Skip to main content
PLOS Neglected Tropical Diseases logoLink to PLOS Neglected Tropical Diseases
. 2022 Jul 15;16(7):e0010249. doi: 10.1371/journal.pntd.0010249

Protein undernutrition reduces the efficacy of praziquantel in a murine model of Schistosoma mansoni infection

Joseph Bertin Kadji Fassi 1,2, Hermine Boukeng Jatsa 1,2,*, Ulrich Membe Femoe 1,2,3, Valentin Greigert 3, Julie Brunet 3, Catherine Cannet 4, Christian Mérimé Kenfack 1,2, Nestor Gipwe Feussom 1,2, Emilienne Tienga Nkondo 1,2, Ahmed Abou-Bacar 3, Alexander Wilhelm Pfaff 3, René Kamgang 1, Pierre Kamtchouing 1, Louis-Albert Tchuem Tchuenté 2,5
Editor: Edward Mitre6
PMCID: PMC9328564  PMID: 35839247

Abstract

Background

Undernutrition and schistosomiasis are public health problems and often occur in low and middle-income countries. Protein undernutrition can alter the host-parasite environment system and aggravate the course of schistosomiasis. This study aimed to assess the impact of a low-protein diet on the efficacy of praziquantel.

Methodology/Principal findings

Thirty-day-old mice were fed with a low-protein diet, and 40 days later, they were individually infected with fifty Schistosoma mansoni cercariae. A 28-day-treatment with praziquantel at 100 mg/kg for five consecutive days followed by distilled water begins on the 36th day post-infection. Mice were sacrificed on the 64th day post-infection. We determined the parasitological burden, liver and intestine histomorphometry, liver injury, and immunomodulation parameters. Praziquantel treatment of infected mice fed with a standard diet (IN-PZQ) resulted in a significant reduction of worm and egg burdens and a normalization of iron and calcium levels. The therapy also improved schistosomiasis-induced hepatopathy and oxidative stress. The anti-inflammatory and immunomodulatory activities of praziquantel were also significant in these mice. When infected mice receiving the low-protein diet were treated with praziquantel (ILP-PZQ), the body weight loss and hepatomegaly were not alleviated, and the worm and liver egg burdens were significantly higher than those of IN-PZQ mice (P < 0.001). The treatment did not reduce the increased activities of ALT and γ-GGT, the high malondialdehyde concentration, and the liver granuloma volume. The iron and calcium levels were not ameliorated and differed from those of IN-PZQ mice (P < 0.001 and P < 0.05). Moreover, in these mice, praziquantel treatment did not reverse the high level of IL-5 and the low mRNA expression of CCL3/MIP-1α and CXCL-10/IP-10 induced by S. mansoni infection.

Conclusion/Significance

These results demonstrated that a low-protein diet reduced the schistosomicidal, antioxidant, anti-inflammatory, and immunomodulatory activities of praziquantel.

Author summary

Almost 90% of people requiring schistosomiasis preventive chemotherapy in 2018 lived in sub-Saharan Africa. Besides, 205.3 million children under five years suffer and die of undernutrition in low- and middle-income countries. The physiopathology of schistosomiasis mansoni involves liver damage, oxidative stress, and perturbation of the immune response. These disturbances are intensified by undernutrition. Praziquantel is used to treat schistosomiasis, but its efficacy on the comorbidity of S. mansoni infection and undernutrition has not been investigated. We conducted this study to assess the effectiveness of praziquantel on S. mansoni infection in mice fed with a low-protein diet. We recorded growth retardation, hepatomegaly, and high worm and egg burdens in mice fed with a low-protein diet and treated with PZQ. Moreover, the treatment did not reverse the liver function injury, oxidative stress, high iron level, and low calcium level. The proinflammatory cytokine IL-5 was still high, and the gene expression of some macrophage-associated chemokines was reduced. Therefore, this study demonstrated that in a murine model of a low-protein diet, the efficacy of praziquantel on S. mansoni infection was reduced. It also underlines the importance of targeting protein deficiency and malnutrition in populations living in schistosomiasis endemic areas for efficient disease control.

Introduction

Undernutrition and schistosomiasis are public health problems and often share the same geographical areas. Approximately 700 million persons, primarily children, are at risk of schistosomiasis in 78 endemic countries. It is estimated that more than 229 million people worldwide, with almost 90% of them living in sub-Saharan Africa, required preventive chemotherapy in 2018. [1]. Estimates by the World Health Organization show that 462 million adults are underweight, 205.3 million children under five years suffer from undernutrition, and about 45% of deaths are linked to undernutrition and mainly occur in low- and middle-income countries [2]. Schistosoma mansoni infection induces liver damage through the granulomatous inflammatory formation around eggs trapped in the sinusoidal periportal spaces and the generation of reactive oxygen species (ROS) [35]. Undernourished people are generally more susceptible to infections and increased morbidity and mortality [610]. Protein malnutrition induces structural changes in the lymphoid organs and impairs the innate and adaptative immune response. It is thus recognized as the cause of frequent immunodeficiency [1115].

The relationship between protein malnutrition of the host and S. mansoni infection is a very complex mechanism, not entirely determined since each can increase the other. Protein malnutrition is a factor that can alter the host-parasite environment system, aggravating the course of schistosomiasis by breaking the equilibrium in the relationship among the components of this system [1620]. Clinical and experimental studies have demonstrated the interference of malnutrition in the outcome of schistosomiasis or vice versa. Assis et al. [17,21] showed that S. mansoni infection negatively impacts schoolchildren’s growth at low or moderate levels. The association between inadequate dietary intake and heavy S. mansoni infection increased the risk of stunting children. Other authors indicated that the association between undernutrition and S. mansoni infection leads to growth retardation, intensifies liver injuries, and decreases the humoral immune response in mice [19,22,23]. Moreover, feeding mice dams with a restricted-protein diet lead firstly to neonatal malnutrition of offspring during lactation and secondly to an increased egg output and liver damage in S. mansoni-infected pups [20]. More specifically, morphometric studies revealed that undernutrition of the host impairs the somatic development, the reproductive system, and the tegumental structure of male adult S. mansoni worms recovered from undernourished infected mice [18]. In clinical studies, praziquantel treatment improved the anthropometric indexes, nutritional status, and haemoglobin level of S. mansoni or S. japonicum-infected children and adolescents [17,24]. However, the literature lacks data on the effect of praziquantel on the comorbidity of S. mansoni infection and undernutrition. This study aimed to assess the efficacy of praziquantel on S. mansoni infection in mice fed with a low-protein diet.

Materials and methods

Ethics statement

All procedures in this study followed the principles of laboratory animal use and care of the “European Community” guidelines (EEC Directive 2010/63/EEC) and were approved by the “Animal Ethical Committee” of the Laboratory of Animal Physiology of the Faculty of Sciences, University of Yaoundé I–Cameroon.

Animals

Animals used for this study were bred in the “Centre for Schistosomiasis and parasitology” of Yaoundé, Cameroon. Thirty-day-old BALB/c mice were separated from their mother and weighed. They were housed in polypropylene cages with free access to food and water and maintained under natural 12 h light/ 12 h dark cycles at temperatures between 22 and 25°C. S. mansoni intermediate host Biomphalaria pfeifferi snails were collected from the river “Afeme” (Yaoundé, Cameroon) and maintained in the laboratory under standardized conditions.

Experimental protocol

We separated 30 days-old mice into two pools during this study and fed them two different diets: a standard diet and a low-protein diet. The bromatological characteristics of these diets are shown in Table 1.

Table 1. Bromatological characteristics of the diets used for mice feeding.

Nutrient content Standard diet Low-protein diet
Protein (%) 22.05 14.60
Fat (%) 3.08 3.52
Crude fiber (%) 7.08 7.17
Calcium (%) 2.00 1.46
Phosphorus (%) 1.43 1.17
Sodium (%) 0.37 0.30
Lysine (%) 1.42 0.77
Methionine (%) 0.50 0.32
Metabolizable energy (kcal) 2292.78 2333.94

We induced protein malnutrition in 30 days-old mice by feeding them a low-protein diet to mimic the usual diet of people with low-income revenue in endemic areas of schistosomiasis [2527].

After forty days of feeding, we divided mice into six different groups, as mentioned in Table 2. Mice belonging to the infection groups were individually infected with 50 S. mansoni cercariae by the tail and legs immersion technique [28] and then left for 35 days for schistosome maturation and mating.

Table 2. Experimental design.

Type of diet Mice Groups Status of infection Treatment Number of mice
Standard diet HN Not infected Distilled water 6
IN S. mansoni-infected Distilled water 9
IN-PZQ S. mansoni-infected PZQ 9
Low-protein diet HLP Not infected Distilled water 6
ILP S. mansoni-infected Distilled water 9
ILP-PZQ S. mansoni-infected PZQ 9

HN: healthy mice receiving a standard diet; IN: infected-untreated mice receiving a standard diet; IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; HLP: healthy mice receiving a low-protein diet; ILP: infected-untreated mice receiving a low-protein diet; ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel

Treatment started at day 36 post-infection, and PZQ was administered per os at the dose of 100 mg/kg for five consecutive days, followed by a daily administration of 10 mL/kg of distilled water. Praziquantel tablets (Merck KGaA, Darmstadt, Germany) were ground into powder and dissolved in distilled water. The duration of the treatment was 28 days, and mice were sacrificed by cervical dislocation at day 64 post-infection [29,30].

Measurement of the body and organ weights

Each mouse was weighed once a week during the experiment to assess the body weight variation from the day of S. mansoni infestation until the end of praziquantel treatment.

We determined the Lee index to appreciate the growth of animals based on their nutritional status. We measured the body lengths (nose-anal) the day before the sacrifice (day 63 post-infection) for all groups and calculated the Lee index using the following formula:

Lee index = cube root of body weight (g) / nose-to-anus length (cm) [31]

After mice sacrifice, their liver, spleen, and intestine were removed and weighed individually. The relative weight (g of organ/100 g of body weight) or the organ weight index was then calculated.

Determination of worm and egg burdens

On the 64th day post-infection, we recovered adult S. mansoni worms from the porto-mesenteric system of the liver by perfusion and counted them under a stereo-microscope [32]. The percentage of reduction of worm burden was calculated as follows:

P=[(CV)/C]x100

Where P = percentage of reduction; C = mean number of worms recovered from S. mansoni-infected and untreated mice; V = mean number of worms recovered from S. mansoni-infected and treated mice;

S. mansoni ova were counted in the feces the day before the sacrifice (63rd day post-infection). Feces were individually collected from each infected mouse, weighed, and homogenized in 10% buffered formaldehyde. Two aliquots of 100 μL each were counted on a light microscope to determine the number of eggs. After sacrifice, the mice’s liver and intestine were removed, rinsed with PBS, weighed, and digested separately in 4% KOH solution at 37°C for 6h. Tissue suspensions were centrifuged at 1500 rpm for 5 min, and the supernatant was removed [33]. Using a light microscope, the number of eggs was determined in two aliquots of 100 μL each using a light microscope. Results were expressed as the mean number of eggs per gram of feces or tissue for the liver and intestine.

Evaluation of biochemical biomarkers of the liver function

We collected blood from the retro-orbital venous plexus in EDTA and dry tubes. We used blood collected in EDTA tubes for hematology analysis using an automated hemacytometer (Sysmex XN-1000).

Blood collected in dry tubes was centrifuged at 3500 rpm for 15 min, and the serum obtained was stored at -70°C for biochemical analysis. Therefore, we determined the total protein level using the Biuret method [34] and the albumin level using the BIOLABO kit according to the method described by Doumas et al. [35]. In addition, we measured the activity of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) according to the Reitman and Frankel method by using Bioclin kits [36]. Furthermore, we estimated the activities of alkaline phosphatase (ALP) and Gamma-glutamyltransferase (GGT) as described by Burtis et al. [37] and Szasz et al. [38], respectively. We also determined the total bilirubin, glucose, iron, calcium, total cholesterol, and triglycerides according to the protocol described in the BIOLABO kits by Burtis et al. [37]. In addition, the protocol to assay HDL cholesterol was described by Badimon et al. [39]. As a result, LDL cholesterol level was calculated as follows:

[LDL cholesterol] = [total cholesterol]–[HDL cholesterol]–([triglycerides] / 5)

Evaluation of oxidative stress biomarkers in the liver

After mice sacrifice, we homogenized 0.4g of the liver in 2 mL of a 50 mM Tris-HCL buffer, pH 7.4, with a mortar on ice. The homogenate (20% w/v) was centrifuged at 3000 rpm for 25min at 4°C. The supernatant was collected and stored at -70°C until assayed. We then evaluated lipid peroxidation by measuring malondialdehyde (MDA) as described by Wilbur et al. [40]. Furthermore, we measured catalase and superoxide dismutase activities following the protocol described by Sinha [41] and Misra et Fridovish [42]. In addition, we determined reduced glutathione (GSH) and nitrite concentrations using Ellman’s reagent [43] and the protocol described by Hibbs et al. [44], respectively.

Determination of the serum levels of cytokines

We measured cytokine levels in serum samples using the mouse ProtocartaPlex 10-plex immunoassay kit (Thermofisher Scientific, Vienna, Austria), following the manufacturer’s recommendations. Data were acquired on the Luminex XMAP technology (Merck Millipore, Darmstadt, Germany) using the Luminex XPONENT software solutions. The concentration (pg/mL) of each cytokine was determined by interpolating the median fluorescent intensity (MFI) of a dilution standard curve over seven dilution points supplied with the kit and calculated by the ProtocartaPlex Analyst 1.0 software (eBioscience, Thermo Fisher Scientific, USA). The immune mediators were classified into four categories: T helper-1 cytokines (IL-2, IFN-γ, and TNF-α), T helper-2 cytokines (IL-4, IL-5, and IL-13), T helper-17 cytokine (IL-17A), and regulatory cytokines (TGF-β1 and IL-10).

Real-time quantitative polymerase chain reaction analysis (RT-qPCR)

We extracted total RNA from 10 mg of liver tissue using a NucleoZOL reagent (Macherey-Nagel GmbH & Co. KG, Germany). First, we determined RNA concentration using a NanoDrop 2000c spectrophotometer (Thermo Scientific, USA), and each RNA sample was reversely transcribed into cDNA (cDNA Synthesis kit, Quanta Biosciences, Inc, USA). Next, we mixed the obtained cDNA with the Universal Supermix kit (Bio-Rad, USA). After that, we amplified it using CFX Real-Time System (Bio-Rad, USA), with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a reference gene. Finally, we calculated the expression of each cDNA using a standard curve and expressed the relative expression of mRNA in each sample as a GAPDH ratio. Primers used for RT-qPCR were purchased from Eurofins Genomics (Nantes, France) and are shown in Table 3.

Table 3. Mice primers used for RT-qPCR.

mRNA Forward Primer (5’ 3’) → Reverse primer (5’ 3’) → Amplicon size
GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA 123
CCL2/MCP-1 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGT 121
CXCL-10/IP10 CCAAGTGCTGCCGTCATTTTC TCCCTATGGCCCTCATTCTCA 133
CCL3/MIP-1α TTCTCTGTACCATGACACTCTGC CGTGGAATCTTCCGGCTGTAG 100
IFN-γ ACAGCAAGGCGAAAAAGGATG TGGTGGACCACTCGGATGA 106
IL-10 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG 105
IL-13 CCTGGCTCTTGCTTGCCTT GGTCTTGTGTGATGTTGCTCA 116
FGF1 CCCTGACCGAGAGGTTCAAC GTCCCTTGTCCCATCCACG 122
TGF-β1 CTCCCGTGGCTTCTAGTGC GCCTTAGTTTGGACAGGATCTG 133
FoxP3 CCCATCCCCAGGAGTCTTG ACCATGACTAGGGGCACTGTA 183

Morphological and morphometry studies of liver and intestine

After perfusion of mice for worm recovery, the liver and intestine were removed, rinsed with PBS, weighed, and divided into portions. Next, we fixed pieces of the liver (left, square, and caudate lobes) and the intestine (ileum) in 10% formaldehyde prepared in PBS. After trimming and dehydration in ethanol baths, we embedded tissues in paraffin and 5 μm thick sections cut using a microtome. A set of these sections was stained with hematoxylin-eosin (HE) to evaluate the granulomatous inflammatory response. Another set was stained with picrosirius-red (PS) to evaluate fibrosis through collagen deposition in the liver or the intestine. Images were acquired at x10 and x20 using CMOS Digital Camera (IDS, Germany) connected to an optical microscope (Axiophot, Germany) and analyzed by PathScan Touch software (Excilone, France).

We carried out a morphometry analysis of liver and intestine sections stained with HE. We analyzed images captured with a digital camera AmScope MD 500 (AmScope, USA) connected to an optical microscope with ImageJ 1.32 software (NIH, USA). The following parameters were evaluated: the number of liver and intestine granulomas and the volume of the liver granuloma. In addition, we estimated the number of granulomas per microscopic field and calculated the volume of each granuloma using the formula of the sphere volume (4/3πR3) [30,45].

Statistical analysis

Data are expressed as means ± SEM. Data were analyzed using GraphPad Prism version 8.01 for Windows by one-way analysis of variance (ANOVA), and differences between groups were assessed using Tukey’s multiple comparison post-test. Differences were considered significant at P < 0.05.

Results

Praziquantel treatment does not improve the body weight and the liver and intestine weight indexes of Schistosoma mansoni-infected mice receiving a low-protein diet

As shown in Fig 1, healthy mice receiving either a standard diet or a low-protein diet gained weight during the experimentation. On the contrary, infected mice (IN and ILP groups) significantly lost weight compared to their respective healthy controls HN and HLP (P < 0.001) from the tenth week of experimentation (4 weeks p.i) to the end (10 weeks p.i). Oral administration of praziquantel to infected mice receiving the standard diet induced a normalization of body weight as the body weight variation increased in the IN-PZQ group compared to IN group (P < 0.01). On the contrary, the body weight of infected mice receiving the low-protein diet and treated with PZQ (ILP-PZQ group) was not improved after the treatment. The body weight variation of mice belonging to the ILP-PZQ group wasn’t statistically different from that of the ILP group at the end of the experimentation. The Lee index, an indicator of the nutritional status, did not vary after S. mansoni infection or after PZQ treatment of mice receiving the standard diet. However, this index was reduced in S. mansoni infected mice fed with a low-protein diet than in controls (P < 0.05). PZQ treatment did not significantly improve the body weight reduction in mice fed a low-protein diet.

Fig 1. Effects of praziquantel treatment on the body weight variation of Schistosoma mansoni-infected mice receiving a low-protein diet.

Fig 1

Data are expressed as mean ± SEM (n = 4–8). Group HN: healthy mice receiving a standard diet; group IN: infected-untreated mice receiving a standard diet; group IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; group HLP: healthy mice receiving a low-protein diet; group ILP: infected-untreated mice receiving a low-protein diet; group ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel. ANOVA followed by Turkey’s multiple comparison test. αP < 0.05; ααP < 0.01; αααP < 0.001: values are significantly different from healthy mice receiving a standard diet (group HN). *P < 0.05; ***P < 0.001: values are significantly different from the infected-untreated mice receiving a standard diet (group IN). λP < 0.05; λλP < 0.01; λλλP < 0.001: values are significantly different from healthy mice receiving a low-protein diet (group HLP).

S. mansoni infection significantly increased mice’s liver, spleen, and intestine weights receiving either the standard diet (IN) or the low-protein diet (ILP). However, the IN mice were more affected by the infection than the ILP mice, as denoted by the significant difference in hepatosplenomegaly (P < 0.001) and intestine enlargement (P < 0.01) between the two groups. Oral administration of PZQ to normally nourished and infected mice (IN-PZQ group) resulted in a significant reduction (P < 0.001) of the liver (32.83%), spleen (60.64%), and intestine (32.07%) weights as compared to those of infected-untreated mice. PZQ treatment then reestablished the liver, intestine and spleen weights of IN-PZQ mice as they were close to the normal range of HN naïve mice. On the contrary, PZQ treatment of infected mice receiving the low-protein diet (ILP-PZQ) did not significantly reduce the liver and intestine weight indexes that are still similar to those of ILP mice. Only the spleen weight of ILP-PZQ mice significantly decreased by 43.01% as compared to their healthy controls (P < 0.01) (Fig 2). Then, PZQ treatment did not improve hepatomegaly and intestine enlargement induced by the infection in mice receiving the low-protein diet.

Fig 2. Effects of praziquantel treatment on the organs weight indexes of Schistosoma mansoni-infected mice receiving a low-protein diet.

Fig 2

Data are expressed as mean ± SEM (n = 4–8). Group HN: healthy mice receiving a standard diet; group IN: infected-untreated mice receiving a standard diet; group IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; group HLP: healthy mice receiving a low-protein diet; group ILP: infected-untreated mice receiving a low-protein diet; group ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel. ANOVA followed by Turkey’s multiple comparison test. αP < 0.05; αααP < 0.001: values are significantly different from the healthy normal nourished animals (group HN). **P < 0.01 ***P < 0.001: values are significantly different from the infected-untreated mice receiving a standard diet (group IN). λP < 0.05; values are significantly different from healthy mice receiving a low-protein diet (group HLP). βββP < 0.001: values are significantly different from infected-untreated mice receiving a low-protein diet (group ILP). The number on top of each bar graph represents the percentage of variation.

Praziquantel treatment is less efficacious in reducing the worm and liver egg burdens of Schistosoma mansoni-infected mice receiving the low-protein diet

The worm and egg burdens of mice subjected to different treatments are depicted in Fig 3. After S. mansoni infection, worm recovery was 47.50% for the infected-untreated mice receiving the standard diet and 45.42% for the infected-untreated mice receiving the low-protein diet. The treatment of infected mice receiving the standard diet with PZQ significantly reduced worm count by 78.95% (P < 0.001). In contrast, we recorded an insignificant decrease of 19.88% of worm count in the group of infected mice receiving the low-protein diet and treated with PZQ compared to their respective infected-untreated mice. PZQ treatment was ineffective in the worm burden reduction of infected mice fed the low-protein diet.

Fig 3. Effects of praziquantel treatment on the worm and egg burdens of Schistosoma mansoni-infected mice receiving a low-protein diet.

Fig 3

Data are expressed as mean ±SEM (n = 4–9). Group HN: healthy mice receiving a standard diet; group IN: infected-untreated mice receiving a standard diet; group IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; group HLP: healthy mice receiving a low-protein diet; group ILP: infected-untreated mice receiving a low-protein diet; group ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel. ANOVA followed by Turkey multiple comparison test. ***P < 0.001: values are significantly different from the infected-untreated mice receiving a standard diet (group IN). βP < 0.05; βββP < 0.001: values are significantly different from infected-untreated mice receiving a low-protein diet (group ILP). θθθP < 0.001: values significantly different from infected mice receiving a standard diet and treated with praziquantel at 100 mg/kg for 5 consecutive days (group IN-PZQ). The number on top of each bar graph represents the percentage of variation.

In comparison to their respective control groups, egg burdens in the feces, the liver and the intestine were significantly reduced in either IN-PZQ mice or ILP-PZQ mice. However, the reduction of the liver egg count was more critical in infected mice receiving the standard diet (97.02%) than in the ones receiving the low-protein diet (42.50%) (P < 0.001).

Praziquantel treatment failed to alleviate transaminases and gamma-glutamyl transferase activities of Schistosoma mansoni-infected mice receiving the low-protein diet

Administration of a low-protein diet to healthy mice (HLP) induced a significant reduction of aspartate aminotransferase (AST) activity by 47.71% as compared to healthy mice receiving a standard diet (HN). S. mansoni infection induced a significant increase in aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP) and γ-glutamyl transferase (GGT) activities, and total bilirubin concentration in mice receiving a standard diet (IN) or a low-protein diet (ILP). Oral administration of praziquantel to infected mice receiving a standard diet resulted in a significant reduction of ALT (12.53%), ALP (42.11%), and GGT (55.19%) activities, as well as total bilirubin concentration (46.12%) as compared to those of their untreated controls. In infected mice receiving the low-protein diet and treated with praziquantel (ILP-PZQ), only ALP activity and total bilirubin level were reduced by 37.48% and 40.14%, respectively, when compared to those of the untreated controls. Activities of AST, ALT and GGT remained higher than those of ILP controls mice, and the differences were statistically significant for AST (P < 0.05) and GGT activities (P < 0.001) (Fig 4). PZQ treatment reduced ALP activity and total bilirubin concentration and failed to improve AST, ALT, and GGT in S. mansoni-infected mice receiving the low-protein diet.

Fig 4. Effects of praziquantel treatment on the liver function biomarkers of Schistosoma mansoni-infected mice receiving a low-protein diet.

Fig 4

Data are expressed as mean ±SEM (n = 4–8). AST: aspartate aminotransferase; ALAT: alanine aminotransferase; ALP: alkaline phosphatase; GGT: gamma-glutamyl transferase; BIL: total bilirubin. Group HN: healthy mice receiving a standard diet; group IN: infected-untreated mice receiving a standard diet; group IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; group HLP: healthy mice receiving a low-protein diet; group ILP: infected-untreated mice receiving a low-protein diet; group ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel. ANOVA followed by Turkey multiple comparison test. αP < 0.05; ααP < 0.01; αααP < 0.001: values are significantly different from healthy mice receiving a standard diet (group HN). ***P < 0.001: values are significantly different from infected-untreated mice receiving a standard diet (group IN). λλλP < 0.001: values are significantly different from healthy mice receiving a low-protein diet (group HLP). βββP < 0.001: values are significantly different from infected-untreated mice receiving a low-protein diet (group ILP).

Praziquantel treatment does not enhance the biomarkers of the general metabolism of Schistosoma mansoni-infected mice receiving the low-protein diet

As shown in Fig 5, the low-protein diet significantly decreased the total proteins, albumin, glucose, and calcium concentrations in HLP mice compared to HN mice. When infected, mice submitted to the standard or the low-protein diet (IN or ILP group) showed significant decreases in total proteins, albumin, glucose, and calcium levels and a significant increase in iron concentration compared to their respective controls (HN and HLP groups). Administration of PZQ to S. mansoni-infected mice receiving the standard diet did not reestablish the expected concentration of proteins, albumin, and glucose. Still, it significantly restored the iron and calcium concentrations (P < 0.001). Compared to ILP mice, we recorded significant increases of total proteins level by 35.54% and glucose concentration by 52.94% in ILP-PZQ mice. However, these increases were not enough to get these concentrations close to normal ones since the total proteins, albumin, and glucose levels were still significantly lower in ILP-PZQ mice than in HN mice (P < 0.05 and P < 0.001). Albumin, iron and calcium concentrations of ILP-PZQ mice did not improve after PZQ treatment. The iron level of ILP-PZQ mice significantly remained higher than that of IN-PZQ mice (P < 0.001). At the same time, their calcium concentration was low compared to that of the IN-PZQ mice (P < 0.05). PZQ treatment ameliorated total proteins and glucose levels in infected mice receiving the low-protein diet but failed to normalize them compared to healthy mice receiving the standard diet. Moreover, PZQ treatment did not improve albumin, iron and calcium levels in these mice.

Fig 5. Effects of praziquantel treatment on some biomarkers of the general metabolism in Schistosoma mansoni-infected mice receiving a low-protein diet.

Fig 5

Data are expressed as mean ±SEM (n = 4–8). Group HN: healthy mice receiving a standard diet; group IN: infected-untreated mice receiving a standard diet; group IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; group HLP: healthy mice receiving a low-protein diet; group ILP: infected-untreated mice receiving a low-protein diet; group ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel. ANOVA followed by Turkey multiple comparison test. αP < 0.05; ααP < 0.01; αααP < 0.001: values are significantly different from healthy mice receiving a standard diet (group HN). ***P < 0.001: values are significantly different from infected-untreated mice receiving a standard diet (group IN). λP < 0.05; λλP < 0.01 values are significantly different from healthy mice receiving a low-protein diet (group HLP). βP < 0.05 ββP < 0.01: values are significantly different from infected-untreated mice receiving a low-protein diet (group ILP). θP < 0.05; θθθP < 0.001: values significantly different from infected mice receiving a standard diet and treated with praziquantel at the dose of 100 mg/kg for 5 consecutive days (group IN-PZQ).

PZQ treatment restores the biomarkers levels of lipid metabolism of Schistosoma mansoni-infected mice receiving the low-protein diet

Compared to HN mice, administration of a low-protein diet to mice (HLP) induced a significant decrease in serum HDL cholesterol level by 18.24% and triglycerides by 28.74%. S. mansoni-infected mice receiving the standard or the low-protein diet showed a significantly lower concentration of total cholesterol, LDL cholesterol, and triglycerides than their uninfected controls. When treating mice with PZQ, total cholesterol, LDL cholesterol, and triglycerides concentrations were significantly improved by 14.53%, 50.35%, and 38.79%, respectively, for the IN-PZQ group and by 24.64%, 59.16%, and 42.53% for the ILP-PZQ group. In addition, a significant increase in HDL cholesterol (P < 0.01) was noted in ILP-PZQ mice as compared to ILP ones (Fig 6). PZQ treatment improved total cholesterol, LDL cholesterol and triglycerides in S. mansoni-infected mice receiving the standard or the low-protein diet.

Fig 6. Effects of praziquantel treatment on the lipid profile of Schistosoma mansoni-infected mice receiving a low-protein diet.

Fig 6

Data are expressed as mean ±SEM (n = 4–8). Group HN: healthy mice receiving a standard diet; group IN: infected-untreated mice receiving a standard diet; group IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; group HLP: healthy mice receiving a low-protein diet; group ILP: infected-untreated mice receiving a low-protein diet; group ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel. ANOVA followed by Turkey multiple comparison test. αP < 0.05; ααP < 0.01; αααP < 0.001: values are significantly different from healthy mice receiving a standard diet (group HN). *P < 0.05; **P < 0.01; ***P < 0.001: values are significantly different from infected-untreated mice receiving a standard diet (group IN). λP < 0.05; λλP < 0.01 λλλP < 0.001: values are significantly different from healthy mice receiving a low-protein diet (group HLP). ββP < 0.01; βββP < 0.001: values are significantly different from infected-untreated mice receiving a low-protein diet (group ILP).

Praziquantel treatment does not restore the concentration of red blood cells of Schistosoma mansoni-infected mice receiving a low-protein diet

Administration of a low-protein diet to healthy mice (HLP) resulted in a significant reduction of 45.29% of the red blood cell count (P < 0.001) as compared to healthy mice receiving a standard diet (HN). S. mansoni infection significantly reduced the red blood cell count, hematocrit, and lymphocytes. At the same time, we recorded an increase in white blood cell count and eosinophil percentage in IN mice compared to HN mice. In infected-untreated mice receiving the low-protein diet (ILP), we noted a decrease in lymphocyte percentage (P < 0.001) but an increase of white blood cell counts (P < 0.001) as compared to healthy mice of the HLP group. Only one mouse expressed eosinophilia in this group. Treatment with praziquantel restored the hematocrit, the total leukocytes, lymphocytes, and eosinophils percentage in mice receiving the standard or the low-protein diet compared to their controls. The red blood cell concentration of all the infected mice receiving praziquantel remained significantly lower than that of IN mice (P < 0.01 for IN-PZQ and P < 0.001 for ILP-PZQ) (Table 4).

Table 4. Effects of praziquantel treatment on blood parameters in Schistosoma mansoni-infected mice receiving a low-protein diet.

Parameters HN IN IN-PZQ HLP ILP ILP-PZQ
Red blood cells (106/μL) 8.43 ± 0.56 3.92 ± 0.45 αα 5.54 ± 0.84αα 4.61 ± 1.21ααα 3.44 ± 0.27ααα 4.67 ± 0.20ααα
Hemoglobin (g/dL) 13.19 ± 0.33 11.50 ± 0.79 13.88 ± 0.71 12.66 ± 0.94 10.34 ± 0.58 12.86 ± 0.57
Hematocrit (%) 42.92 ± 2.39 33.90 ± 3.49α 48.46 ± 2.35** 42.36 ± 4.12 34.77 ± 3.27 42.20 ± 2.37
White blood cells (103/μL) 6.64 ± 0.86 9.95 ± 1.01α 5.74 ± 0.63** 4.15 ± 0.42 9.66 ± 0.78λ 4.24 ± 0.37β
Lymphocytes (%) 84.90 ± 0.88 42.48 ± 3.50ααα 80.60 ± 4.52** 65.18 ± 9.79 19.74 ± 2.00λλλ 66.07 ± 7.25ββ
Eosinophils (%) 0.10 ± 0.06 1.90 ± 0.30αα 0.05 ± 0.05**(1) 0.17 ± 0.17 (1) 0.05 ± 0.05 (1) 0.68 ± 0.45
Platelets (103/μL) 522.80 ± 78.35 224.20 ±16.77 309.00 ± 15.70 514.00 ± 87.46 158.40 ± 18.08 250.40 ± 32.15

Data are expressed as mean ±SEM (n = 4–8). MCH: mean corpuscular hemoglobin. Group HN: healthy mice receiving a standard diet; group IN: infected-untreated mice receiving a standard diet; group IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; group HLP: healthy mice receiving a low-protein diet; group ILP: infected-untreated mice receiving a low-protein diet; group ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel. ANOVA followed by Turkey multiple comparison test.

α P < 0.05

ααP < 0.01

αααP < 0.001: values are significantly different from healthy mice receiving a standard diet (group HN).

**P < 0.01: values are significantly different from infected-untreated mice receiving a standard diet (group IN).

λP < 0.05

λλλP < 0.001: values are significantly different from healthy mice receiving a low-protein diet (group HLP).

βP < 0.05

ββP < 0.01: values are significantly different from infected-untreated mice receiving a low-protein diet (group ILP).

Praziquantel treatment is less efficacious in normalizing malondialdehyde concentration of Schistosoma mansoni-infected mice receiving the low-protein diet

As shown in Fig 7, administration of a low-protein diet to mice (ILP group) did not significantly modify oxidative stress biomarkers compared to healthy mice receiving a standard diet (HN). In the IN and ILP groups of mice, malondialdehyde (MDA) concentration significantly increased. In contrast, superoxide dismutase (SOD) and catalase (CAT) activities and reduced glutathione (GSH) concentration significantly decreased as compared to their respective controls. The nitrites level decreased only in IN group compared to the HN group. Praziquantel treatment ameliorated the MDA concentration by reducing it by 64.73% in IN-PZQ as compared to IN (P < 0.001) and 25.72% in ILP-PZQ as compared to ILP (P < 0.05). Despite this significant reduction, the MDA concentration of ILP-PZQ mice was 69.56% higher than that of IN-PZQ mice (P < 0.05).

Fig 7. Effects of praziquantel treatment on the liver oxidative stress biomarkers of Schistosoma mansoni-infected mice receiving a low-protein diet.

Fig 7

Data are expressed as mean ±SEM (n = 4–8). Group HN: healthy mice receiving a standard diet; group IN: infected-untreated mice receiving a standard diet; group IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; group HLP: healthy mice receiving a low-protein diet; group ILP: infected-untreated mice receiving a low-protein diet; group ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel. ANOVA followed by Turkey multiple comparison test. αP < 0.05; ααP < 0.01; αααP < 0.001: values are significantly different from healthy mice receiving a standard diet (group HN). **P < 0.01; ***P < 0.001: values are significantly different from infected-untreated mice receiving a standard diet (group IN). λλλP < 0.001: values are significantly different from healthy mice received a low-protein diet (group HLP). βP < 0.05; βββP < 0.001: values are significantly different from infected-untreated mice receiving a low-protein diet (group ILP). θP < 0.05: values significantly different from infected mice receiving a standard diet and treated with praziquantel at the dose of 100 mg/kg for 5 consecutive days (group IN-PZQ).

In both standard and low-protein diet-feed infected mice, treatment with praziquantel restores the SOD and CAT activities. We recorded 49.35% and 63.96% increase of SOD activity and 33.29% and 57.22% increases of catalase activity in IN-PZQ and ILP-PZQ groups of mice, respectively, when compared to their infected-untreated controls groups. However, praziquantel treatment did not reverse the reduced concentration of GSH in IN-PZQ mice. On the contrary, GSH concentration significantly increased by 47.34% in ILP-PZQ mice compared to ILP mice (P < 0.001). Furthermore, PZQ treatment did not restore the nitrite levels, whatever the type of diet, and it was significantly low in ILP-PZQ mice compared to ILP mice (P < 0.05), as well as to IN-PZQ mice (P < 0.05). PZQ treatment improved the MDA concentration and SOD and CAT activities of IN-PZQ and ILP-PZQ mice but did not bring the MDA concentration of ILP-PZQ mice near the normal range.

PZQ treatment restores the cytokines Th1, Th2, Th17, and Treg levels, except IL-5, of Schistosoma mansoni-infected mice receiving the low-protein diet

Cytokines Th1, Th2, Th17, and Treg levels were measured in the sera of mice after praziquantel treatment and are illustrated in Fig 8. The diet did not influence the immune response since no variation in cytokine levels was recorded between healthy mice receiving the standard diet and healthy mice receiving the protein-deficient diet.

Fig 8. Effects of praziquantel treatment on cytokines production of Schistosoma mansoni-infected mice receiving a low-protein diet.

Fig 8

Data are expressed as mean ±SEM (n = 4–8). Group HN: healthy mice receiving a standard diet; group IN: infected-untreated mice receiving a standard diet; group IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; group HLP: healthy mice receiving a low-protein diet; group ILP: infected-untreated mice receiving a low-protein diet; group ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel. ANOVA followed by Turkey multiple comparison test. αP < 0.05; ααP < 0.01; αααP < 0.001: values are significantly different from healthy mice receiving a standard diet (group HN). *P < 0.05; **P < 0.01; ***P < 0.001: values are significantly different from infected-untreated mice receiving a standard diet (group IN). λP < 0.05; λλP < 0.01; λλλP < 0.001: values are significantly different from healthy mice received a low-protein diet (group HLP). βP < 0.05; ββP < 0.01; βββP < 0.001: values are significantly different from infected-untreated mice receiving a low-protein diet (group ILP). θP < 0.05: values significantly different from infected mice receiving a standard diet and treated with praziquantel at the dose of 100 mg/kg for 5 consecutive days (group IN-PZQ).

In S. mansoni-infected mice, serum levels of Th1 cytokines varied significantly. A 32.27% and 68.53% reduction for TNF-α and a 81.61% and 66.96% reduction for IFN-γ were recorded in IN and ILP mice, respectively, compared to their respective healthy controls. The TNF-α reduction was more critical in the ILP group than in IN group (P < 0.01). The level of IL-2 rose substantially higher in IN and ILP mice, 8.23-fold and 38.39-fold, respectively, compared to their healthy controls (Fig 8). Praziquantel treatment did not restore TNF-α and IFN-γ levels, whatever the type of the diet for mice. On the contrary, this treatment significantly reversed the increased IL-2 levels of infected mice, as we recorded a 47% and 89.57% reduction in mice of groups IN-PZQ and ILP-PZQ, respectively.

As denoted in Fig 8, IL-4 was poorly detected in the sera of healthy mice, and IL-13 was absent. Whatever the type of diet, serum concentrations of IL-4, IL-5, and IL-13 significantly increased after S. mansoni infection. Praziquantel treatment completely abrogated infection-induced IL-13 levels in both treatment groups (IN-PZQ and ILP-PZQ). When treated with praziquantel, infected mice receiving the standard diet showed an 81.31% reduction of IL-5 level (P < 0.01) compared to their infected-untreated controls. In contrast, treatment did not significantly affect infected mice receiving a low-protein diet. In addition, the praziquantel treatment did not significantly reduce the high IL-4 level of infected mice in the IN-PZQ and ILP-PZQ groups.

IL-17A and IL-10 were not detected in the sera of healthy mice receiving a standard or a low-protein diet. However, S. mansoni infected mice secreted significant levels of IL-17A and IL-10, particularly in infected mice receiving the standard diet. IL-17A and IL-10 were 75.40% and 69.95%, respectively, lower in the ILP group than in the IN group. The administration of praziquantel to infected mice significantly reduced IL-17A levels by 71.45% and 94.08% and IL-10 levels by 82.27% and 94.71% for IN-PZQ and ILP-PZQ groups, respectively, as compared to their infected untreated controls. The level of TGF-β1 was not modified by S. mansoni infection, whatever the type of diet administered to mice. However, it increased significantly after praziquantel treatment, to 1.81-fold and 3.05-fold in IN-PZQ and ILP-PZQ groups, respectively, compared to their healthy controls (Fig 8). PZQ treatment restores the cytokines Th1, Th2, Th17, and Treg levels of infected mice receiving the standard or the low-protein diet, except for the IL-5 level of infected mice receiving the low-protein diet.

Praziquantel treatment does not restore the CXCL-10/IP-10 and CCL3/MIP-1α gene expression of Schistosoma mansoni-infected mice receiving the low-protein diet

The diet did not induce any variation of the mRNA expression of cytokines and chemokines in healthy mice (HN), except for the gene expression of FGF-1 and CCL3, which are low in HLP mice. S. mansoni infection significantly decreased the mRNA expression of TGF-β1 by 81.71% and 79.68%, and FGF-1 by 79.25% and 64.45% in the standard diet feed (IN) and low-protein diet-feed mice (ILP), respectively, as compared to their healthy controls. We also recorded significant reductions of mRNA expression of chemokines CCL2/MCP-1, CCL3/MIP-1α, and CXCL-10/IP-10. In addition, we noted a decrease of IFN-γ mRNA expression and an increase of FoxP3 IL-10 and IL-13 mRNA expression in the liver of infected mice compared to healthy mice, although it was not statistically significant. Oral administration of praziquantel to infected mice completely reversed the diminished TGF-β1 gene expression. It was 3.70-fold and 2.85-fold higher in infected mice receiving the standard diet (IN-PZQ) or the low-protein diet (ILP-PZQ), respectively, than in their infected untreated controls. Praziquantel treatment did not restore the mRNA expression of FGF-1 and MCP-1 in infected mice, whatever their diet. Regarding the gene expression of chemokines, significant increases of the mRNA expression of CXCL-10/IP-10 and CCL3/MIP-1α were 40.59-fold and 5.96-fold, respectively, higher in IN-PZQ mice than those of IN mice. However, their levels did not change in infected mice fed with a low-protein diet and treated with praziquantel (ILP-PZQ) (Fig 9). Finally, PZQ treatment restored the gene expression of TGF-β1 but failed to do it for CXCL-10/IP-10 and CCL3/MIP-1α in infected mice fed with a low-protein diet.

Fig 9. Effects of praziquantel treatment on the mRNA expression of cytokines and chemokines of Schistosoma mansoni-infected mice receiving a low-protein diet.

Fig 9

Data are expressed as mean ±SEM (n = 4–8). Group HN: healthy mice receiving a standard diet; group IN: infected-untreated mice receiving a standard diet; group IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; group HLP: healthy mice receiving a low-protein diet; group ILP: infected-untreated mice receiving a low-protein diet; group ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel. ANOVA followed by Turkey multiple comparison test. αP < 0.05; ααP < 0.01; αααP < 0.001: values are significantly different from healthy mice receiving a standard diet (group HN). *P < 0.05; **P < 0.001: values are significantly different from infected-untreated mice receiving a standard diet (group IN). λλP < 0.01; λλλP < 0.001: values are significantly different from healthy mice received a low-protein diet (group HLP). βP < 0.05; values are significantly different from infected-untreated mice receiving a low-protein diet (group ILP). θθθP < 0.001: values significantly different from infected mice receiving a standard diet and treated with praziquantel at the dose of 100 mg/kg for 5 consecutive days (group IN-PZQ).

Praziquantel treatment does not reverse the liver and intestine histological injuries in Schistosoma mansoni-infected mice receiving a low-protein diet

The qualitative analysis of the liver and the intestine sections of HLP mice did not substantially differ from HN mice. Histological examination of hematoxylin-eosin (H&E) and picrosirius (PS) stained liver sections showed a typical portal triad and hepatic lobules with normal hepatocytes radiating from the central vein to the periphery of the lobule (Fig 10A, 10A’, 10D and 10D’). Intestine sections showed normal muscularis mucosa, lamina propria, and epithelial layer. The villous height or crypt depth was typical (Fig 11A, 11A’, 11D and 11D’).

Fig 10. Effects of praziquantel treatment on the liver histology of Schistosoma mansoni-infected mice receiving a low-protein diet.

Fig 10

A, B, C, D E, and F: Hematoxylin-eosin staining A’, B’, C’, D’, E’ and F’: Picrosirius staining. Group IN: infected-untreated mice receiving a standard diet; group IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; group ILP: infected-untreated mice receiving a low-protein diet; group ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel. IC: inflammatory cells, Gr: granuloma, O. S.m: egg of S. mansoni, CF: collagen fiber.

Fig 11. Effects of praziquantel treatment on the intestine histology of Schistosoma mansoni-infected mice receiving a low-protein diet.

Fig 11

A, B, C, D E, and F: Hematoxylin-eosin staining A’, B’, C’, D’, E’ and F’: Picrosirius staining Group IN: infected-untreated mice receiving a standard diet; group IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; group ILP: infected-untreated mice receiving a low-protein diet; group ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel. IC: inflammatory cells, Gr: granuloma, O. S.m: egg of S. mansoni, CF: collagen fiber.

The liver sections of S. mansoni-infected mice receiving the standard or the low-protein diet revealed a granulomatous inflammatory response around the parasite egg, with a considerable density of collagen fibers. Signs of reactional hepatitis in mice, represented by infiltration of mononuclear leukocytes mixed with polymorphonuclear eosinophils within the portal spaces and around the central vein, were observed (Fig 10B, 10B’, 10E and 10E’). The liver sections of mice treated with praziquantel (IN-PZQ and ILP-PZQ groups) showed a low density of granulomas with slight collagen deposition. The liver sections were nearly free of granulomas for some animals in both groups. However, some sinusoids were still dilated and infiltrated with lymphocytes (Fig 10C, 10C’, 10F and 10F’). These damages were primarily observed in infected mice receiving a low-protein diet and treated with praziquantel (ILP-PQZ).

Histopathological examination of the intestine sections of both IN and ILP mice revealed chronic inflammation and giant granulomas in the mucosa, the submucosa, and sometimes in the muscular layer. We also observed muscularis thickening, villous atrophy, crypt hyperplasia, and cell hypertrophy (Fig 11B, 11B’, 11E and 11E’). The intestine structure of IN-PZQ and ILP-PZQ mice) was ameliorated as granulomas were few and immature. In most cases, there was neither egg with concentric collagen fibers nor an accumulation of epithelioid cells and lymphocytes in the intestine sections. However, in the ILP-PZQ group, some sinusoids were still dilated and infiltrated with lymphocytes on the liver sections.

Praziquantel treatment is inefficacious in reducing the volume of hepatic granulomas in Schistosoma mansoni-infected mice receiving the low-protein diet

The number of granulomas per field was 0.45 ± 0.01 and 0.51 ± 0.05 in the liver and 0.60 ± 0.08 and 0.50 ± 0.10 in the intestine of infected mice receiving the standard diet (IN) or the low-protein diet (ILP), respectively. Praziquantel treatment significantly reduced the granulomas number in the liver of infected mice receiving the standard or the protein-deficient diet by 44.49% and 33.16%, respectively, compared to their infected-untreated controls (Fig 12A). Moreover, praziquantel treatment significantly decreases by 49.43% the number of intestine granulomas per field in the IN-PZQ group and by 66.04% in ILP-PQZ group of mice (Fig 12B).

Fig 12. Effects of praziquantel treatment on the liver and intestine granulomas number and volume of Schistosoma mansoni-infected mice receiving a low-protein diet.

Fig 12

Data are expressed as mean ±SEM (n = 4–8). Group IN: infected-untreated mice receiving a standard diet; group IN-PZQ: infected mice receiving a standard diet and treated with praziquantel; group ILP: infected-untreated mice receiving a low-protein diet; group ILP-PZQ: infected mice receiving a low-protein diet and treated with praziquantel. ANOVA followed by Turkey’s multiple comparison test. *P < 0.05; **P < 0.01: values are significantly different from infected-untreated mice receiving the standard diet (group IN). βP < 0.05; values are significantly different from infected-untreated mice receiving the low-protein diet (group ILP).

The volume of the liver granulomas significantly decreased by 38.37% in IN-PZQ mice compared to that of the control IN group. In the group of infected mice receiving the low-protein diet and treated with praziquantel, the hepatic granulomas volume was close to the one of the infected untreated mice group. (Fig 12C). Praziquantel treatment did not correct the hepatic granulomas volume in the ILP-PZQ group of mice.

Discussion

Protein malnutrition and schistosomiasis are health problems that affect millions of people. A low-protein diet increases the risk of illness and death [7,8]. Protein malnutrition can impair immune function and affect hematopoiesis, biochemical and histological parameters [7,10,4650]. Consequently, a low-protein diet increases susceptibility to infections and induces an imbalance between food intake and the need to ensure the most favourable growth [47,5153]. As revealed by the Lee index, the nutritional state of healthy mice receiving the low-protein diet was normal in the current study. Since the bromatological characteristics of the low-protein diet and the standard one revealed that the total metabolizable energy was similar, it can be understandable that the low-protein diet used to feed healthy mice has supplied food intake without altering energy expenditure, body fat, lean mass, and body weight [54,55]. While infected with S. mansoni, mice receiving either the standard or the low-protein diet significantly lost weight, probably due to anaemia and hypoglycemia. Indeed, the current study clearly showed a reduction in red blood cell count, hematocrit and glucose concentration in infected mice as S. mansoni adult worms use haemoglobin and glucose for their nutrition, energy supply, and egg-laying [56]. As determined by anthropometric indexes, growth retardation has been associated with chronic S. mansoni infection in children [17]. The Lee index also provides information on the health and growth of individuals and is often cited as a reliable indicator of nutritional status [57,58]. In this study, the Lee index of infected mice receiving the low-protein diet was significantly reduced, demonstrating the negative impact of undernutrition and schistosomiasis on growth [21,59]. Moreover, the total proteins, albumin, and glucose concentrations of mice fed with the low-protein diet significantly decreased. Hypoproteinemia and hypoalbuminemia could be the consequence of reducing protein supply in the diet, leading to a decrease of protein biosynthesis by the host. The combined effects of protein and glucose deficiencies and S. mansoni infection have undoubtedly impaired the nutritional status of the mice and, therefore, their growth. Contrary to that of infected mice fed a low-protein diet, oral administration of PZQ improves the body weight of infected mice receiving the standard diet. The low body weight of the infected mice fed with the low-protein diet and treated with PZQ could be linked to the persistence of anaemia and protein and glucose deficiencies after PZQ treatment. The red blood cell counts, and the concentrations of total proteins, albumin, and glucose of these mice remained low compared to those of healthy mice. An adverse synergistic action of malnutrition and S. mansoni infection on host glycemia and hemoglobinemia have been previously described [23,24].

In the current study, the worm recovery rates of infected-untreated mice were similar in both diet groups, indicating the capacity of worms to accomplish their life cycle in a final host fed with a low-protein diet [18,60]. However, some authors have mentioned that male adult S. mansoni isolated from mice fed with a low-protein diet present thinning of the tegument, large tubercles on the dorsal region, vacuolated areas on the subtegumental region, and small testes [18]. On the other hand, Wolowczuk et al. [61] pointed out that even if a low-protein diet may induce morphological changes in schistosomes and produce dwarf worms, these changes would not be enough to impair their reproductive capacity; dwarf worms would still be able to mate and lay eggs. This correlates with our study, where egg loads in feces and liver were comparable in both diet groups. S. mansoni-infected mice also exhibited hepatosplenomegaly and intestine enlargement, undoubtedly due to egg deposition in the hepatic and intestine parenchyma. Enlargement of the spleen could result from passive congestion of blood flow and reticuloendothelial hyperplasia [60,62]. Oral administration of PZQ to infected mice receiving the standard diet (IN-PZQ group) resulted in a significant reduction of hepatomegaly, splenomegaly, and intestine enlargement. This could be the consequence of the considerable decrease of egg burden in the liver and intestine after PZQ treatment, as recorded in this study and by some authors [30,6365]. The reduction of hepatic egg load of infected mice fed with the low-protein diet and treated with PZQ (ILP-PZQ) was insufficient to induce a reduction of hepatomegaly. Indeed, despite PZQ treatments, the worm and hepatic egg burdens of infected mice receiving the low-protein diet were higher than those of infected mice receiving the standard diet. These findings justify the persistence of anemia and low glucose levels in these mice and indicate that a low-protein diet could reduce PZQ efficacy. This is probably linked to intestinal malabsorption of PZQ as França et al. [13] have demonstrated that in undernourished mice, intestinal villi lose their brush border and become small and irregular, thus impairing intestinal function. Ibrahim et al. [12] pointed out that intestinal inflammation resulting from enteric pathogens disrupts intestinal barrier function. Undernutrition coupled with granulomatous intestinal inflammation, as recorded in infected mice fed with a low-protein diet, could thus explain the malabsorption of PZQ. The poor efficacy of PZQ in protein-undernourished and infected mice could also be understandable by exploring the PZQ mechanism of action. PZQ acts on schistosome motility by disrupting calcium ions homeostasis in the worm. It alters the worm’s membrane permeability, causing an uncontrolled and rapid calcium ion influx that leads to sustained muscle contraction and paralysis [6668]. It has been demonstrated that PZQ-induced disruption of schistosome tegument and muscular contraction depends on calcium concentration in the worm’s environment [67,6972]. In the current study, calcium levels remained low in infected mice receiving the low-protein diet and treated with PZQ. The extracellular calcium could therefore be insufficient to sustain schistosome muscle contractions which leads to their paralysis and death. This might also explain the important worm and egg burdens of infected mice receiving the low-protein diet after PZQ treatment.

Embolization of schistosome eggs in the liver induces impairment of hepatic metabolism. Following da Silva et al. [73], who demonstrated lipid metabolism alterations in hepatosplenic schistosomiasis, the present study showed significant decreases in total cholesterol, cholesterol LDL, and triglyceride in infected untreated mice receiving the standard or the low-protein diet. Because S. mansoni worms cannot synthesize cholesterol required for their growth and egg production, they absorb it from the host’s bloodstream, hence dropping total cholesterol, cholesterol LDL, and triglycerides [74]. Hepatocellular injury leading to the modification of transaminases (ALT and AST), alkaline phosphatase (ALP), gamma-glutamyl transferase (GGT), and total bilirubin (BIL) levels is also common in S. mansoni infection [30,45,63,65]. The presence of S. mansoni eggs in the liver parenchyma initiates an inflammatory process that gives rise to the formation of granulomas. These granulomatous lesions injure hepatocytes, which lose their membrane integrity and release transaminases in the bloodstream, thus increasing their activity [60,75]. The present investigation also showed increased PAL, GGT, and BIL concentration, implying an impairment of hepato-biliary function [73]. Since the liver is the site of iron metabolism, hepatocyte injury could increase iron concentration as recorded in S. mansoni-infected mice during this study and in patients with chronic liver diseases [76]. Administration of PZQ to infected mice receiving the standard diet or the low-protein diet ameliorates the lipid profile, ALP activity, and BIL concentration. ALT and GGT activities and iron levels were improved only in infected mice receiving the standard diet. These results demonstrated that the liver is recovering from the injury induced by S. mansoni infection. The concomitant reduction of worm burden and egg load in the liver after PZQ treatment has contributed to reducing the hepatocellular damage and probably initiated liver regeneration. Oliva-Vilarnau et al. [77] have demonstrated that calcium is a critical component of hepatic growth factors signalling during liver regeneration after injury. Intracellular calcium has been associated with mitogens epithelial growth factor (EGF) and hepatocyte growth factor (HGF) in hepatocytes. As recorded in this study, the normalization of the calcium concentration of infected mice receiving the standard diet after PZQ treatment could be essential for their liver regeneration. Remarkably, in S. mansoni infected mice receiving the low-protein diet, the ALT and GGT activities and iron and calcium concentrations did not recover after PZQ treatment. This impaired recovery is probably due to the high liver egg burden and hypocalcemia in these mice, indicating a diminished efficiency of PZQ treatment in this low-protein setting again.

The infection induced liver oxidative stress in the current study, marked by malondialdehyde overload and depletion of antioxidants and nitrites. During schistosomiasis, the granuloma-inflammatory cells generate reactive oxygen species (ROS) such as superoxide and hydroxyl radicals involved in the production of lipid peroxides. This leads to an increased concentration of MDA in the liver. Because of its implication in the generation of peroxynitrite, the oxidization of nitric oxide (NO) to nitrites, and consequently the concentration of nitrites, diminish. Therefore, the host will immediately use antioxidants to counteract the harmful action of ROS overload. The consequence will be the reduction of hepatic SOD, CAT, and GSH levels [4,30,45,6365,78,79]. Administration of PZQ to S. mansoni-infected mice fed with a standard or a low-protein diet reduced lipid peroxidation (MDA) and improved enzymatic, non-enzymatic antioxidants levels (SOD, CAT, and GSH). However, despite PZQ treatment to infected mice fed with the low-protein diet (ILP-PZQ), MDA concentration was still higher, and nitrites were lower than those of infected mice fed with the standard diet treated with PZQ (IN-PZQ). It implies that despite the treatment, lipoperoxidation due to ROS and peroxynitrite production occurs, probably because of the high liver egg burden of the ILP-PZQ group of mice. Indeed, the action of PZQ on oxidative stress is indirect through its schistosomicidal effect on adult worms. By limiting the recruitment of inflammatory cells, the source of ROS, in the vicinity of schistosome eggs, PZQ indirectly reduces ROS production [64,80,81].

The generation of oxidative stress is intimately linked to the granulomatous inflammatory cells’ activity. Therefore, reducing ROS production would reduce inflammatory response or vice versa. We assessed the effects of PZQ treatment on the inflammatory status of S. mansoni-infected mice by performing histomorphometry of the liver and intestine and determining the immunological status of the mice. Histopathological examination of the liver and the mall intestine sections of infected mice fed with the standard or the low-protein diet and treated with PZQ (IN-PZQ and ILP-PZQ, respectively) revealed fewer and smaller granulomas than in infected untreated mice. These observations were confirmed by the reducing number of liver and intestine granulomas. The hepatic granulomas volume also decreased in the IN-PZQ group of mice but not in the ILP-PZQ group. Other authors obtained similar results on S. mansoni-infected mice receiving a standard diet. They correlated this anti-inflammatory activity of PZQ to its schistosomicidal effect resulting in the reduction of eggs laying in the liver and intestine [30, 45, 8284]. The decrease in granulomas volume after PZQ treatment of infected mice could also be consistent with the reduction of fibrosis. This is materialized by the decline of collagen types I and III or their biomarker hydroxyproline [64, 82, 84]. The non-reduction of the hepatic granulomas volume of infected mice receiving the low-protein diet and treated with PZQ could be explained by the continuous recruitment of inflammatory cells due to the critical egg burden in their liver. It has been demonstrated that schistosomiasis and undernutrition comorbidity led to increased egg production and liver damage marked by high density and large areas of exudative granulomas [19, 20].

Malnutrition considerably impairs the immune system by causing atrophy of primary lymphoid organs, compromising complement components and phagocyte function, and decreasing the biological function of lymphocytes, macrophages, and Kupffer cells [12,13]. In the current study, protein deficiency did not induce significant Th1, Th2, Th17, and Treg levels. In contrast, several authors have reported reduced proliferation and effector function of lymphocytes T, a low level of blood lymphocytes T, and a shift of a Th1 towards a Th2 cytokine response in children with severe malnutrition and fasted mice or mice fed with a low-protein diet [1315,8588]. The lack of variation in cytokine levels in our study could be due to the moderate low-protein diet used to feed mice (14.60% of protein), as compared to the very low-protein diet (2% of protein) used by others [89]. The involvement of T lymphocytes, especially CD4+ T cells, in the immune response against schistosomiasis is essential [90]. During the migratory phase of schistosomula, from 3 to 5 weeks post-infection, the dominant immune response is Th1. When parasites mature, mate and begin to lay eggs at 5 to 6 weeks post-infection, female worms release fertilized eggs that stimulate a Th2 immune response via their soluble egg antigens. The Th2 response reaches a peak at approximately 8 weeks post-infection and is down-modulated with progression to chronic infection [9194]. In the current study, the immune response at 9 weeks of S. mansoni infection shifted from a Th1 to a Th2 response in infected mice receiving the standard or the low-protein diet. Indeed, the serum levels of TNF-α and IFN-γ, as well as the liver mRNA expression of CCL2/MCP-1, FGF, CCL3/MIP 1-α, CXCL-10/IP-10, and IFN-γ decreased significantly. Concurrently, the serum levels of IL-4, IL-5, IL-13, and the liver mRNA expression of FoxP3 increased. During the early acute stage of S. mansoni infection, a Th1 response is initiated and is characterized by the increased concentration of inflammatory cytokines and chemokines [95]. The elevated expression of eosinophil-, neutrophil- and macrophage- associated chemokines such as CCL2/ MCP-1, CCL3/MIP 1-α, and CXCL-10/IP-10 is concomitant to the migration of eosinophils and neutrophils from the circulation to the site of the granulomatous inflammation, and the recruitment and activation of hepatic stellate cells (HSCs). [9698]. HSCs can also be activated during the chronic stage of schistosomiasis, and in turn, they can produce chemokines like CCL2, CCL3, and CXCL-10 following liver injury [99]. The reduction of the mRNA expression of CCL2, CCL3, FGF, CXCL-10, and IFN-γ at the 9th-week post-infection reflects a downmodulation of the Th1 response by reducing the recruitment of inflammatory cells and HSCs to the granulomatous site. This indicates a maximal granuloma growth, as revealed by the highest IL-2 production [100]. The increased serum level of IL-17A during this period is also correlated to the granulomatous lesions associated with severe liver pathology [95,101]. Hepatic granuloma formation and fibrosis are upregulated by Th2 and Th17 cells, mainly secreting IL-4 and IL-17A, respectively [102104], and downregulated by Th1 and Treg cells [105,106]. Regulatory T cells secrete IL-10 and TGF-β that suppress the activation of dendritic cells, mediate Th1 and Th2 responses and inhibit granuloma development and fibrosis during S. mansoni infection to promote host survival [90,95,107,108]. During this study, increasing the serum level of IL-10 and its mRNA expression in infected mice demonstrates its regulatory activity by inhibiting the production of cytokines Th1 like TNF-α [107]. IL-10 can also play its regulatory role in periportal fibrosis by blocking the activation of quiescent HSCs [109,110]. The reduction of the mRNA expression of TGF-β1 in S. mansoni-infected mice after 9 weeks could also reflect the modulation of liver fibrosis. It has been reported that high levels of TGF-β1 are associated with liver fibrosis and pulmonary arterial hypertension in S. mansoni infection [111,112]. The normalization of Th1, Th2, Th17, and Treg cytokine levels (IL-2, IL-5, IL-13, IL-17A, and TGF-β1) and the mRNA expression of some chemokines and Treg cytokines (CCL3, CXCL-10 and TGF-β1) after PZQ treatment is the consequence of drug-induced clearance of S. mansoni worms. This reduces the number of eggs trapped in the liver, and subsequently the recruitment and migration of inflammatory cells around the eggs. Indeed, in the current study, PZQ treatment re-establish normal levels of total leukocytes and eosinophils that were significantly increased and of lymphocytes that was decreased by S. mansoni infection. Leukocytosis, eosinophilia and lymphocytopenia are common during granulomatous inflammatory diseases as schistosomiasis. Blood total leukocytes and eosinophils increase to fight the infection and lymphocytes migrate at the sites of inflammation, being attracted by chemokines and cytokines. This migratory process leads to a decrease of their blood count [113,114]. The capacity of PZQ to normalize the total leukocyte, eosinophil and lymphocyte blood counts therefore demonstrates its ability to limit the immunogenic action of S. mansoni eggs and to alleviate the infection. Because of the persistent high worm and egg burdens in the group of infected mice receiving the low-protein diet and treated with PZQ, the levels of IL-5 and the mRNA expression of CCL3 and CXCL-10 were not ameliorated by the treatment. FoxP3 was barely detectable in non-infected mice, but expressed in the liver of infected untreated mice and of infected mice treated with PZQ. This is consistent with its down-regulatory role on Th1 and Th2 cytokines production and on the fibrogranulomatous inflammation via the inhibition of the profibrogenic activity of IL-4 and IL-13 [115,116].

Conclusion

The current study revealed that a low-protein diet resulted in the low efficacy of praziquantel treatment on the growth, hepatomegaly, worm burden, and egg output of S. mansoni-infected mice. The difference was also noted for liver function biomarkers such as ALT, GGT, iron, and calcium and the liver oxidative stress biomarker malondialdehyde. Furthermore, the immunomodulatory activity of praziquantel was not significant in these mice, as the levels of Th2 cytokine IL-5 and the mRNA expression of chemokines CCL3/MIP-1α and CXCL-10/IP-10 were not improved. This poor praziquantel efficiency was also observed on the liver granulomas volume. This study, therefore, demonstrated the reduced praziquantel efficacy in S. mansoni-infected mice receiving a low-protein diet. It also underlines the importance of targeting protein deficiency and malnutrition in populations living in schistosomiasis endemic areas for efficient disease control.

Declarations

Consent for publication

Not applicable.

Acknowledgments

The authors are grateful to the association “Pathologie, Cytologie et Développement” (PCD), which kindly donated equipment and reagents for histological study. We also thank Ms Laetitia Béal and Ms Chloé Gommenginger for their technical assistance in realizing multiplex assays.

Data Availability

All relevant data are within the manuscript.

Funding Statement

One of the authors of this work (UMF) received the financial support of the France Government through the Cooperative and Cultural Action Service (SCAC) scholarship 959139G and the Strasbourg Institute of Parasitology and Tropical Diseases (IPPTS) to perform cytokine and RT-qPCR analyses. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.WHO. Fact sheets—Schistosomiasis. 2021. https://www.who.int/news-room/fact-sheets/detail/schistosomiasis. Accessed 18 May 2021.
  • 2.WHO. Fact sheets—malnutrition. 2021. https://www.who.int/news-room/fact-sheets/detail/malnutrition. Accessed 9 June 2021.
  • 3.Cavalcanti MG, de Araujo-Neto JM, Peralta JM. Schistosomiasis: clinical management of liver disease. Clin Liver Dis. 2015;6: 59–62. doi: 10.1002/cld.495 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.El-Sokkary GH, Omar HM, Hassanein, Cuzzocrea S, Reiter RJ. Melatonin reduces oxidative damage and increases survival of mice infected with Schistosoma mansoni. Free Radic Biol Med. 2002;32: 319–332. doi: 10.1016/s0891-5849(01)00753-5 [DOI] [PubMed] [Google Scholar]
  • 5.El Shenawy NS, Soliman MFM, Reyad SI. The effect of antioxidant properties of aqueous garlic extract and Nigella sativa as anti-schistosomiasis agents in mice. Rev Inst Med Trop Sao Paulo. 2008;50: 29–36. doi: 10.1590/s0036-46652008000100007 [DOI] [PubMed] [Google Scholar]
  • 6.FAO. The state of food and agriculture 2013 | FAO | food and agriculture organization of the united nations. 2013. [Google Scholar]
  • 7.Brundtland GH. Nutrition and Infection: malnutrition and Mortality in Public Health. Nutr Rev. 2009;58: S1–S4. doi: 10.1111/j.1753-4887.2000.tb07797.x [DOI] [PubMed] [Google Scholar]
  • 8.Calder PC. Feeding the immune system. Proc Nutr Soc. 2013;72: 299–309. doi: 10.1017/S0029665113001286 [DOI] [PubMed] [Google Scholar]
  • 9.Solomons NW. Malnutrition and infection: an update. British Journal of Nutrition. 2007. pp. S5–S10. doi: 10.1017/S0007114507832879 [DOI] [PubMed] [Google Scholar]
  • 10.Chandra RK. Symposium on “nutrition, infection and immunity”: nutrition and immunology: From the clinic to cellular biology and back again. Proc Nutr Soc. 1999;58: 681–683. doi: 10.1017/s0029665199000890 [DOI] [PubMed] [Google Scholar]
  • 11.Landgraf MA, Tostes R de CA, Borelli P, Zorn TMT, Nigro D, Carvalho MHC, et al. Mechanisms involved in the reduced leukocyte migration in intrauterine undernourishment. Nutrition. 2007;23: 145–156. doi: 10.1016/j.nut.2006.08.020 [DOI] [PubMed] [Google Scholar]
  • 12.Ibrahim MK, Zambruni M, Melby CL, Melby PC. Impact of childhood malnutrition on host defense and infection. Clin Microbiol Rev. 2017;30: 919–971. doi: 10.1128/CMR.00119-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.França TGD, Ishikawa LLW, Zorzella-Pezavento SFG, Chiuso-Minicucci F, Da Cunha MLRSM, Sartori A. Impact of malnutrition on immunity and infection. J Venom Anim Toxins Incl Trop Dis. 2009;15: 374–390. doi: 10.1590/S1678-91992009000300003 [DOI] [Google Scholar]
  • 14.Gerriets VA, MacIver NJ. Role of T cells in malnutrition and obesity. Front Immunol. 2014;5: 1–11. doi: 10.3389/fimmu.2014.00379 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rytter MJH, Kolte L, Briend A, Friis H, Christensen VB. The immune system in children with malnutrition—a systematic review. PLoS One. 2014;9: 1–19. doi: 10.1371/journal.pone.0105017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Schaible UE, Kaufmann SHE. Malnutrition and Infection: complex mechanisms and global impacts. PLoS Med. 2007;4: e115. doi: 10.1371/journal.pmed.0040115 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Assis AMO, Barreto ML, Prado MS, Reis MG, Parraga IM, Blanton RE. Schistosoma mansoni infection and nutritional status in schoolchildren: a randomized, double-blind trial in northeastern Brazil. Am J Clin Nutr. 1998;68: 1247–1253. doi: 10.1093/ajcn/68.6.1247 [DOI] [PubMed] [Google Scholar]
  • 18.Neves RH, Machado-Silva JR, Pelajo-Machado M, Oliveira SA, Coutinho EM, Lenzi HL, et al. Morphological aspects of Schistosoma mansoni adult worms isolated from nourished and undernourished mice: a comparative analysis by confocal laser scanning microscopy. Mem Inst Oswaldo Cruz. 2001;96: 1013–1016. doi: 10.1590/s0074-02762001000700022 [DOI] [PubMed] [Google Scholar]
  • 19.Coutinho EM. Malnutrition and hepatic fibrosis in murine schistosomiasis. Mem Inst Oswaldo Cruz. 2004;99: 85–92. doi: 10.1590/s0074-02762004000900015 [DOI] [PubMed] [Google Scholar]
  • 20.Corrêa CL, Lisboa PC, de Oliveira E, de Moura EG, de Oliveira RMF, Gomes AC, et al. The outcome of acute schistosomiasis infection in adult mice with postnatal exposure to maternal malnutrition. Mem Inst Oswaldo Cruz. 2011;106: 584–593. doi: 10.1590/s0074-02762011000500011 [DOI] [PubMed] [Google Scholar]
  • 21.Assis AMO, Prado MS, Barreto ML, Reis MG, Conceição Pinheiro SM, Parraga IM, et al. Childhood stunting in Northeast Brazil: the role of Schistosoma mansoni infection and inadequate dietary intake. Eur J Clin Nutr. 2004;58: 1022–1029. doi: 10.1038/sj.ejcn.1601926 [DOI] [PubMed] [Google Scholar]
  • 22.Coutinho EM, de Freitas LP, Abath FG. The influence of the regional basic diet from northeast Brazil on health and nutritional conditions of mice infected with Schistosoma mansoni. Rev Soc Bras Med Trop. 1992;25: 13–20. doi: 10.1590/s0037-86821992000100003 [DOI] [PubMed] [Google Scholar]
  • 23.Couto JLA, Vieira RCDS, Barbosa JM, Machado SS, Ferreira HDS. Alterações da função hepática de camundongos desnutridos e infectados pelo Schistosoma mansoni. Rev Soc Bras Med Trop. 2008;41: 390–393. doi: 10.1590/s0037-86822008000400013 [DOI] [PubMed] [Google Scholar]
  • 24.Coutinho HM, Acosta LP, McGarvey ST, Jarilla B, Jiz M, Pablo A, et al. Nutritional status improves after treatment of Schistosoma japonicum-infected children and adolescents. J Nutr. 2006;136: 183–188. doi: 10.1093/jn/136.1.183 [DOI] [PubMed] [Google Scholar]
  • 25.Coutinho EM, De Souza MM, Silva LM, Cavalcanti CL, De Araujo RE, Barbosa AA, et al. Pathogenesis of schistosomal “pipestem” fibrosis: a low-protein diet inhibits the development of “pipestem” fibrosis in mice. Int J Exp Pathol. 1997;78: 337–342. doi: 10.1046/j.1365-2613.1997.310357.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Simões C, Neves RH, De Andrade Barros L, Brito PD, Cravo CO, De Moura EG, et al. Parasitological characteristics of Schistosoma mansoni infection in Swiss mice with underlying malnutrition. Mem Inst Oswaldo Cruz. 2002;97: 143–147. doi: 10.1590/s0074-02762002000900027 [DOI] [PubMed] [Google Scholar]
  • 27.Mello AS, de Oliveira DC, Bizzarro B, Sá-Nunes A, Hastreiter AA, de Oliveira Beltran JS, et al. Protein Malnutrition Alters Spleen Cell Proliferation and IL-2 and IL-10 Production by Affecting the STAT-1 and STAT-3 Balance. Inflammation. 2014;37: 2125–2138. doi: 10.1007/s10753-014-9947-5 [DOI] [PubMed] [Google Scholar]
  • 28.Olivier L, Stirewalt MA. An efficient method for exposure of mice to cercariae of Schistosoma mansoni. J Parasitol. 1952;38: 19–23. doi: 10.2307/3274166 [DOI] [PubMed] [Google Scholar]
  • 29.Cioli D, Botros SS, Wheatcroft-Francklow K, Mbaye A, Southgate V, Tchuenté LAT, et al. Determination of ED50 values for praziquantel in praziquantel-resistant and -susceptible Schistosoma mansoni isolates. Int J Parasitol. 2004;34: 979–987. doi: 10.1016/j.ijpara.2004.05.001 [DOI] [PubMed] [Google Scholar]
  • 30.Jatsa HB, Feussom NG, Femoe UM, Kenfack MC, Nkondo ET, Kadji Fassi JB, et al. Evaluation of the schistosomicidal, antioxidant and anti-inflammatory activities of the ethyl acetate fraction from Ozoroa pulcherrima Schweinf. Roots on Schistosoma mansoni-induced liver pathology in mice and its phytochemical characterization. J Ethnopharmacol. 2019;238: 111883. doi: 10.1016/j.jep.2019.111883 [DOI] [PubMed] [Google Scholar]
  • 31.Novelli ELB, Diniz YS, Galhardi CM, Ebaid GMX, Rodrigues HG, Mani F, et al. Anthropometrical parameters and markers of obesity in rats. Lab Anim. 2007;1: 111–119. doi: 10.1258/002367707779399518 [DOI] [PubMed] [Google Scholar]
  • 32.DeWitt WB, Duvall RH. An Improved Perfusion Technique for Recovering Adult Schistosomes from Laboratory Animals. Am J Trop Med Hyg. 1967;16: 483–486. doi: 10.4269/ajtmh.1967.16.483 [DOI] [PubMed] [Google Scholar]
  • 33.Cheever AW. Conditions affecting the accuracy of potassium hydroxide digestion techniques for counting Schistosoma mansoni eggs in tissues. Bull World Health Organ. 1968;39: 328–331. [PMC free article] [PubMed] [Google Scholar]
  • 34.Gregor A, Kostrzewska E, Godorowska W. Determination of serum proteins in the presence of dextran by means of the Biuret reaction. Infusionstherapie und Klin Ernahrung—Forsch und Prax. 1977;4: 48–50. doi: 10.1159/000219790 [DOI] [PubMed] [Google Scholar]
  • 35.Doumas BT, Ard Watson W, Biggs HG. Albumin standards and the measurement of serum albumin with bromcresol green. Clin Chim Acta. 1971;31: 87–96. doi: 10.1016/0009-8981(71)90365-2 [DOI] [PubMed] [Google Scholar]
  • 36.Reitman S, Frankel S. A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am J Clin Pathol. 1957;28: 56–63. doi: 10.1093/ajcp/28.1.56 [DOI] [PubMed] [Google Scholar]
  • 37.Burtis CA, Ashwood ER. Tietz Textbook of Clinical Chemistry, Third Edition: 9780721656106: medicine & health science books @ amazon.com. [Google Scholar]
  • 38.Szasz G. Reaction rate method for γ glutamyltransferase activity in serum. Clin Chem. 1976;22: 2051–2055. doi: 10.1093/clinchem/22.12.2051 [DOI] [PubMed] [Google Scholar]
  • 39.Badimon JJ, Badimon L, Fuster V. Regression of atherosclerotic lesions by high density lipoprotein plasma fraction in the cholesterol-fed rabbit. J Clin Invest. 1990;85: 1234–1241. doi: 10.1172/JCI114558 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wilbur KM, Bernheim F, Shapiro OW. The thiobarbituric acid reagent as a test for the oxidation of. Arch Biochem. 1949;24: 305–313. [PubMed] [Google Scholar]
  • 41.Sinha AK. Colorimetric assay of catalase. Anal Biochem. 1972;47: 389–394. doi: 10.1016/0003-2697(72)90132-7 [DOI] [PubMed] [Google Scholar]
  • 42.Misra HP, Fridovich I. The purification and properties of superoxide dismutase from Neurospora crassa. J Biol Chem. 1972;247: 3410–3414. [PubMed] [Google Scholar]
  • 43.Ellman GL. Tissue sulfhydryl groups. Arch Biochem Biophys. 1959;82: 70–77. doi: 10.1016/0003-9861(59)90090-6 [DOI] [PubMed] [Google Scholar]
  • 44.Hibbs JB, Taintor RR, Vavrin Z, Rachlin EM. Nitric oxide: a cytotoxic activated macrophage effector molecule. Biochem Biophys Res Commun. 1988;157: 87–94. doi: 10.1016/s0006-291x(88)80015-9 [DOI] [PubMed] [Google Scholar]
  • 45.Jatsa HB, Femoe UM, Njiaza J, Tombe Tombe DS, Mbolang LN, Nkondo ET, et al. Efficacy of Sida pilosa Retz aqueous extract against Schistosoma mansoni—induced granulomatous inflammation in the liver and the intestine of mice: Histomorphometry and gastrointestinal motility evaluation. BMC Complement Altern Med. 2018;18: 247. doi: 10.1186/s12906-018-2318-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Fock RA, Vinolo MAR, de Moura Sá Rocha V, de Sá Rocha LC, Borelli P. Protein-energy malnutrition decreases the expression of TLR-4/MD-2 and CD14 receptors in peritoneal macrophages and reduces the synthesis of TNF-α in response to lipopolysaccharide (LPS) in mice. Cytokine. 2007;40: 105–114. doi: 10.1016/j.cyto.2007.08.007 [DOI] [PubMed] [Google Scholar]
  • 47.Ortiz R, Cortés L, Cortés E, Medina H. Malnutrition alters the rates of apoptosis in splenocytes and thymocyte subpopulations of rats. 2008. doi: 10.1111/j.1365-2249.2008.03796.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Fock RA, Blatt SL, Beutler B, Pereira J, Tsujita M, de Barros FEV, et al. Study of lymphocyte subpopulations in bone marrow in a model of protein-energy malnutrition. Nutrition. 2010;26: 1021–1028. doi: 10.1016/j.nut.2009.08.026 [DOI] [PubMed] [Google Scholar]
  • 49.Lim SL, Ong KCB, Chan YH, Loke WC, Ferguson M, Daniels L. Malnutrition and its impact on cost of hospitalization, length of stay, readmission and 3-year mortality. Clin Nutr. 2012;31: 345–350. doi: 10.1016/j.clnu.2011.11.001 [DOI] [PubMed] [Google Scholar]
  • 50.Calder PC. Feeding the immune system. 2020. doi: 10.1017/S0029665113001286 [DOI] [PubMed] [Google Scholar]
  • 51.Savino W, Postel-Vinay MC, Smaniotto S, Dardenne M. The Thymus Gland: a target organ for growth hormone. Scand J Immunol. 2002;55: 442–452. doi: 10.1046/j.1365-3083.2002.01077.x [DOI] [PubMed] [Google Scholar]
  • 52.Latham MC. Protein-energy malnutrition—its epidemiology and control. J Environ Pathol Toxicol Oncol. 1990;10: 168–180. [PubMed] [Google Scholar]
  • 53.Woodward B. Protein, calories, and immune defenses. Nutr Rev. 1998;56. doi: 10.1111/j.1753-4887.1998.tb01649.x [DOI] [PubMed] [Google Scholar]
  • 54.Griffioen-Roose S, Mars M, Siebelink E, Finlayson G, Tomé D, De Graaf C. Protein status elicits compensatory changes in food intake and food preferences. Am J Clin Nutr. 2012;95: 32–38. doi: 10.3945/ajcn.111.020503 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Griffioen-Roose S, Smeets PAM, Van Den Heuvel E, Boesveldt S, Finlayson G, De Graaf C. Human protein status modulates brain reward responses to food cues 1–3. Am J Clin Nutr. 2014;100: 113–122. doi: 10.3945/ajcn.113.079392 [DOI] [PubMed] [Google Scholar]
  • 56.Skelly PJ, Da’dara AA, Li XH, Castro-Borges W, Wilson RA. Schistosome feeding and regurgitation. PLoS Pathog. 2014;10. doi: 10.1371/journal.ppat.1004246 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Sclafani A, Gorman AN. Effects of age, sex, and prior body weight on the development of dietary obesity in adult rats. Physiol Behav. 1977;18: 1021–1026. doi: 10.1016/0031-9384(77)90006-3 [DOI] [PubMed] [Google Scholar]
  • 58.Fisher RS, Robert Almili C, Parsons S. Infant rats: VMH damage and the ontogeny of obesity and neuroendocrine dysfunction. Physiol Behav. 1978;21: 369–382. doi: 10.1016/0031-9384(78)90096-3 [DOI] [PubMed] [Google Scholar]
  • 59.Coutinho EM, Ferreira HS, de Freitas LP, Silva MR, Cavalcanti CL, Samico MJ. Nutrition and acute schistosomiasis. Mem Inst Oswaldo Cruz. 1992;87 Suppl 4: 297–301. doi: 10.1590/s0074-02761992000800046 [DOI] [PubMed] [Google Scholar]
  • 60.Wilson S, Vennervald BJ, Dunne DW. Chronic hepatosplenomegaly in African school children: a common but neglected morbidity associated with schistosomiasis and malaria. PLoS Negl Trop Dis. 2011;5. doi: 10.1371/journal.pntd.0001149 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Wolowczuk I, Nutten S, Roye O, Delacre M, Capron M, Murray RM, et al. Infection of mice lacking interleukin-7 (IL-7) reveals an unexpected role for IL-7 in the development of the parasite Schistosoma mansoni. Infect Immun. 1999;67: 4183–4190. doi: 10.1128/IAI.67.8.4183-4190.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Hamed MA. Potency of detergents in enhancing Schistosoma mansoni tegumental antigens. J Infect Dev Ctries. 2011;5: 209–215. doi: 10.3855/jidc.1199 [DOI] [PubMed] [Google Scholar]
  • 63.Jatsa HB, Kenfack CM, Simo DN, Feussom NG, Nkondo ET, Tchuem Tchuente LA, et al. Schistosomicidal, hepatoprotective and antioxidant activities of the methanolic fraction from Clerodendrum umbellatum Poir leaves aqueous extract in Schistosoma mansoni infection in mice. BMC Complement Altern Med. 2015;15: 1–9. doi: 10.1186/s12906-015-0520-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Jatsa HB, Russo RC, Pereira CADJ, Aguilar EC, Garcia CC, Araújo ES, et al. Improvement of the liver pathology by the aqueous extract and the n-butanol fraction of Sida pilosa Retz in Schistosoma mansoni-infected mice. J Ethnopharmacol. 2016;180: 114–123. doi: 10.1016/j.jep.2016.01.017 [DOI] [PubMed] [Google Scholar]
  • 65.Jatsa HB, Feussom NG, Nkondo ET, Kenfack MC, Simo ND, Fassi JBK, et al. Efficacy of Ozoroa pulcherrima Schweinf methanolic extract against Schistosoma mansoni-induced liver injury in mice. J Tradit Complement Med. 2019;9: 304–311. doi: 10.1016/j.jtcme.2017.08.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Giboda M, Smith JM. Schistosoma mansoni eggs as a target for praziquantel: efficacy of oral application in mice. J Trop Med Hyg. 1994;97: 98–102. [PubMed] [Google Scholar]
  • 67.Barros LA, Neves RH, De Moura EG, MacHado-Silva JR. Effects of low-protein diet on Schistosoma mansoni morphology visualized by morphometry and confocal laser scanning microscopy. J Helminthol. 2009;83: 13–21. doi: 10.1017/S0022149X08067217 [DOI] [PubMed] [Google Scholar]
  • 68.Thomas CM, Timson DJ. The mechanism of action of praziquantel: can new drugs exploit similar mechanisms? Curr Med Chem. 2020;27: 676–696. doi: 10.2174/0929867325666180926145537 [DOI] [PubMed] [Google Scholar]
  • 69.Bourke CD, Nausch N, Rujeni N, Appleby LJ, Mitchell KM, Midzi N, et al. Integrated analysis of innate, Th1, Th2, Th17, and regulatory cytokines identifies changes in immune polarisation following treatment of human schistosomiasis. J Infect Dis. 2013;208: 159–169. doi: 10.1093/infdis/jis524 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Doenhoff MJ, Cioli D, Utzinger J. Praziquantel: mechanisms of action, resistance and new derivatives for schistosomiasis. Curr Opin Infect Dis. 2008;21: 659–667. doi: 10.1097/QCO.0b013e328318978f [DOI] [PubMed] [Google Scholar]
  • 71.Chan YS, Huen DS, Glauert R, Whiteway E, Russell S. Optimising homing endonuclease gene drive performance in a semi-refractory species: the Drosophila melanogaster experience. PLoS One. 2013;8. doi: 10.1371/journal.pone.0054130 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Bricker CS, Depenbusch JW, Bennett JL, Thompson DP. The relationship between tegumental disruption and muscle contraction in Schistosoma mansoni exposed to various compounds. Zeitschrift für Parasitenkd Parasitol Res. 1983;69: 61–71. doi: 10.1007/BF00934011 [DOI] [PubMed] [Google Scholar]
  • 73.da Silva FL, Del-Rei RP, Fraga DBM, Leony LM, de Souza AMGC, Santos FLN. Alterations in the lipid profiles and circulating liver enzymes in individuals infected by Schistosoma mansoni. Rev Soc Bras Med Trop. 2018;51: 795–801. doi: 10.1590/0037-8682-0113-2018 [DOI] [PubMed] [Google Scholar]
  • 74.Meyer F, Meyer H, Bueding E. Lipid metabolism in the parasitic and free-living flatworms, Schistosoma mansoni and Dugesia dorotocephala. Biochim Biophys Acta (BBA)/Lipids Lipid Metab. 1970;210: 257–266. doi: 10.1016/0005-2760(70)90170-0 [DOI] [PubMed] [Google Scholar]
  • 75.Kadry SM, Mohamed AM, Farrag EM, Fayed DB. Influence of some micronutrients and Citharexylum quadrangular extract against liver fibrosis in Schistosoma mansoni infected mice. Glob J Pharm Pharmacol. 2013;1: 051–061. [Google Scholar]
  • 76.Kowdley K V. Iron overload in patients with chronic liver disease. Gastroenterol Hepatol. 2016;12: 695–698. [PMC free article] [PubMed] [Google Scholar]
  • 77.Oliva-Vilarnau N, Hankeova S, Vorrink SU, Mkrtchian S, Andersson ER, Lauschke VM. Calcium signaling in liver injury and regeneration. Front Med. 2018;5: 1–17. doi: 10.3389/fmed.2018.00192 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.El-Rigal NS, Nadia MM, Azza MM, Naema ZM, Maha ZR. Protection against oxidative damage induced by Schistosoma mansoni using susceptible/resistant nucleoproteins from Biomphalaria alexandrina Snails. Asian J Biol Sci. 2011;4: 445–456. doi: 10.3923/ajbs.2011.445.456 [DOI] [Google Scholar]
  • 79.Dkhil MA. Role of berberine in ameliorating Schistosoma mansoni-induced hepatic injury in mice. Biol Res. 2014;47. doi: 10.1186/0717-6287-47-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Souto AL, Tavares JF, Da Silva MS, De Diniz MFFM, De Athayde-Filho PF, Barbosa Filho JM . Anti-inflammatory activity of alkaloids: An update from 2000 to 2010. Molecules. 2011;16: 8515–8534. doi: 10.3390/molecules16108515 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Jatsa HB. Essais thérapeutiques de l’extrait aqueux et des fractions de Sida pilosa Retz (Malvacées) sur la pathologie induite par Schistosoma mansoni dans un modèle murin. 2016. [Google Scholar]
  • 82.El-Badrawy NM, Hadi AMA, Voss B, Metwally AA, Ebeid F. Effect of praziquantel on the distribution of interstitial collagen types I and III and basement membrane collagen types IV and V in murine hepatic schistosomiasis. Trans R Soc Trop Med Hyg. 1991;85: 752–755. doi: 10.1016/0035-9203(91)90444-4 [DOI] [PubMed] [Google Scholar]
  • 83.Riad NHA, Fares NH, Mostafa OMS, Mahmoud YI. The effect of garlic on some parasitological parameters and on hepatic tissue reactions in experimental Schistosomiasis mansoni. J Appl Sci Res. 2007;3: 949–960. [Google Scholar]
  • 84.Jatsa BH, Catherine C, Femoe MU, Feussom GN, Dzeufiet DDP, Tchuem TL. Analyses histologiques du foie des souris infectées par Schistosoma mansoni après traitement par Ozoroa pulcherrima Schweinf. Rev Française d’Histotechnologie. 2018;30: 31–50. [Google Scholar]
  • 85.Nájera O, González C, Toledo G, López L, Cortés E, Betancourt M, et al. CD45RA and CD45RO isoforms in infected malnourished and infected well-nourished children. Clin Exp Immunol. 2001;126: 461–465. doi: 10.1046/j.1365-2249.2001.01694.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Nájera O, González C, Toledo G, López L, Ortiz R. Flow cytometry study of lymphocyte subsets in malnourished and well-nourished children with bacterial infections. Clin Diagn Lab Immunol. 2004;11: 577–580. doi: 10.1128/CDLI.11.3.577-580.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Nájera O, González C, Cortés E, Toledo G, Ortiz R. Effector T lymphocytes in well-nourished and malnourished infected children. Clin Exp Immunol. 2007;148: 501–506. doi: 10.1111/j.1365-2249.2007.03369.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Peixoto Paes-Silva R, Michelle Correia de Macedo É, Tokiko Oliveira Tomiya M, Maria Machado Barbosa de Castro C. Immune response of severe malnutrition children treated according to the protocol of the World Health Organization. Nutr Hosp. 2015;32: 638–644. doi: 10.3305/nh.2015.32.2.9048 [DOI] [PubMed] [Google Scholar]
  • 89.Taylor AK, Cao W, Vora KP, De La Cruz J, Shieh WJ, Zaki SR, et al. Protein energy malnutrition decreases immunity and increases susceptibility to influenza infection in mice. J Infect Dis. 2013;207: 501–510. doi: 10.1093/infdis/jis527 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Zheng B, Zhang J, Chen H, Nie H, Miller H, Gong Q, et al. T lymphocyte-mediated liver immunopathology of schistosomiasis. Front Immunol. 2020;11: 61. doi: 10.3389/fimmu.2020.00061 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Pearce EJ, Caspar P, Grzych JM, Lewis FA, Sher A. Downregulation of Th1 cytokine production accompanies induction of Th2 responses by a parasitic helminth, Schistosoma mansoni. J Exp Med. 1991;173: 159–166. doi: 10.1084/jem.173.1.159 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Pearce EJ, MacDonald AS. The immunobiology of schistosomiasis. Nat Rev Immunol. 2002;2: 499–511. doi: 10.1038/nri843 [DOI] [PubMed] [Google Scholar]
  • 93.Wynn TA, Thompson RW, Cheever AW, Mentink-Kane MM. Immunopathogenesis of schistosomiasis. Immunol Rev. 2004;201: 156–167. doi: 10.1111/j.0105-2896.2004.00176.x [DOI] [PubMed] [Google Scholar]
  • 94.Wilson MS, Mentink-Kane MM, Pesce JT, Ramalingam TR, Thompson R, Wynn TA. Immunopathology of schistosomiasis. Immunol Cell Biol. 2007;85: 148–154. doi: 10.1038/sj.icb.7100014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Chuah C, Jones MK, Burke ML, McManus DP, Gobert GN. Cellular and chemokine-mediated regulation in schistosome-induced hepatic pathology. Trends Parasitol. 2014;30: 141–150. doi: 10.1016/j.pt.2013.12.009 [DOI] [PubMed] [Google Scholar]
  • 96.Burke ML, McManus DP, Ramm GA, Duke M, Li Y, Jones MK, et al. Temporal expression of chemokines dictates the hepatic inflammatory infiltrate in a murine model of schistosomiasis. PLoS Negl Trop Dis. 2010;4. doi: 10.1371/journal.pntd.0000598 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Souza PRS, Souza ALS, Negrão-Correa D, Teixeira AL, Teixeira MM. The role of chemokines in controlling granulomatous inflammation in Schistosoma mansoni infection. Acta Trop. 2008;108: 135–138. doi: 10.1016/j.actatropica.2008.04.016 [DOI] [PubMed] [Google Scholar]
  • 98.Fu CL, Odegaard JI, Herbert DR, Hsieh MH. A novel mouse model of Schistosoma haematobium egg-induced immunopathology. PLoS Pathog. 2012;8: 1–13. doi: 10.1371/journal.ppat.1002605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99.Seki E, De Minicis S, Österreicher CH, Kluwe J, Osawa Y, Brenner DA, et al. TLR4 enhances TGF-β signaling and hepatic fibrosis. Nat Med. 2007;13: 1324–1332. doi: 10.1038/nm1663 [DOI] [PubMed] [Google Scholar]
  • 100.Boros DL. The role of cytokines in the formation of the schistosome egg granuloma. Immunobiology. 1994;191: 441–450. doi: 10.1016/S0171-2985(11)80450-X [DOI] [PubMed] [Google Scholar]
  • 101.Rutitzky LI, Lopes da Rosa JR, Stadecker MJ. Severe CD4 T cell-mediated immunopathology in murine schistosomiasis is dependent on IL-12p40 and correlates with high levels of IL-17. J Immunol. 2005;175: 3920–3926. doi: 10.4049/jimmunol.175.6.3920 [DOI] [PubMed] [Google Scholar]
  • 102.Kaplan MH, Whitfield JR, Boros DL, Grusby MJ. Th2 cells are required for the Schistosoma mansoni egg-induced granulomatous response. J Immunol. 1998;160: 1850–6. [PubMed] [Google Scholar]
  • 103.Wen X, He L, Chi Y, Zhou S, Hoellwarth J, Zhang C, et al. Dynamics of Th17 cells and their role in Schistosoma japonicum infection in C57BL/6 mice. PLoS Negl Trop Dis. 2011;5. doi: 10.1371/journal.pntd.0001399 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104.Chen S, Gao Y, Liang Y, Hu L, Liu J, Peng L, et al. Imbalance of Th1/Th2 and Th17/Treg promoting schistosome egg granuloma formation. Int J Clin Exp Med. 2017;10: 14290–14300. [Google Scholar]
  • 105.Stadecker MJ, Asahi H, Finger E, Hernandez HJ, Rutitzky LI, Sun J. The immunobiology of Th1 polarization in high-pathology schistosomiasis. Immunol Rev. 2004;201: 168–179. doi: 10.1111/j.0105-2896.2004.00197.x [DOI] [PubMed] [Google Scholar]
  • 106.Singh KP, Gerard HC, Hudson AP, Reddy TR, Boros DL. Retroviral Foxp3 gene transfer ameliorates liver granuloma pathology in Schistosoma mansoni infected mice. Immunology. 2005;114: 410–417. doi: 10.1111/j.1365-2567.2004.02083.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107.Hesse M, Piccirillo CA, Belkaid Y, Prufer J, Mentink-Kane M, Leusink M, et al. The pathogenesis of schistosomiasis is controlled by cooperating IL-10-producing innate effector and regulatory T cells. J Immunol. 2004;172: 3157–3166. doi: 10.4049/jimmunol.172.5.3157 [DOI] [PubMed] [Google Scholar]
  • 108.Huang P, Zhou M, Cheng S, Hu Y, Gao M, Ma Y, et al. Myricetin possesses anthelmintic activity and attenuates hepatic fibrosis via modulating TGFβ1 and Akt signaling and shifting Th1/Th2 balance in Schistosoma japonicum-Infected Mice. Front Immunol. 2020;11: 593. doi: 10.3389/fimmu.2020.00593 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 109.Kamdem SD, Moyou-Somo R, Brombacher F, Nono JK. Host regulators of liver fibrosis during human schistosomiasis. Frontiers in Immunology. 2018. p. 2781. doi: 10.3389/fimmu.2018.02781 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 110.Mutengo MM, Mduluza T, Kelly P, Mwansa JCL, Kwenda G, Musonda P, et al. Low IL-6, IL-10, and TNF-α and high IL-13 cytokine levels are associated with severe hepatic fibrosis in Schistosoma mansoni chronically exposed individuals. J Parasitol Res. 2018;2018. doi: 10.1155/2018/9754060 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 111.Zhu D, He X, Duan Y, Chen J, Wang J, Sun X, et al. Expression of microRNA-454 in TGF-β1-stimulated hepatic stellate cells and in mouse livers infected with Schistosoma japonicum. Parasites and Vectors. 2014;7: 148. doi: 10.1186/1756-3305-7-148 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 112.Ferreira R de CDS, Montenegro SML, Domingues ALC, Bandeira AP, Silveira CADM, Leite LAC, et al. TGF beta and IL13 in schistosomiasis mansoni associated pulmonary arterial hypertension; a descriptive study with comparative groups. BMC Infect Dis. 2014;14: 282. doi: 10.1186/1471-2334-14-282 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 113.Riley LK, Rupert J. Evaluation of patients with leukocytosis. Am Fam Physician. 2015;92: 1004–1011. [PubMed] [Google Scholar]
  • 114.Ackermann MR. Inflammation and healing. Pathologic Basis of Veterinary Disease Expert Consult. Elsevier Inc.; 2017. pp. 73–131.e2. doi: [DOI] [Google Scholar]
  • 115.Schmiedel Y, Mombo-Ngoma G, Labuda LA, Janse JJ, de Gier B, Adegnika AA, et al. CD4+CD25hiFOXp3+ regulatory t cells and cytokine responses in human schistosomiasis before and after treatment with praziquantel. PLoS Negl Trop Dis. 2015;9. doi: 10.1371/journal.pntd.0003995 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 116.Romano A, Hou X, Sertorio M, Dessein H, Cabantous S, Oliveira P, et al. FOXP3+ regulatory T cells in hepatic fibrosis and splenomegaly caused by Schistosoma japonicum: the spleen may be a major source of Tregs in subjects with splenomegaly. PLoS Negl Trop Dis. 2016;10: e0004306. doi: 10.1371/journal.pntd.0004306 [DOI] [PMC free article] [PubMed] [Google Scholar]
PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0010249.r001

Decision Letter 0

Edward Mitre, Sergio C Oliveira

11 Apr 2022

Dear Pr Boukeng Jatsa,

Thank you very much for submitting your manuscript "Protein undernutrition reduces the efficacy of praziquantel in a murine model of Schistosoma mansoni infection" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

Dear Dr. Fassi and colleagues,

In general, the reviewers were positive with regards to your submission. The research question of the effects of malnutrition on the efficacy of praziquantel has important clinical and biological implications, and the research approach taken was sound.

Please address the critiques of the reviewers. In particular, both reviewers highlighted that the presentation of the results in some areas was confusing and made recommendations regarding changing many of the tables into graphs. Additionally, the reviewers recommended highlighting several limitations to the study in the discussion.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Edward Mitre

Associate Editor

PLOS Neglected Tropical Diseases

Sergio Oliveira

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Dear Dr. Fassi and colleagues,

In general, the reviewers were positive with regards to your submission. The research question of the effects of malnutrition on the efficacy of praziquantel has important clinical and biological implications, and the research approach taken was sound.

Please address the critiques of the reviewers. In particular, both reviewers highlighted that the presentation of the results in some areas was confusing and made recommendations regarding changing many of the tables into graphs. Additionally, the reviewers recommended highlighting several limitations to the study in the discussion.

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: see below

Reviewer #2: See general comments

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: see below

Reviewer #2: See general comments

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: see below

Reviewer #2: See general comments

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: see below

Reviewer #2: See general comments

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: Fassi et al have studied the effect of protein undernutrition on the efficacy of praziquantel treatment on S mansoni infection. The authors find that PZQ efficacy is reduced as consequence of protein undernutrition in experimental model of murine schistosomaisis.

This is a highly relevant research question populations in which S mansoni infection is endemic, often also suffer from malnutrition, including insufficient protein intake. Knowing how PZQ efficacy is affected by host nutritional status is therefore highly relevant. Alhtough the experimental approach is generally sound, the way the manuscript is written and data are presented make it hard to read. This should be improved. Specifically, I have the following comments:

Major comments:

1) The results section lists the main differences observed between the different experimental groups. However, it is now very difficult to read because it contains no rationale why certain parameters are analyzed. In addition, no summarizing sentences present at the end of each section, to bring across the main points of each of the findings. Also the headings of each section should reflect the findings of that section rather than what is measured. So, for instance, not ‘worm burden and egg load….in mice with a protein deficient diet and treated with PZQ’ but ‘PZQ treatment is less efficacious in reducing worm burden etc in Sm infected mice on a protein-poor diet’ These things should be changed, to improved readability.

2) The results section starts off with 10 tables, which are much harder to read then bar graphs. So please change them into bar graphs and display individual mice as dots, to be able to gauge inter experimental variation.

3) What was the rationale to treat the mice with PZQ at day 36 post infection, which is the prepatent phase, before egg deposition? In clinical settings, treatment will most likely take place in infections where egg laying has already started.

4) Where the mice randomized based on weight before infection? It doesn’t seem so, as there were some weight difference between the groups before Sm infection (table 4). This may have skewed some of the results

5) The authors attribute difference in PZQ treatment efficacy to differences in protein intake. However, before Sm infection, there seems to be a weight difference between the two groups with different diets. Hence differences in efficacy may inf fact be attricbuted to initial weight differences, rather than differences in protein intake specifically. This could be have solved by performing paired feeding experiments, where caloric intake of the mice on a protein poor diet was matched by those on a standard diet. This should at least be discussed and mentioned as limitation of the study.

6) Please also measure type 2 cytokines in figure 3.

7) What about hydroxyproline levels in livers of these mice as a measure for fibrosis?

Minor comments:

1) The authors use the term ‘protein-deficient diet’. However the type of diet used in this study is reduced in protein content, not deficient. This should be corrected throughout the manuscript

2) Please explain in the results section what the Lee index entails. This is explained later on, but should be explained at time of introduction

3) Abbreviations of the experimental groups don’t have to be introduced in every single results section. Once at the beginning of the results section is enough

Reviewer #2: Inadequate feeding is common in areas of poor sanitation where diseases such as schistosomiasis prevail. Kwashiorkor, a severe form of malnutrition common in some of these countries argue for the clear lack of protein-sufficient diet in these countries.

In this report, Jatsa and collaborators assessed the impact of protein-deficient diet on the efficacy of anti-schistosomiasis treatment with Praziquantel.

Using a mouse model of infection, the authors fed young mice (<5 weeks old) with protein-sufficient or protein-deficient diets for 5-6 weeks and infected them individually with 50 S mansoni cercariae. Animals were treated for 5 consecutive days with 100 mg/kg of PZQ after 6 weeks of infection and then culled after 9 weeks of infection to retrieve parasitological, pathological, biochemical and immunological markers of infection.

The authors report on a reduced ability of PZQ to clear parasites, restore ion levels, improve pathology and ameliorate stress in S mansoni-infected and PZQ treated protein-deficient diet fed mice where as PZQ treatment in S mansoni infected mice and initially fed with protein-sufficient diet displayed reduced parasitological burden, ameliorated liver pathology and reverse immunomodulatory markers that are pathognomonic of s mansoni infection.

The authors went on to conclude on the possible negative influence of a protein-deficient diet on the schistosomicidal, antioxidant, anti-inflammatory and immunomodulatory activities of PZQ.

General Comments:

The report is conceptually novel in its approach and does attempt to tackle a clearly relevant facet of schistosomiasis control in poor areas where undernutrition is common. As such the potential in providing preclinical insights on the current impact of undernutrition on PZQ treatment efficiency during schistosomiasis is clear and a novel addition to the current body of literature. The massive amount of data and the comprehensive appraisal of the differences in the experimental set-ups do considerably strengthen the robustness of the present report.

However, some points of concern are to be raised here to provide more clarity to the conclusions made by the authors and maximize the impact of the present report:

1) The present report of body weight change in table 4 is quite cryptic and should be rather displayed in a graph (XY, linear regression option on graph pad). Having performed the same with the data provided by the authors in table 4, I did fail to clearly see the claimed difference. In fact, weight loss was not to be found for all infected animals as claimed by the authors, especially for PZQ treated groups at day 106 i.e. prior to treatment per se. The data do not support a reversal of weight loss but perhaps a prevention of weight loss, as presented. Perhaps a body weight variation curve (i.e. following up the changes of an animal body weight and plotting that over time) would be more informative. As it now stands, the clear baseline differences in body weight do preclude a conclusive analysis of the extent of body weight change per group.

2) Lines 109-112:’ All procedures in this study followed the principles of laboratory animal use and care of the “European Community” guidelines (EEC Directive 2010/63/EEC) and were approved by the “Animal Ethical Committee” of the Laboratory of Animal Physiology of the Faculty of Sciences, University of Yaoundé I – Cameroon.’ The authors should provide an Ethics approval number for the study as is commonly assigned by established animal ethics committee.

3) Similarly to the body weight in table 4, the organ weight indexes in table 5 would benefit from a bar graph representation of the different indexes coupled with a conclusive curve on the percentage change from naïve to infected and from infected to treated. It is paramount here to consider the reference to the naïve setting towards which the PZQ treatment should move the system rather than simply claiming differences induced on the infected by the PZQ treatment (IN-PZQ vs IN compared to ILP-PZQ vs ILP). The latter approach, taken by the authors, is misleading as it is clear that infection does not similarly affect the IN and the ILP mice when compared to their naïve controls HN and HLP respectively.

4) Table 6 should also be displayed as bar graph for clarity. It is also necessary here to plot a variation curve to show how different the efficacy of PZQ is in one setting over the other i.e. a bar graph of worm burden changes after PZQ treatment in each group. This is the most critical result here, and should be more clearly represented to convey the key message of the paper.

5) Table 7-10 should be modified into graphs also i.e. presenting the data as bar graph and then performing statistical comparisons between HN vs HLP (what the diet does); HN vs IN & HLP vs ILP (what the infections does in the groups and plotting the changes here from infection in N vs infection in LP); IN-PZQ vs IN and vs HN compared to ILP-PZQ vs ILP and vs HLP (what treatment does and how close back to naïve does it bring the system) etc.. PS: Note that table 10 is too large and truncated as it was inserted in the wrong orientation.

6) Figure 6: How do the authors explain such an observation; secondly, hepatic granuloma volumes are apparently reduced by PZQ treatment in IN-PZQ but not in ILP-PZQ whereas both do present a drastic abrogation of IL-13 production (figure 2), a key cytokine, along with IL-4, in granuloma formation. How could that be reconciled ?

7) Lines 736-737: The authors refer to an eventual decrease of fibrosis in their assays following PZQ treatment. Was this decline quantitatively reported in the figures (area coverage in liver sections or hydroxyproline per trapped eggs in tissue etc…) ? Also, was this fibrosis development affected in ILP when compared to IN mice ?

8) Does protein undernutrition affect the course of the disease + host responsiveness to the disease and/or does it affect the efficacy of PZQ? The protein undernutrition could very well impair the host immune system, a key actor in the killing process of worms by PZQ. In fact, after worm paralysis induced by the drug, the host immune system might play a critical role in finalizing the schistosomicidal activity of the treatment (Modha J, Lambertucci JR, Doenhoff MJ, McLaren DJ: Immune dependence of schistosomicidal chemotherapy: an ultrastructural study of Schistosoma mansoni adult worms exposed to praziquantel and immune serum in vivo. Parasite Immunol. 1990, 12 (3): 321-334. 10.1111/j.1365-3024.1990.tb00958.x.). This should be better discussed and the a more inclusive view incorporating this aspect should be reflected in the entire discussion.

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Justin Komguep Nono

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0010249.r003

Decision Letter 1

Edward Mitre, Sergio C Oliveira

28 Jun 2022

Dear Pr Boukeng Jatsa,

We are pleased to inform you that your manuscript 'Protein undernutrition reduces the efficacy of praziquantel in a murine model of Schistosoma mansoni infection' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Edward Mitre

Associate Editor

PLOS Neglected Tropical Diseases

Sergio Oliveira

Deputy Editor

PLOS Neglected Tropical Diseases

***********************************************************

PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0010249.r004

Acceptance letter

Edward Mitre, Sergio C Oliveira

8 Jul 2022

Dear Pr Boukeng Jatsa,

We are delighted to inform you that your manuscript, "Protein undernutrition reduces the efficacy of praziquantel in a murine model of Schistosoma mansoni infection," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Attachment

    Submitted filename: Response to reviewers.docx

    Data Availability Statement

    All relevant data are within the manuscript.


    Articles from PLoS Neglected Tropical Diseases are provided here courtesy of PLOS

    RESOURCES