. medRxiv. 2020 [Google Scholar]
  • 42.Yang L.F., Kacherovsky N., Panpradist N., Wan R., Liang J., Zhang B. Aptamer sandwich lateral flow assay (aptaflow) for antibody-free sars-cov-2 detection. Anal Chem. 2022;94(20):7278–7285. doi: 10.1021/acs.analchem.2c00554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Kim C., Yoo Y.K., Lee N.E., Lee J., Kim K.H., Lee S., et al. Nanoelectrokinetic-assisted lateral flow assay for covid-19 antibody test. Biosens Bioelectron. 2022;212:114385. doi: 10.1016/j.bios.2022.114385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Zhou W., Huang P.J., Ding J., Liu J. Aptamer-based biosensors for biomedical diagnostics. Analyst. 2014;139(11):2627–2640. doi: 10.1039/c4an00132j. [DOI] [PubMed] [Google Scholar]
  • 45.Ellington A.D., Szostak J.W. In vitro Selection of rna molecules that bind specific ligands. Nature. 1990;346(6287):818–822. doi: 10.1038/346818a0. [DOI] [PubMed] [Google Scholar]
  • 46.Amini R., Zhang Z., Li J., Gu J., Brennan J., Li Y. Aptamers for sars-cov-2: isolation, characterization, and diagnostic and therapeutic developments. Anal Sens. 2022 doi: 10.1002/anse.202200012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Kacherovsky N., Yang L.F., Dang H.V., Cheng E.L., Cardle I.I., Walls A.C., et al. Discovery and characterization of spike n-terminal domain-binding aptamers for rapid sars-cov-2 detection. Angew Chem Int Ed Engl. 2021;60(39):21211–21215. doi: 10.1002/anie.202107730. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Huang L., Tian S., Zhao W., Liu K., Ma X., Guo J. Aptamer-based lateral flow assay on-site biosensors. Biosens Bioelectron. 2021;186:113279. doi: 10.1016/j.bios.2021.113279. [DOI] [PubMed] [Google Scholar]
  • 49.Binzel D.W., Li X., Burns N., Khan E., Lee W.J., Chen L.C., et al. Thermostability, tunability, and tenacity of rna as rubbery anionic polymeric materials in nanotechnology and nanomedicine-specific cancer targeting with undetectable toxicity. Chem Rev. 2021;121(13):7398–7467. doi: 10.1021/acs.chemrev.1c00009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Ghimire C., Wang H., Li H., Vieweger M., Xu C., Guo P. RNA nanoparticles as rubber for compelling vessel extravasation to enhance tumor targeting and for fast renal excretion to reduce toxicity. ACS Nano. 2020;14(10):13180–13191. doi: 10.1021/acsnano.0c04863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Li X., Bhullar A.S., Binzel D.W., Guo P. The dynamic, motile and deformative properties of rna nanoparticles facilitate the third milestone of drug development. Adv Drug Deliv Rev. 2022;186:114316. doi: 10.1016/j.addr.2022.114316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Nicol T., Lefeuvre C., Serri O., Pivert A., Joubaud F., Dubee V., et al. Assessment of sars-cov-2 serological tests for the diagnosis of covid-19 through the evaluation of three immunoassays: two automated immunoassays (euroimmun and abbott) and one rapid lateral flow immunoassay (ng biotech) J Clin Virol. 2020;129:104511. doi: 10.1016/j.jcv.2020.104511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Wu J.L., Tseng W.P., Lin C.H., Lee T.F., Chung M.Y., Huang C.H., et al. Four point-of-care lateral flow immunoassays for diagnosis of covid-19 and for assessing dynamics of antibody responses to sars-cov-2. J Infect. 2020;81(3):435–442. doi: 10.1016/j.jinf.2020.06.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Zhu X., Wang X., Han L., Chen T., Wang L., Li H., et al. Multiplex reverse transcription loop-mediated isothermal amplification combined with nanoparticle-based lateral flow biosensor for the diagnosis of covid-19. Biosens Bioelectron. 2020;166:112437. doi: 10.1016/j.bios.2020.112437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Daoud Z., McLeod J., Stockman D.L. Higher sensitivity provided by the combination of two lateral flow immunoassay tests for the detection of covid-19 immunoglobulins. Front Cell Infect Microbiol. 2020;10:479. doi: 10.3389/fcimb.2020.00479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Flower B., Brown J.C., Simmons B., Moshe M., Frise R., Penn R., et al. Clinical and laboratory evaluation of sars-cov-2 lateral flow assays for use in a national covid-19 seroprevalence survey. Thorax. 2020;75(12):1082–1088. doi: 10.1136/thoraxjnl-2020-215732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Chen S.Y., Lee Y.L., Lin Y.C., Lee N.Y., Liao C.H., Hung Y.P., et al. Multicenter evaluation of two chemiluminescence and three lateral flow immunoassays for the diagnosis of covid-19 and assessment of antibody dynamic responses to sars-cov-2 in taiwan. Emerg Microbes Infect. 2020;9(1):2157–2168. doi: 10.1080/22221751.2020.1825016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Tong H., Cao C., You M., Han S., Liu Z., Xiao Y. Artificial intelligence-assisted colorimetric lateral flow immunoassay for sensitive and quantitative detection of covid-19 neutralizing antibody. Biosens Bioelectron. 2022;213:114449. doi: 10.1016/j.bios.2022.114449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Alhabbab R.Y., Alfaleh M.A., Alsulaiman R.M., Alamri S.S., Eyouni M.S., El Assouli M.Z., et al. Amplifying lateral flow assay signals for rapid detection of covid-19 specific antibodies. Glob Chall. 2022;6(7):2200008. doi: 10.1002/gch2.202200008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Yi Z., de Dieu Habimana J., Mukama O., Li Z., Odiwuor N., Jing H., et al. Rational programming of cas12a for early-stage detection of covid-19 by lateral flow assay and portable real-time fluorescence readout facilities. Biosensors (Basel) 2021;12(1) doi: 10.3390/bios12010011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Shelite T.R., Uscanga-Palomeque A.C., Castellanos-Gonzalez A., Melby P.C., Travi B.L. Isothermal recombinase polymerase amplification-lateral flow detection of sars-cov-2, the etiological agent of covid-19. J Virol Methods. 2021;296:114227. doi: 10.1016/j.jviromet.2021.114227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Alrashoudi A.A., Albalawi H.I., Aldoukhi A.H., Moretti M., Bilalis P., Abedalthagafi M., et al. Fabrication of a lateral flow assay for rapid in-field detection of covid-19 antibodies using additive manufacturing printing technologies. Int J Bioprint. 2021;7(4):399. doi: 10.18063/ijb.v7i4.399. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Nanomedicine are provided here courtesy of Elsevier

RESOURCES