Performance and muscle lipogenesis of calves born to Nellore cows with different residual feed intake classification

Ana Carolina Almeida Rollo de Paz; Márcio Machado Ladeira; Priscilla Dutra Teixeira; Roberta Carrilho Canesin; Camila Delveaux Araujo Batalha; Maria Eugênia Zerlotti Mercadante; Sarah Figueiredo Martins Bonilha

doi:10.1371/journal.pone.0272236

. 2022 Jul 29;17(7):e0272236. doi: 10.1371/journal.pone.0272236

Performance and muscle lipogenesis of calves born to Nellore cows with different residual feed intake classification

Ana Carolina Almeida Rollo de Paz ¹, Márcio Machado Ladeira ², Priscilla Dutra Teixeira ², Roberta Carrilho Canesin ¹, Camila Delveaux Araujo Batalha ¹, Maria Eugênia Zerlotti Mercadante ¹, Sarah Figueiredo Martins Bonilha ^1,^*

Editor: Marcio Duarte³

PMCID: PMC9337683 PMID: 35905086

Abstract

This study aimed to evaluate relationships among maternal residual feed intake (RFI) with growth performance and expression of genes involved in lipid metabolism in offspring of Nellore cattle. Fifty-three cows classified as negative or positive RFI by genomic prediction were exposed to fixed-time artificial insemination (FTAI) protocols at 2 and 3 years of age using semen from the same bull. In the first year, cows gestated under grazing conditions and nursed their calves in the feedlot. In the second year, the opposite occurred. Cows were weighed every 28 days during pregnancy and calves were weighed at birth and every 28 days until weaning. Ultrasound images were collected from the carcass of cows and calves. Muscle gene expression was evaluated in calves at birth and weaning. Data were analyzed by year considering the fixed effects of RFI class and FTAI protocol for variables measured in cows, and RFI class, FTAI protocol and sex for variables measured in calves. There was no effect of maternal RFI on calves performance in the first year. Lower expression of FABP4 gene and trend towards lower expression of SREBF1 and LPL genes were detected in samples collected after birth from calves born to negative RFI cows, indicating that adipogenesis was reduced during the fetal and neonatal period. In the second year, negative RFI cows had greater subcutaneous fat thickness than positive RFI cows, and their calves tended to be heavier at birth and to have less rump fat thickness at weaning. No significant differences in expression of genes studied were detected between cow RFI classes. Nellore cows classified as negative RFI consume less feed and produce calves whose growth potential is similar to that of calves produced by positive RFI cows.

Introduction

Calf production is an important step for beef cattle system, being the first stage towards efficient livestock production. Maternal nutrition during pregnancy and lactation is crucial for the pre- and postnatal development of the offspring [1]. The low nutrient availability during the second trimester of gestation can have long-term effects on growth, body composition and metabolism of the offspring, affecting the development of fetal body tissues [2,3]. Furthermore, the maternal diet can affect the long-term expression of genes through epigenetic mechanisms since the nutritional stimulus is recorded by the genome and revealed by gene expression [4]. In other words, nutrient restriction during the fetal period can result in impaired growth rates and productivity throughout the offspring’s productive life [5]. Understanding this process and all factors involved is therefore important to improve the production indices of beef cattle herds.

The identification of feed efficient animals is also a key factor for the productive efficiency of beef cattle farming. It can be used as a strategy to control the costs and enhance sustainability of production systems. Residual feed intake (RFI) is a feed efficiency measure that explores variations in the feed intake of animals and is defined as the difference between observed and predicted dry matter intake as a function of the rate of gain and metabolic body weight (BW) of the animal [6]. Studies comparing animals classified as more or less feed efficient based on RFI have shown differences in the efficiency of energy utilization for maintenance [7]. Animals with lower net energy requirements for maintenance are interesting since they can allocate most of the energy to production traits. This direction of energy can favor the gestational environment and fetal development. Thus, the identification of feed efficient beef cows that have lower maintenance requirements and that produce calves with a good growth potential is a promising approach for beef cattle herds [8], since cows are the animal category that remains in the production system for the longest period of time.

Within this context, the study of the association between RFI and production traits of Nellore cows and the growth potential of their offspring is essential to determine whether lower feed intake, inherent to feed efficiency, has long-term effects on offspring development, body composition and metabolism. It is found in the literature that pregnant beef cows classified as low RFI consumed 1.91 kg DM/day less than high RFI cows for similar levels of body composition (ultrasound-measured fat thickness) and productivity (calf birth weight and calving difficulty) [9].

The hypothesis of the present study is that differences in feed intake, represented by the RFI class of Nellore cows, influence the growth potential, metabolism and gene expression in muscle tissue of their offspring until weaning. The aim of this study was to elucidate the effect of RFI class of Nellore cows on the growth traits and the expression of genes related to lipid metabolism of their offspring in different livestock production environments.

Material and methods

Two studies were conducted at Centro Avançado de Pesquisa e Desenvolvimento de Bovinos de Corte of the Instituto de Zootecnia (IZ), Secretaria da Agricultura e Abastecimento of the State of São Paulo, in consecutive years. Pregnant Nellore cows of divergent RFI classes raised under different nutritional conditions were studied. After the study, experimental animals returned with no sequels to the production system. The experiments followed the guidelines of animal welfare in accordance with State Law No. 11.977 of São Paulo State, Brazil. All procedures were approved by the Ethics Committee on Animal Use of IZ (protocol number 252–17).

Cows

Fifty-three contemporaneous Nellore cows belonging to the same line selected for growth and feed efficiency were used. The cows were genotyped using a 77k chip (Neogen, Michigan, USA). The RFI was determined by genomic prediction using relatedness data and missing genotypes imputed to 700k [10–12]. Based on the RFI thus obtained, the animals were classified as efficient (negative RFI, i.e., animals having RFI below the mean of the herd) or inefficient (positive RFI, i.e., animals having RFI above the mean of the herd).

From the total contemporary group of cows submitted to two fixed-time artificial insemination (FTAI) protocols for two consecutive years, 25 (471 ± 47.4 kg of BW and 749 ± 76 days of age) became pregnant in the first year and 28 became pregnant in the second year (558 ± 43.6 kg of BW and 1107 ± 77 days of age). Semen from the Macegal Nellore bull of IZ, which is classified as negative RFI and is from the same selection line as the cows, was used in both years.

The cows were weighed every 28 days in the morning, without previous fasting, during the second trimester of gestation, totaling three weight recordings. The following ultrasound measures were obtained on the occasion of the last weight recording: 1) rib eye area (REA) and backfat thickness (BFT) measured transversally between the 12^th and 13^th rib [13]; 2) rump fat thickness (RFT) measured longitudinally over the junction between the Gluteus medius and Biceps femoris muscles [13]. The images were obtained with a Pie Medical 401347-Aquila apparatus equipped with a 3.5-MHz linear probe (18 cm; Pie Medical Equipment B.V., Maastricht, Netherlands). The images were saved and subsequently analyzed using the Echo Image Viewer 1.0 (Pie Medical Equipment B.V., Maastricht, Netherlands), with a precision of 1 decimal place.

Calves

Fifty-three Nellore calves were evaluated: 25 calves in Year 1 (13 females and 12 males), including 11 animals born to negative RFI cows and 14 born to positive RFI cows; 28 calves in Year 2 (9 females and 19 males), including 13 animals born to negative RFI cows and 15 born to positive RFI cows.

The calves were weighed at birth and every 28 days until weaning, without previous fasting. Average daily weight gain (ADG) was calculated by regression using all available weights for each animal. The weight at 120 days of age (W120) was calculated from the birth weight and weight gain until 120 days of age. Similarly, the weight at 210 days of age (W210) was calculated from the birth weight and weight gain until 210 days of age. Calves were weaned with 259 ± 38.6 kg of BW and 220 ± 24 days of age in Year 1, and 209 ± 29.1 kg of BW and 254 ± 17 days of age in Year 2. On the occasion of weight recording at weaning, ultrasound measurements were taken at the same anatomical sites as measured in cows (i.e. REA, BFT, and RFT).

Nutritional management: Year 1

Prenatal nutrition

During pregnancy of Year 1, the 25 pregnant cows were kept on Brachiaria brizantha cv. Marandu paddock, having 22 ha of area, previously nitrogen fertilized, with mineral supplement in rainy season and protein supplement in dry season. Pasture samples were collected every 28 days during the months corresponding to the second trimester of gestation (April, May, and June) for the determination of nutritional composition. The paddock was sampled at six sites using a quadrant of 1 m² to obtain a representative sample of the area. The samples collected 5 cm from the ground at each site, were divided into the fractions of leaves, stems, dead material, and intact plant. The nutritional composition of the leaf fraction was used as a proxy of the feed consumed by the cows (Table 1).

Table 1. Chemical composition of the leaf fraction of the pasture available for cows during the second trimester of gestation.

Nutritional components
Dry matter (%)	52.5
Organic matter (%DM)	97.9
Mineral matter (%DM)	2.07
Crude protein (%DM)	5.21
Neutral detergent fiber (%DM)	73.3
Acid detergent fiber (%DM)	40.2
Lignin (%DM)	5.26
Total digestible nutrients (%)	36.2

Open in a new tab

The samples were dried in a forced ventilation oven (SOLAB, Piracicaba, SP, Brazil) at 65°C for 72 hours and then ground in a knife mill (Thomas Scientific, Swedesboro, NJ, USA) with a 1-mm sieve. Dry matter (DM) [14; AOAC Official Method 934.01] and mineral matter (MM) [14, AOAC Official Method 942.05] contents were determined. Neutral detergent insoluble fiber was determined using α-amylase without the addition of sodium sulfite [15], and corrected for ash and protein [16]. Acid detergent insoluble fiber was also determined [17]. Crude protein was analyzed by the combustion method of Dumas for the detection of nitrogen [14, AOAC Official Method 993.13]. Lignin was determined by solubilization of cellulose with sulfuric acid [18]. Total digestible nutrients were estimated from the results of bromatological analysis using the equation of Weiss [19].

Forage availability was calculated as the amount of forageavailable within 1 m², measured in six points over the area, multiplied by 10,000 m². The forage available for cows during the second trimester was 10.2 ton of DM/ha, with a leaf-to-stem ratio of 1.78. The proportions of leaf, stem and dead material were 42.6%, 31.8% and 25.6%, respectively.

Postnatal nutrition

The cow-calf pairs were kept under feedlot conditions in the same pen from calving to weaning. The diet was formulated to meet the requirements of lactating and pregnant females (RLM 3.2, ESALQ, Piracicaba, SP, Brazil). The animals (cows and calves) were housed in two paired collective paddocks (1,758 m² and 1,929 m²) with artificial shade (122 m²). In each paddock there was a collective drinker (1,500 L) and five electronic feeders (GrowSafe System^®, Vytelle, Kansas City, Missouri, USA) equipped with vertical and horizontal protection bars, which allowed access to only one animal at a time. The animals received an electronic identification tag to recognize each individual in the electronic feeder, which permits daily recording of individual feed intake.

Feed was offered twice a day, being the amount adjusted daily to maintain leftovers at about 10%. The leftovers were removed three times per week and the diet ingredients were sampled weekly for the determination of nutritional composition. The methods of sample preparation and determination of the nutritional components of the diet were the same as those described for leaf fraction (Table 2).

Table 2. Nutritional composition of the diet offered to lactating cows and calves.

Ingredients
Corn silage (%DM)	90.34
Soybean meal (%DM)	8.51
Mineral salt (%DM)	0.83
Urea (%MS)	0.32
Nutritional components
Dry matter (%)	41.4
Mineral matter (%DM)	3.67
Crude protein (%DM)	11.1
Neutral detergent fiber (%DM)	51.3
Acid detergent fiber (%DM)	20.5
Lignin (%DM)	5.59
Total digestible nutrients (%)	64.4
Metabolizable energy (Mcal/kg)	2.42

Open in a new tab

Dry matter intake was calculated as individual feed intake multiplied by the dietary DM content, considering the first 102 days of lactation for cows and the period between 35 days of age and weaning for calves.

Nutritional management: Year 2

Prenatal nutrition

The gestation period of Year 2 coincided with the lactation period of Year 1. Thus, during the second trimester of pregnancy, cow-calf pairs of Year 2 remained under feedlot conditions, with the diet and nutritional management being the same as those described for postnatal nutrition of calves from Year 1.

Postnatal nutrition

The 28 cow-calf pairs were kept on Brachiaria brizantha cv. Marandu paddock (22 ha of area, previously nitrogen fertilized) from birth to weaning with mineral supplement in rainy season and protein supplement in dry season. As described for the pre-natal management of Year 1, the paddock was sampled at six sites using a quadrant of 1 m² and the nutritional composition of the leaf fraction was analyzed as a proxy of the feed consumed by cows (Table 3).

Table 3. Chemical composition of the leaf fraction of the pasture available for cows and calves during the lactation period.

Nutritional components
Dry matter (%)	47.8
Organic matter (%DM)	91.2
Mineral matter (%DM)	8.84
Crude protein (%DM)	9.13
Neutral detergent fiber (%DM)	69.5
Acid detergent fiber (%DM)	34.5
Lignin (%DM)	4.64
Total digestible nutrients (%)	51.0

Open in a new tab

Forage availability was calculated as described previously and was 5.31 ton of DM/ha. The leaf-to-stem ratio was 0.73. The proportions of leaf, stem and dead material were 28.4%, 40.6% and 31.0%, respectively.

Weaning efficiency

The weaning efficiency (WE) was calculated based on calf weight at 205 days (W205) and cow weight at weaning using the equation: PE = (W205/cow weight at weaning)*100. The W205 was calculated as follows: W205 = WW + [(WW+BW)/WA]*(205-WA), where WW is the calf’s weight at weaning, BW is the birth weight, and WA is the calf’s age in days at weaning [20].

Muscle biopsy

Longissimus muscle biopsies were obtained on the body right side between the 12^th and 13^th rib of calves at 62 ± 24 days of age in Year 1 and at 56 ± 17 days of age in Year 2. For the biopsy, the lumbar region was shaved, the skin was cleaned and disinfected with degerming chlorhexidine and iodine, and 8 mL of 2% lidocaine hydrochloride without epinephrine was applied (Lidovet, Laboratório Bravet Ltda., Rio de Janeiro, RJ, Brazil) as local anesthetic. Approximately 1-cm long incision was made with a scalpel and a sterilized Bergstrom cannula (AgnThos, Eskildstuna, Södermanland, Sweden) was used to obtain 1 to 2 g of muscle tissue. After the procedure, the incision was washed with sterile saline/water, treated with iodine and antibiotic spray, and sutured with veterinary tissue adhesive. The calves were monitored until healing and the medication was applied again if necessary. The muscle tissue samples were immediately transferred to an identified cryogenic tube and frozen in liquid nitrogen for subsequent analysis of gene expression.

Close to the time of weaning, when the animals of Year 1 were 214 ± 24 days of age and the animals of Year 2 were 247 ± 17 days of age, a biopsy was performed to collect Longissimus muscle samples from body left side between the 12^th and 13^th rib for histological and gene expression analysis. For this procedure, in addition to the 8 mL of intradermally applied anesthetic, the calves received an additional 12 mL applied intramuscularly. A 10-cm skin incision was made with a scalpel in the cranio-caudal direction parallel to the dorsal midline of the animal. After the incision, the adipose tissue and epimysium were dissected for exposure of the muscle and two incisions were made parallel to the midline of the animal, removing a fragment that measured approximately 1 cm in width x 2 cm in length x 0.5 cm in depth for histological analysis.

Once the tissue sample was obtained, the muscle was immediately sutured with absorbable polyglycolic acid sutures (No.2, Atramat^®, Ciudad de México, DF, Mexico) and the skin was sutured with 60-mm nylon suture. Iodine and antibiotic spray were applied to the site of the incision for healing. The calves received an injectable anti-inflammatory agent and antibiotic and were monitored for 14 days after the procedure. The medications were applied again, if necessary, until removal of the external sutures.

Histological analysis

The muscle samples were fixed in 10% formalin for 48 hours. After fixation, the tissues were dehydrated in an increasing alcohol series (80, 85, 90, 95 and 100% ethanol) and submitted to two clearing sequences with xylene. The material was embedded in paraffin blocks and 5-μm sections were cut with a rotary microtome. Three slides were prepared per tissue sample per animal, totaling six sections. The tissue sections were stained with hematoxylin and eosin [21]. The samples were analyzed under an Olympus CX31 light microscope coupled to an Olympus SC30 camera (Olympus Corp., Tokyo, Honshu Island, Japan) for image capture using a 40X objective. After acquisition of the images, 50 fibers per sample were analyzed using the ImageJ^® software (National Institutes of Health, Bethesda, Maryland, USA). The Straight tool of the software was used to measure the diameter and area in μm.

Gene expression

The primers of the target and reference genes were selected based on the literature [22] using registered sequences published in the GenBank database of the National Center for Biotechnology Information (NCBI) platform (Table 4).

Table 4. Sequence (5’ to 3’) and efficiency of the primers used for qRT-PCR.

Symbol	Gene	Forward (F) and reverse (R)	Accession number	Amplicon (bp)	R²	Efficiency
PPARA	Peroxisome proliferator-activated receptor α	F `CAATGGAGATGGTGGACACA` R `TTGTAGGAAGTCTGCCGAGAG`	NM_001034036.1	95	0.992	99.2
PPARG	Peroxisome proliferator-activated receptor gamma	F `GCAATCAAAGTGGAGCCTGT` R `CCATGAGGGAGTTGGAAGG`	NM_181024.2	94	0.973	100
SREBF1	Sterol regulatory element-binding protein-1c	F `GAGCCACCCTTCAACGAA` R `TGTCTTCTATGTCGGTCAGCA`	NM_001113302.1	88	0.985	94.6
LPL	Lipoprotein lipase	F `CTCAGGACTCCCGAAGACAC` R `GTTTTGCTGCTGTGGTTGAA`	NM_001075120.1	98	0.99	96.7
FABP4	Fatty acid binding protein 4	F `GGATGGAAAATCAACCACCA` R `GTGGCAGTGACACCATTCAT`	NM_174314.2	84	0.991	99
ACACA	Acetyl CoA carboxylase alpha	F `TGAAGAAGCAATGGATGAACC` R `TTCAGACACGGAGCCAATAA`	NM_174224.2	88	0.994	96.6
FASN	Fatty acid synthase	F `ATCAACTCTGAGGGGCTGAA` R `CAACAAAACTGGTGCTCACG`	U34794.1	83	0.974	99.5
SCD1	Stearoyl-CoA desaturase	F `ACCATCACAGCACCTCCTTC` R `ATTTCAGGGCGGATGTCTTC`	NM_173959.4	95	0.991	98
ACOX	Acyl-coenzyme A oxidase 1	F `GCTGTCCTAAGGCGTTTGTG` R `ATGATGCTCCCCTGAAGAAA`	BC102761.2	83	0.994	99
CPT2	Carnitine palmitoyl transferase 2	F `CTATTCCCAAACTTGAAGAC` R `TTTTCCTGAACTGGCTGTCA`	NM_001045889.2	81	0.952	98
β-actin	β-actin	F `GTCCACCTTCCAGCAGATGT` R `CAGTCCGCCTAGAAGCATTT`	NM_173979.3	90	0.996	105
CASC3	Cancer susceptibility candidate 3	F `GGACCTCCACCTCAGTTCAA` R `GTCTTTGCCGTTGTGATGAA`	NM_001098069.1	85	0.976	98

Open in a new tab

Total RNA was extracted from the muscle samples using QIAzol (Qiagen, Valencia, CA, USA) and treated with DNA-free DNase (Ambion, Austin, TX, USA) according to manufacturer recommendations. For analysis of the rRNA bands (28S and 18S), total RNA was submitted to electrophoresis on 1% agarose gel stained with GelRed (Biotium, Hayward, CA, USA) and visualized under a UVItec FireReader XS D-77Ls-20M camera (UVItec, Cambridge, UK). The cDNA was synthesized using the cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) and the samples were stored at -20°C. qRT-PCR was carried out in an Eppendorf Realplex Real-Time PCR System (Eppendorf, Hamburg, Germany) using the SYBR Green detection system (Applied Biosystems, Foster City, CA, USA) and the cDNA of the samples [23].

The efficiency of the primers was determined by constructing standard curves for the genes studied using the following dilutions: 1:5, 1:25, 1:125, 1:625, and 1:3,125. The results were normalized using the cycle threshold (CT) obtained from the expression of the reference genes β-actin and cancer susceptibility candidate 3 (CASC3). Reference genes were chosen according to literature guidelines [22]. The relative expression levels were calculated [24] based on the CT values that were corrected for the amplification efficiency of each primer.

Statistical analysis

The data of each year were analyzed in a completely randomized design. Analysis of variance was performed using the PROC MIXED procedure of the SAS program (SAS Institute Inc., Cary, NC, USA), considering RFI class and FTAI protocol as the fixed effects for the variables measured in cows. For the variables measured in calves, RFI class, FTAI protocol and sex were included as fixed effects. The Shapiro-Wilk test was applied to evaluate the normality of the collected data. Since there was no normal distribution, the data were transformed using the PROC RANK procedure of SAS (SAS Institute Inc., Cary, NC). The interactions between effects were tested and removed from the model because they were not significant. Means were calculated by the least squares method and compared by the t-test at a probability level of 5%. Tendencies were defined when 0.05 < P ≤ 0.10 for the performance traits and when 0.05 < P ≤ 0.15 for the gene expression data.

Results

Considering both years, the mean RFI of cows was -0.087 kg DM/day. This value is within the range of the trait for a herd under selection for feed efficiency (Table 5).

Table 5. Descriptive statistics of the variables studied in Nellore cows and calves of Years 1 and 2.

Variable	n	Mean	SD	CV	Maximum	Minimum
Year 1
Cows
RFI, kg/day	25	-0.086	1.49	-	2.50	-4.85
W1, kg	25	501	50.4	10.1	586	412
W2, kg	25	516	51.5	9.98	608	422
W3, kg	25	527	53.4	10.1	621	422
WW, kg	25	615	57.9	9.41	740	492
ADG, kg/day	25	0.381	0.178	46.8	0.719	0.098
REA, cm²	25	79.4	5.21	6.56	87.7	64.3
BFT, mm	25	5.69	1.73	30.3	8.94	2.83
RFT, mm	25	7.31	2.17	29.7	12.3	3.07
DMI, kg/day	25	12.0	1.69	14.0	14.5	9.0
Calves
BW, kg	25	33.6	4.58	13.6	45.0	26.0
W120, kg	24	155	18.1	11.7	200	116
W210, kg	24	251	28.2	11.2	308	188
ADG, kg/day	24	1.03	0.121	11.7	1.26	0.772
REA, cm²	24	46.0	6.11	13.3	59.1	38.0
BFT, mm	24	2.26	0.888	39.3	3.80	0.000
RFT, mm	24	5.72	1.43	25.0	8.60	3.40
DMI, kg/day	24	2.64	0.895	33.9	4.42	1.51
PE, %	24	40.9	5.92	14.5	59.5	29.6
Year 2
Cows
RFI, kg/day	28	-0.088	0.681	-	1.28	-1.34
W1, kg	28	594	46.4	7.81	711	476
W2, kg	28	611	46.8	7.66	727	498
W3, kg	28	626	46.9	7.51	739	527
WW, kg	28	523	37.8	7.22	591	471
ADG, kg/day	28	0.501	0.241	48.1	1.03	0.147
REA, cm²	28	81.5	5.20	6.38	93.3	73.4
BFT, mm	28	8.50	1.58	18.6	12.2	5.73
RFT, mm	28	10.4	1.62	15.5	15.8	7.87
Calves
BW, kg	28	33.5	6.32	18.9	46.0	20.0
W120, kg	28	118	14.1	12.0	144	85.2
W210, kg	27	184	23.9	13.0	223	137
ADG, kg/day	27	0.761	0.130	17.1	1.07	0.537
REA, cm²	27	34.8	6.49	18.7	45.3	21.3
BFT, mm	27	1.26	0.552	43.7	2.30	0.000
RFT, mm	27	2.39	0.640	26.7	3.80	1.10
Area, μm²	27	3074	573	18.6	3875	1221
Diameter, μm	27	60.9	6.81	11.2	71.0	39.5
WE, %	27	33.1	4.87	14.7	40.8	23.6

Open in a new tab

n: Number of observations, SD: Standard deviation, CV: Coefficient of variation, RFI: Residual feed intake, W1: Weight in the 1^st month of the second trimester of gestation, W2: Weight in the 2^nd month of the second trimester of gestation, W3: Weight in the 3^rd month of the second trimester of gestation, WW: Weight at weaning of the calves, BW: Birth weight, W120: Weight at 120 days of age, W210: Weight at 210 days of age, ADG: Average daily gain, REA: Rib eye area, BFT: Backfat thickness, RFT: Rump fat thickness, DMI: Dry matter intake, WE: Weaning efficiency, Area: Muscle fiber area, Diameter: Muscle fiber diameter.

In both years, the average BW of cows increased during the second trimester of gestation, even when fetal weight was deducted, demonstrating energy availability for weight gain in both nutritional situations. In Year 1, the cows weighed on average 501 ± 50.4, 516 ± 51.5 and 527 ± 53.4 kg in the first, second and third month of the second trimester of gestation, respectively, with an ADG of 0.381 ± 0.178 kg/days. In Year 2, the average BW of cows was 594 ± 46.4, 611 ± 46.8 and 626 ± 46.9 kg in the first, second and third month of the second trimester of gestation, respectively, with an ADG of 0.501 ± 0.241 kg/days. The higher weights during pregnancy observed in Year 2 were expected since gestation occurred under feedlot conditions, which are characterized by greater nutrient availability of the diet compared to tropical pastures.

In Year 1, the cows gestated under the typical nutritional conditions of pastures and nursed under better nutritional conditions, with feed being offered in a trough. The animals reached an average BW of 615 ± 57.9 kg at weaning, corresponding to a weight gain of 88 kg between the end of the second trimester of gestation and weaning of the calves. In Year 2, the cows gestated under feedlot conditions and nursed their calves under grazing conditions. The average BW at weaning was 523 ± 37.8 kg, corresponding to a weight loss of 103 kg between the end of the second trimester of gestation and weaning of the calves.

The average birth weights of the calves were similar in the two years (33.6 ± 4.58 kg in Year 1 and 33.5 ± 6.32 kg in Year 2), showing that the difference in the nutritional condition to which the cows were exposed during pregnancy did not affect fetal growth. However, the same difference in nutritional condition to which the cow-calf pair was exposed had an expressive effect on the calf’s growth from birth to weaning, as demonstrated by the average BW at 120 and 210 days of age (155 vs 118 kg for W120 and 251 vs 184 kg for W210 in Years 1 and 2, respectively). These differences were also reflected in the body composition of the calves, with the following mean values for REA, BFT and RFT, respectively: 46.0 ± 6.11 cm², 2.26 ± 0.888 mm and 5.72 ± 1.43 mm in Year 1 and 34.8 ± 6.48 cm², 1.26 ± 0.552 mm and 2.39 ± 0.641 mm in Year 2. The weaning efficiency of calves was 40.9 ± 5.92% in Year 1 and 33.1 ± 4.87% in Year 2, corresponding to a 19.1% greater efficiency of calves of Year 1 compared to those of Year 2.

No significant differences in the performance traits of cows during the second trimester of gestation or postnatal growth of calves were found between RFI classes in Year 1 (Table 6). These results show that the efficient class of the cow was not associated with calf performance from birth to weaning under the environmental conditions of this year.

Table 6. Performance of Nellore cows of different residual feed intake (RFI) classes during the second trimester of gestation and postnatal growth of their calves in Year 1.

	Negative RFI	Positive RFI	P-value
Cows
RFI	-0.184 ± 0.467	0.376 ± 0.417	0.071^T
W1, kg	487 ± 15.3	505 ± 13.6	0.363^NS
W2, kg	501 ± 15.4	520 ± 13.7	0.365 ^NS
W3, kg	508 ± 15.6	534 ± 14.0	0.219 ^NS
WW, kg	604 ± 16.6	610 ± 14.8	0.806 ^NS
ADG, kg/day	0.301 ± 0.048	0.402 ± 0.043	0.124 ^NS
REA, cm²	81.0 ± 1.43	79.2 ± 1.27	0.296 ^NS
BFT, mm	5.48 ± 0.542	5.97 ± 0.484	0.496 ^NS
RFT, mm	7.23 ± 0.681	7.59 ± 0.608	0.698 ^NS
DMI, kg/day	11.8 ± 0.501	11.9 ± 0.447	0.974 ^NS
Calves
BW, kg	35.0 ± 1.17	33.1 ± 1.05	0.226 ^NS
W120, kg	159 ± 5.05	152 ± 4.64	0.317 ^NS
W210, kg	253 ± 8.20	247 ± 7.54	0.627 ^NS
ADG, kg/day	1.04 ± 0.036	1.02 ± 0.033	0.737 ^NS
REA, cm²	45.7 ± 1.52	44.4 ± 1.40	0.520 ^NS
BFT, mm	2.17 ± 0.274	2.21 ± 0.252	0.906 ^NS
RFT, mm	5.74 ± 0.388	5.43 ± 0.357	0.574 ^NS
DMI, kg/day	2.68 ± 0.290	2.60 ± 0.267	0.844 ^NS
WE, %	41.3 ± 1.67	41.7 ± 1.54	0.867 ^NS

Open in a new tab

W1: Weight in the 1^st month of the second trimester of gestation, W2: Weight in the 2^nd month of the second trimester of gestation, W3: Weight in the 3^rd month of the second trimester of gestation, WW: Weight at weaning of the calves, BW: Birth weight, W120: Weight at 120 days of age, W210: Weight at 210 days of age, ADG: Average daily gain, REA: Rib eye area, BFT: Backfat thickness, RFT: Rump fat thickness, DMI: Dry matter intake, WE: Weaning efficiency.

*: <0.05;

^T: 0.05<^T<0.10;

^NS: Not significant.

Despite the similarity in the performance traits of cows during pregnancy and in the postnatal growth traits of calves, differences in the expression of genes involved in lipid metabolism were detected between RFI classes at birth (Fig 1A). Offspring of negative RFI cows tended to have lower expression of the sterol regulatory element-binding protein 1c (SREBF1) gene and consequently lower expression of the lipoprotein lipase (LPL) and fatty acid binding protein 4 (FABP4) genes. However, there was no difference between cow RFI classes for the peroxisome proliferator-activated receptor (PPARA and PPARG), acetyl CoA carboxylase alpha (ACACA), fatty acid synthase (FASN), stearoyl-CoA desaturase (SCD1), carnitine palmitoyltransferase 2 (CPT2), or acyl-coenzyme A oxidase 1 (ACOX) genes. Despite the effect observed at birth, the expression of all genes studied was similar in both RFI classes of cows close to weaning (Fig 1B).

Fig 1 — (A) Birth, (B) Weaning. The bars represent the standard deviation of the mean. Values with an asterisk (*) differ significantly (P ≤ 0.05) and T indicates a tendency (0.05 < P ≤ 0.15). NS: Not significant (P > 0.15).

In Year 2, negative RFI cows had higher BFT and tended to have higher RFT in the second trimester of gestation than positive RFI cows, and their calves tended to be heavier at birth and to have less rump fat at weaning (Table 7). No significant differences between maternal RFI classes were found for the other variables studied.

Table 7. Performance of Nellore cows of different residual feed intake (RFI) classes during the second trimester of gestation and postnatal growth of their calves in Year 2.

	Negative RFI	Positive RFI	P-value
Cows
RFI, kg/d	-0.280 ± 0.202	0.078 ± 0.235	0.066^T
W1, kg	572 ± 12.8	590 ± 14.9	0.301 ^NS
W2, kg	594 ± 13.5	607 ± 15.7	0.477 ^NS
W3, kg	611 ± 13.8	623 ± 16.1	0.554 ^NS
WW, kg	517 ± 11.2	511 ± 13.3	0.709 ^NS
ADG, kg/day	0.626 ± 0.066	0.512 ± 0.076	0.211 ^NS
REA, cm²	82.6 ± 1.51	79.3 ± 1.76	0.123 ^NS
BFT, mm	8.72 ± 0.433	7.45 ± 0.503	0.040 ^*
RFT, mm	10.6 ± 0.451	9.42 ± 0.524	0.076^T
Calves
BW, kg	34.3 ± 1.90	29.8 ± 2.08	0.068^T
W120, kg	118 ± 4.84	116 ± 5.30	0.738 ^NS
W210, kg	184 ± 7.91	186 ± 8.69	0.827 ^NS
ADG, kg/day	0.810 ± 0.034	0.811 ± 0.037	0.971 ^NS
REA, cm²	33.1 ± 2.23	34.1 ± 2.44	0.739 ^NS
BFT, mm	1.08 ± 0.186	1.30 ± 0.204	0.359 ^NS
RFT, mm	2.23 ± 0.203	2.66 ± 0.222	0.097^T
Area, μm²	2977 ± 196	3060 ± 215	0.734 ^NS
Diameter, μm	59.8 ± 2.34	60.9 ± 2.57	0.693 ^NS
WE, %	34.0 ± 1.51	33.8 ± 1.72	0.928 ^NS

Open in a new tab

*: <0,05;

^T: 0,05<^T<0,10;

^NS: Not significant.

In Year 2, the expression of genes involved in lipid metabolism, were similar between maternal RFI classes for transcription factors (SREBF1, PPARA and PPARG), uptake genes (LPL and FABP4), lipogenic genes (ACACA, FASN and SCD1), and lipolytic genes (CPT2 and ACOX) at birth or weaning (Fig 2).

Fig 2 — (A) Birth, (B) Weaning. The bars represent the standard deviation of the mean. Values with an asterisk (*) differ significantly (P ≤ 0.05) and T indicates a tendency (0.05 < P ≤ 0.15). NS: Not significant (P > 0.15).

Discussion

Feed efficiency is relevant for beef cattle production systems since feed costs account for the highest percentage of total production costs. In beef cattle herds, the cow category remains in the production system for the longest period of time and requires the largest supply of inputs; thus, small daily variations in the feed intake of this category would have a more expressive effect on the efficiency of the whole system [25]. The RFI is a measure of feed efficiency independent of the BW and growth rate of the animals [6]. The measurement of RFI in cows and the selection of efficient animals are an alternative to reduce inputs necessary for beef production, which would have economic and environmental benefits.

The difference in dry matter intake between RFI classes was 0.560 kg/day in Year 1 (-0.184 kg/day for negative RFI and +0.376 kg/day for positive RFI) and 0.358 kg/day in Year 2 (-0.280 kg/day for negative RFI and +0.078 kg/day for positive RFI). Studies of RFI in beef cows in the literature reported an average dry matter intake of 9.6 kg/day for animals classified as low RFI, of 11.2 kg/day for those classified as medium RFI, and of 12.6 kg/day for those classified as high RFI [26] or of 12.0 kg/day for negative RFI cows and of 13.3 kg/day for positive RFI cows [27]. These results indicate expressive differences in feed intake between feed efficiency classes of cows.

The main function of cows in beef cattle herds is the production of healthy calves with a good growth potential. Thus, studying the effects of the choice of feed-efficient cows based on RFI on the calves produced is of fundamental importance in order to avoid losses in production traits of the herds. It is equally important to know the effect of the pre- and postnatal environments on the growth traits of calves. These are the reasons why the results of Years 1 and 2 were reported sequentially.

The performance of pasture-raised animals is directly related to the availability and quality of forage, which interferes with feed intake and consequently with nutrient intake [28]. Years 1 and 2 used feeds with highly different nutritional compositions (pasture and diet offered in a trough), with the forage quality being below satisfactory standards during some periods.

As expected, a difference of 19% was found in the comparison of calf production efficiency between Years 1 and 2, which is mostly explained by the variation in nutritional conditions and physiological differences between studied years. Thus, the adoption of feed efficiency measures in order to improve productive efficiency must be considered in systems that meet the basic requirements for animal nutrition.

The ADG of cows during the second trimester of gestation was 0.301 and 0.402 kg/day in Year 1 and 0.626 and 0.512 kg/day in Year 2 for negative and positive RFI cows, respectively. The difference between years was mainly due to the nutritional condition established. ADG under feedlot conditions of 0.81, 0.84 and 0.82 kg/day for low, medium and high RFI cows, respectively, were reported in the literature [26]. The ADG of cows during the second trimester found in Years 1 and 2 showed that pregnant cows met the nutritional requirements, even in the situation of low forage quality (pregnancy studied in Year 1). The cows did not enter a negative energy balance during gestation, a key factor for the formation of muscle tissue in the fetus which can affect its growth potential during different phases of life.

In conventional beef cattle production systems, the suckling period of calves born in one year coincides with the gestation period of calves of the following year. The calves of Year 1, which were gestated under grazing conditions, spent the suckling period under feedlot conditions together with their mothers that were pregnant with the calves of Year 2. Thus, due to the better nutritional conditions, these animals had greater ADG during the period from birth to weaning than calves of Year 2, regardless of maternal RFI class. Calves born to cows that received protein supplementation during pregnancy had higher weights at birth, 4 months of age and weaning than calves born to not supplemented cows [29].

The higher BW of calves of Year 1 compared to Year 2 resulted in greater REA, BFT and RFT. The ultrasound measures of calves born to non-supplemented and supplemented cows were compared and significant differences were detected between treatments: 49.6 vs 54.9 cm² for REA and 5.6 vs 6.6 mm for BFT, respectively [30].

Weaning efficiency was calculated in the two nutritional situations evaluated (Years 1 and 2). Negative and positive RFI cows produced calves with the same efficiency, which is an advantage for negative RFI cows that consumed less feed for the same weaning efficiency. The weaning efficiency of Nellore cow-calf pairs of different RFI classes were reported in the literature, being similar for negative and positive RFI animals (40.6 vs 40.0%) [27].

It is known that cows have increased amino acid requirements during fetal development and that both the lack and excess of these nutrients can alter the metabolic pathways of the fetus. It is reported in the literature that nutritional restriction of the pregnant cow can affect the expression of the PPARG gene in adipose tissues [31]. The PPARG gene uses fatty acids as endogenous ligands and the expression of the gene is regulated nutritionally. Thus, amino acids present in maternal milk can affect the expression of PPARG in calves [32]. The FABP4 gene is expressed in adipocytes and influences the coding of proteins related to fatty acid metabolism necessary for fat deposition [33]. As the expression of the FABP4 gene occurs, intramuscular fat develops [34]. In ruminants, 55 to 60% of free fatty acids are derived from the hydrolysis of triglycerides mediated by the LPL gene [35]. This gene plays a key role in lipid uptake and in the formation of fat cells and also regulates the BW and energy balance of animals by controlling triglycerides in adipose and muscle tissues [36,37].

Three factors interfere with the lipid balance: diet, biosynthesis, and catabolism through β-oxidation [38]. Changes in synthesis and degradation of lipid balance are related to an increase or decrease of intramuscular fat [39]. The SCD1 gene is involved in lipid metabolism and BW control [40]. In cattle, SCD1 is associated with marbling and milk production of females [41,42]. The protein FASN is mainly involved in fatty acid synthesis and lipid metabolism [43] and its levels are controlled by the mRNA transcription rate [44]. Beta-oxidation of fatty acids is initiated by ACOX1. Like SDC1 and FASN, this enzyme is significant for lipid metabolism.

In the present study, expression of the FABP4 gene at birth was lower in calves born to negative RFI cows; however, when evaluated close to weaning, the expression of this gene was similar in calves born to negative and positive RFI cows. In addition, there was a tendency towards lower expression of the SREBF1 and LPL genes in calves born to negative RFI cows immediately after birth. All of these genes are associated with the formation of fat cells, indicating that adipogenesis occurs later during the fetal and neonatal period in calves born to negative RFI cows.

Despite the similarity between maternal RFI classes in terms of the growth traits of their offspring, the gene expression data of Year 1 suggest that RFI exerts an effect on adipogenesis and consequently affects fat deposition in the offspring during the finishing phase. The results of this study indicate that RFI class exerts its effect mainly under conditions of maternal nutritional restriction since no effect on the expression of genes involved in lipid metabolism was observed in Year 2, in which cows gestated under feedlot conditions. In cattle, adipogenesis starts in mid-gestation and lasts throughout the life of the offspring [45]. Although there was no significant difference in the expression of the transcription factor PPARG, one of the main markers of adipogenesis, between maternal RFI classes, the lower expression of SREBF1 at birth in calves born to negative RFI cows suggests reduced adipogenesis in these animals during the fetal and neonatal period. However, during the neonatal period, the adipogenesis of intramuscular fat becomes more effective because of greater differentiation of progenitor cells to the intramuscular adipocyte lineage [45], a fact that may have prevented the effect of the maternal’s RFI class from persisting until weaning since the nutritional conditions were more favorable.

The SREBF1 transcription factor is involved in the terminal events of adipose cell differentiation. In the nucleus, this factor activates the transcription of genes that encode enzymes involved in lipid metabolism such as LPL and FABP4 [46–48]. In Year 1, as observed for SREBF1, offspring of negative RFI cows exhibited lower expression of the LPL and FABP4 genes.

The FABP4 gene is mainly expressed in mature adipocytes. This gene encodes a protein that participates in the absorption and transport of fatty acids, being involved in fat deposition [49]. Thus, the lower expression of FABP4 may be an indicator of a reduction in the formation of adipocytes in muscle tissue during the fetal period, which may affect fat deposition during the finishing phase of these animals.

Conclusion

The pre- and postnatal nutritional conditions influence the deposition of body tissues at the beginning of life in Nellore cattle. Nellore cows classified as negative RFI are beneficial for global livestock production systems since they consume less feed and produce calves with a growth potential similar to those produced by positive RFI cows. Adipogenesis during the fetal period is reduced in calves born to negative RFI cows that gestated under the nutritional conditions of tropical pastures.

Supporting information

S1 Fig. Genetic value for RFI from the entire Nellore progeny group born in 2014 at Instituto de Zootenia.

(DOCX)

Click here for additional data file.^{(41.1KB, docx)}

S2 Fig. Experimental cow-calf pairs performance data.

(DOCX)

Click here for additional data file.^{(44.9KB, docx)}

Data Availability

All relevant data are within the manuscript and its Supporting information files.

Funding Statement

This work was supported by São Paulo Research Foundation (FAPESP): grant #2017/06709-2 provided to SFMB; and #2018/20080-2 provided to CDAB. This work was also supported by Coordination for the Improvement of Higher Education Personnel (CAPES, Finance Code 001), providing grant to ACARP. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. There was no additional external funding received for this study.

References

1.Meyer AM, Reed JJ, Vonnahme KA, Soto-Navarro SA, Reynolds LP, Ford SP, et al. Effects of stage of gestation and nutrient restriction during Early tom id-gestation on maternal and fetal visceral organ mass and indices of jejunal growth and vascularity in beef cows. Journal of Animal Science. 2014; 88:2410–2424. doi: 10.2527/jas.2009-2220 [DOI] [PubMed] [Google Scholar]
2.Robinson DL, Oddy VH, Smith C. Preliminary genetic parameters for feed intake and efficiency in feedlot cattle. Procedings: Association for the Advancement of Animal Breeding and Genetics. 1999; 13. [Google Scholar]
3.Du M, Tong J, Zhao J, Underwood KR, Zhu M, Ford SP, et al. Fetal programming of skeletal muscle Development in ruminant animals. Journal of Animal Science. 2009; 88:E51–E60. doi: 10.2527/jas.2009-2311 [DOI] [PubMed] [Google Scholar]
4.Funston RN, Larson DM, Vonnahme KA. Effects of maternal nutrition on conceptus growth and offspring performance: Implications for beef cattle production. Journal of Animal Science. 2010; 88:E205–E215. doi: 10.2527/jas.2009-2351 [DOI] [PubMed] [Google Scholar]
5.Wu G, Bazer FW, Wallace JM, Spencer TE. Board-Invited Review: Intrauterine growth retardation: Implications for the animal sciences. Journal of Animal Science. 2006; 84:2316–2337. doi: 10.2527/jas.2006-156 [DOI] [PubMed] [Google Scholar]
6.Koch RM, Swiger LA, Chambers D, Gregory KE. Efficiency of feed use in beef cattle. Journal of Animal Science. 1963; 22:486–494. [Google Scholar]
7.Menezes ACB, Valadares SC, Benedeti PDB, Zanetti D, Paulino MF, Silva FF, et al. Feeding behavior, water intake, and energy and protein requirements of young Nellore bulls with different residual feed intakes. Journal of Animal Science. 2020; 98(9). doi: 10.1093/jas/skaa279 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Ferrell CL, Jenkins TG. Energy utilization by mature, nonpregnant, nonlactating cows of different types. Journal of Animal Science. 1984; 58(1). doi: 10.2527/jas1984.581234x [DOI] [PubMed] [Google Scholar]
9.Fitzsimons C, Kenny DA, Fahey AG, McGee M. Feeding behavior, ruminal fermentation, and performance of pregnant beef cows differing in phenotypic residual feed intake offered grass silage. Journal of Animal Science. 2014; 92:2170–2181. doi: 10.2527/jas.2013-7438 [DOI] [PubMed] [Google Scholar]
10.Berry DP, Kearney JF. Imputation of genotypes from low- to high-density genotyping platforms and Implications for genomic selection. The Animal Consortium. 2011; 5:1162–1169. doi: 10.1017/S1751731111000309 [DOI] [PubMed] [Google Scholar]
11.VanRaden PM, Null DJ, Sargolzaei M, Wiggans GR, Tooker ME, Cole JB, et al. Genomic imputation and evaluation using high-density Holstein genotypes. Journal of Dairy Science. 2013; 96:668–678. doi: 10.3168/jds.2012-5702 [DOI] [PubMed] [Google Scholar]
12.Silva RM, Souza JC, Fernandes HJ, Abreu UGP, Ferraz Filho PB, Rosa AN. Eficiência produtiva ao desmame de vacas Nelore criadas no Pantanal. Arquivos Brasileiros de Medicina Veterinária e Zootecnia. 2015; 67:1105–1110. doi: 10.1590/1678-4162-6909 [DOI] [Google Scholar]
13.Beef Improvement Federation. Guidelines for uniform beef improvement programs. 2010; 9:1–183. [Google Scholar]
14.AOAC—Association of Official Analytical Chemists. Official Methods of Analysis. 1990; 15th ed. [Google Scholar]
15.Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. Journal of Dairy Science. 1991; 74:3583–3597. doi: 10.3168/jds.S0022-0302(91)78551-2 [DOI] [PubMed] [Google Scholar]
16.Licitra G, Hernandez TM, Van Soest PJ. Standardization of procedures for nitrogen fraction of ruiminant feeds. Animal Feed Science and Technology. 1996; 57:347–358. doi: 10.1016/0377-8401(95)00837-3 [DOI] [Google Scholar]
17.Goering HK, Van Soest PJ. Forage fiber Analysis: apparatus reagents, procedures and some applications. Agricultural Handbook. 1970; 18:379. [Google Scholar]
18.Van Soest PJ, Robertson JB. Analysis of forages and fibrous foods. Cornel University. 1985; p.202. [Google Scholar]
19.Weiss WP, Conrad HR, Shockey WL. Predicting digestible protein using acid detergent insoluble nitrogen. Journal of Dairy Science. 1983; 66:192. [Google Scholar]
20.Rosa AN, Silva LOC, Nobre PRC. Avaliação do desempenho de animais Nelore em controle de desenvolvimento ponderal no Estado de Mato Grosso do Sul. Revista da Sociedade Brasileira de Zootecnia. 1986; 15:515–532. [Google Scholar]
21.Pluske JR, Thompson MJ, Atwood CS, Bird PH, Williams IH, Hartmann PE. Maintenance of villus height and crypt depth, and enhancement of disaccharide digestion and monosaccharide absorption, in piglets fed on cows’ whole milk after weaning. British Journal of Nutrition. 1996; 76:409–422. doi: 10.1079/bjn19960046 [DOI] [PubMed] [Google Scholar]
22.Teixeira PD, Oliveira DM, Chizzotti ML, Chalfun-Junior A, Coelho TC, Gionbelli MP, et al. Subspecies and diet affect the expression of genes involved in lipid metabolism and chemical composition of muscle in beef cattle. Meat Science. 2017; 133, 110–118. doi: 10.1016/j.meatsci.2017.06.009 [DOI] [PubMed] [Google Scholar]
23.Oliveira DM, Chalfun-Junior A, Chizzotti ML, Barreto HG, Coelho TC, Paiva LV, et al. Expression of genes involved in lipid metabolism in the muscle of beef cattle fed soybean or rumen-protected fat, with or without monensin supplementation. Journal of Animal Science. 2014; 92, 5426–5436. doi: 10.2527/jas.2014-7855 [DOI] [PubMed] [Google Scholar]
24.Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research. 2001; 29:2003–2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Arthur JPF, Herd RM. Residual feed intake in beef cattle. Revista Brasileira de Zootecnia. 2008; 37:269–279. doi: 10.1590/S1516-35982008001300031 [DOI] [Google Scholar]
26.Black TE, Bischoff KM, Mercadante VRG, Marquezini GHL, DiLorenzo N, Chase CC Jr, et al. Relationship among performance, residual feed intake, and temperament assessed in growing beef heifers and subsequently as 3-year-old, lactating beef cows. Journal of Animal Science. 2013; 91:2256–2263. doi: 10.2527/jas2012-5242 [DOI] [PubMed] [Google Scholar]
27.Souza LL, Zorzetto MF, Ricci TJT, Canesin RC, Silva NCD, Negrão JA, et al. Relationship between performance, metabolic profile, and feed efficiency of lactating beef cows. Tropical Animal Health and Production. 2019; 51:2045–2055. doi: 10.1007/s11250-019-01906-1 [DOI] [PubMed] [Google Scholar]
28.Barros LV, Paulino MF, Chizzotti ML, Rennó LN, Cardenas JEG, Valente EEL, et al. Suplementação de bezerras de corte lactentes em sistema de creep-feeding e parâmetros nutricionais e produtivos de vaca de corte em pastejo. Semina: Ciências Agrárias. 2014; 35:2723–2738. doi: 10.5433/1679-0359.2014v35n4Suplp2723 [DOI] [Google Scholar]
29.Larson DM, Martin JL, Adams DC, Funston RN. Winter grazing system and supplementation during late gestation influence performance of beef cows and steer progeny. Journal of Animal Science. 2015; 87:1147–1155. doi: 10.2527/jas.2008-1323 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Radunz AE, Fluharty FL, Relling AE, Felix TL, Shoup LM, Zerby HN, et al. Prepartum dietary energy source fed to beef cows: II. Effects on progeny postnatal growth, glucose tolerance, and carcass composition. Journal of Animal Science. 2015; 90:4962–4974. doi: 10.2527/jas2012-5098 [DOI] [PubMed] [Google Scholar]
31.Chmurzynska A. Fetal programming: link between early nutrition, DNA methylation, and complex diseases. Nutrition Reviews. 2010; 68:87–98. doi: 10.1111/j.1753-4887.2009.00265.x [DOI] [PubMed] [Google Scholar]
32.Bispham J, Gardner DS, Gnanalingham MG, Stephenson T, Symonds ME, Budge H. Maternal Nutritional Programming of Fetal Adipose Tissue Development: Differential Effects on Messenger Ribonucleic Acid Abundance for Uncoupling Proteins and Peroxisome Proliferator-Activated and Prolactin Receptors. Endocrinology. 2005; 146:3943–3949. doi: 10.1210/en.2005-0246 [DOI] [PubMed] [Google Scholar]
33.Michal JJ, Zhang ZW, Gaskins CT, Jiang Z. The bovine fatty acid binding protein4 gene is significantly associated with marbling and subcutaneous fat depth in Wagyu x Limousin F₂ crosses. Animal Genetics. 2006; 37:400–402. doi: 10.1111/j.1365-2052.2006.01464.x [DOI] [PubMed] [Google Scholar]
34.Pickworth CL, Loerch SC, Velleman SG, Pate JL, Poole DH, Fluharty FL. Adipogenic differentiation state-specific gene expression as related to bovine carcass adiposity. Journal of Animal Science. 2011; 89:355–366. doi: 10.2527/jas.2010-3229 [DOI] [PubMed] [Google Scholar]
35.Goldberg IJ, Soprano DR, Wyatt ML, Vanni TM, Kirchgessner TG, Schotz MC. Localization of lipoprotein lipase mRNA in selected rat tissues. Journal of Lipid Research. 1989; 30:1569–1618. doi: 10.1016/S0022-2275(20)38241-9 [DOI] [PubMed] [Google Scholar]
36.Goodarzi MO, Guo X, Taylor KD, Quiñones MJ, Saad MF, Yang H, et al. Lipoprotein lipase is a gene for insulin resistance in Mexican Americans. Diabetes. 2004; 53:214–221. doi: 10.2337/diabetes.53.1.214 [DOI] [PubMed] [Google Scholar]
37.Badaoui B, Serradilla JM, Tomàs A, Urrutia B, Ares JL, Carrizosa J, et al. Short Communication: Identification of two polymorphisms in the goat lipoprotein lipase gene and their association with milk production traits. Journal of Dairy Science. 2007; 90:3012–3017. doi: 10.3168/jds.2006-409 [DOI] [PubMed] [Google Scholar]
38.Dong GF, Zou Q, Wang H, Huang F, Liu XC, Chen L, et al. Conjugated linoleic acid differentially modulates growth, tissue lipid deposition, and gene expression. Involved in the lipid metabolism of grass carp. Aquaculture. 2014; 432:181–191. doi: 10.1016/j.aquaculture.2014.05.008 [DOI] [Google Scholar]
39.Gondret F, Hocquette JF. La teneur em lipides de la viande: une balance métabolique complexe. INRA Productions Animales. 2006; 5:327–338. doi: 10.20870/Productions-animales.2006.19.5.3499 [DOI] [Google Scholar]
40.Sampath H, Ntambi JM. Role of stearoyl-CoA desaturase-1 in skin integrity and whole-body energy balance. Journal of Biological Chemistry. 2014; 289:2482–2488. doi: 10.1074/jbc.R113.516716 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Taniguchi M, Utsugi T, Oyama K, Mannen H, Kobayashi M, Tanabe Y, et al. Genotype of stearoyl-CoA desaturase is associated with fatty acid composition in Japanese Black cattle. Mammalian Genome. 2004; 14:142–148. doi: 10.1007/s00335-003-2286-8 [DOI] [PubMed] [Google Scholar]
42.Macciotta NPP, Mele M, Conte G, Serra A, Cassandro M, Dal Zotto R, et al. Association between a polymorphism at the stearoyl CoA desaturase locus and milk production traits in Italian Holsteins. Journal of Dairy Science. 2008; 91:3184–3189. doi: 10.3168/jds.2007-0947 [DOI] [PubMed] [Google Scholar]
43.Wakil SJ. Fatty acid synthase, a proficient multifunctional enzyme. Biochemistry. 1989; 28:4523–4530. doi: 10.1021/bi00437a001 [DOI] [PubMed] [Google Scholar]
44.Roy R, Taourit S, Zaragoza P, Eggen A, Rodellar C. Genomic structure and alternative transcript of bovine fatty acid synthase gene (FASN): comparative Analysis of the FASN gene between monogastric and ruminant species. Cytogenetic and Genome Research. 2005; 111:65–73. doi: 10.1159/000085672 [DOI] [PubMed] [Google Scholar]
45.Du M, Ford SP, Zhu MJ. Optimizing livestock production efficiency through maternal nutritional management and fetal developmental programming. Animal Frontiers. 2017; 7, 5–11. doi: 10.2527/af.2017-0122 [DOI] [Google Scholar]
46.Kim JB, Spiegelman BM. ADD1/SREBP1 promotes adipocyte differentiation and gene expression linked to fatty acid metabolism. Genes & Development. 1996; 10, 1096–1107. doi: 10.1101/gad.10.9.1096 [DOI] [PubMed] [Google Scholar]
47.Ladeira MM, Schoonmaker JP, Gionbelli MP, Dias J, Gionbelli TRS, Carvalho JRR, et al. Nutrigenomics and Beef Quality: A Review about Lipogenesis. International Journal of Molecular Science. 2016; 17, 918. doi: 10.3390/ijms17060918 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Bateman ME, Strong AL, McLachlan JA, Burow ME, Bunnell BA. The effects of endocrine disruptors on adipogenesis and osteogenesis in mesenchymal stem cells: a review. Frontiers in Endocrinology. 2017; 7:171. doi: 10.3389/fendo.2016.00171 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.del Pino LM, Arana A, Alfonso L, Mendizábal JA, Soret B. Adiposity and adipogenic gene expression in four different muscles in beef cattle. PloS One. 2017; 12, e0179604. doi: 10.1371/journal.pone.0179604 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0272236.r001

Decision Letter 0

Marcio Duarte

7 Feb 2022

PONE-D-21-37544Performance and muscle lipogenesis in offspring of Nellore cows of different residual feed intake classesPLOS ONE

Dear Dr. Bonilha,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Mar 24 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Marcio Duarte, PhD

Academic Editor

PLOS ONE

Journal Requirements:1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Methods section, please include a comment about the state of the animals following this research. Were they euthanized or housed for use in further research? If any animals were sacrificed by the authors, please include the method of euthanasia and describe any efforts that were undertaken to reduce animal suffering.

3. Thank you for stating in your Funding Statement:

(This work was supported by São Paulo

Research Foundation (FAPESP): grant #2017/06709-2 provided to SFMB; and #2018/20080-2 provided to CDAB.

This work was also supported by Coordination for the Improvement of Higher Education Personnel (CAPES, Finance Code 001), providing grant to ACARP.

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.)

Please provide an amended statement that declares *all* the funding or sources of support (whether external or internal to your organization) received during this study, as detailed online in our guide for authors at http://journals.plos.org/plosone/s/submit-now. Please also include the statement “There was no additional external funding received for this study.” in your updated Funding Statement.

Please include your amended Funding Statement within your cover letter. We will change the online submission form on your behalf.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Overall considerations: This study evaluates the effects of maternal RFI classification on calf gene expression and growth performance. This reviewer believes authors should pay close attention to the statistical analyses, description of methods, and writing style. The manuscript is lacking flow. For example, introduction does not address well the research project and the abstract does not reflect the studies performed. It does not mention that 2 separately studies were conducted. Regarding the statistics, for instance, AI is included in the fixed model when it was not supposed to be since researchers were not testing different protocols. In fact, the AI protocol was the same for every cow, including the sire used. Therefore, no needed to be included in the fixed model. This reviewer thinks that both experiments should be analyzed as a single project, generating the interaction between feeding system x RFI. For the calf data, sex was included in the fixed term, why an interaction was not tested then (maternal RFI|SEX)? P-values for sex or AI were not even reported even though they were in the fixed model. The gene expression data could have been analyzed as a repeated measure, therefore, conclusion could be drawn when comparing the pre-weaning vs. post-weaning values. The introduction section can be improved by stating why testing different feeding systems are needed. It would justify the 2 experiments. Materials and methods are missing important information about animals/pen, days of the experiment and so on. Table 5 is not needed and could be removed from the manuscript. English/written style could be improved. This reviewer suggests authors to improve the writing style, table descriptions, and statistics analyses. Some other detailed information can be found below.

Title: This reviewer suggests changing the title to: “Performance and muscle lipogenesis of calves born to Nellore cows with different residual feed intake classification”.

Introduction does not address why authors were testing 2 systems (grazing and feedlot/dry lot pen). Why was that tested?

Line 16: Replace to “This study aimed to evaluate the relationship among maternal residual feed intake (RFI) with growth performance and expression of genes involved in lipid metabolism in the offspring.

Line 18: Replace to “Fifty-two cows previously classified as negative or positive RFI by genomic prediction were exposed to fixed-time artificial insemination (FTAI) protocols at 2 and 3 years of age using semen from the same bull.

Line 21: Feedlot or drylot pens?

Line 22: “Cows were weighed every 28 days” for how long?

Line 23 and 24: When?

Line 23 to 25: Sentences could be improved.

Line 25: Why analyzed by experiment? It was never mentioned in the abstract there is more than one study.

Line 26: Year needs to be in the model (if experiment was repeated within years. This information is not clear though).

Line 27: To know if there is an effect of year, it needs to be in the fixed model. According to line 26, year is not in the model. Please, address this discrepancy.

Line 27: Growth, reproductive performance?

Line 31: It seems that the data was analyzed separately. Why?

Line 42 to 43: Poor sentence. It can be more knowledgeable.

Line 46 to 38: Needs to be rewritten. Because of the low nutrient availability?

Line 51: Replace to “can result in impaired growth rates…”

Line 56: and enhance sustainability of production systems.

Line 67: Are authors referring to replacement heifers?

Introduction: This reviewer thinks that in the introduction more information on lipid metabolism needs to be added. For instance, why is your research focused on lipid metabolism?

Line 82: were conducted at the…

Line 95 and 96: How above and below the average. Suggest adding the SD used.

Line 102: Add the days of the experiment (d 0, d 28..)

Were the AI different form exp 1 to exp 2? Details on them and add BW of cows and age in days. How were the cows weighed? Shrunk?

Line 116: The calves were weight at birth and the birth weight was recorded. Suggest changing this sentence.

Line 118 to 120: The weight at 120 days of age (W120) was calculated from the birth weight and weight gain until days of age. Similarly, the weight at 210 days of age (W210) was calculated from the birth weight and weight gain until 210 days of age. The weight or ADG? Authors weighted cattle, so why was weight calculated?

Line 126: Were all the cows in the same pasture?

Line 133: Why were the forage samples divided and only the leaves analyzed? Cows also consume some roots, stem and so on. Hand samples should be collected in a way to represent what is consumed.

149: This methodology does not seem okay because forage mass in one part of the pasture may not be the same in the other area. To estimate forage mass, it is more common to use regression equation using the double sampling technique. Forage availability was calculated as the amount of forage, in kg DM, available 150 within 1 m2 multiplied by 10,000 m2.

150: Why during the second trimester?

Cows were grazing a pasture with less than 6% of CP. No supplementation was provided?

Line 155: How many pens?

Line 168 to 170: This sentence needs to be rewritten. It is not clear.

Line 176: Cow-calf pairs

Line 193: Where is this equation from? Citation needed.

Line 279: Why the P-value is different for gene expression?

Why is the AI in the fixed model? Where the protocols different both experiments? What were the random effects? Why if sex is the fixed term for calf variables why it is not interacting with each other (RFI|SEX)?

297: Deducted instead of deduced?

Why to have a descriptive table?

Table 6: Needs more information. For example, how long was this DMI measured in calves (pre-weaning or post-weaning). Those details need to be in the table.

Reviewer #2: Ms. Ref. No.: PONE-D-21-37544

Title: Performance and muscle lipogenesis in offspring of Nellore cows of different residual feed intake classes

Overview:

This study evaluated cow-calf pairs until weaning in two experiments. Cows with different RFI and different production systems were evaluated. Animal performance and gene expression was used to assessed.

Major comments:

My major consideration in this study is the potential carry-over effect of the higher weight of the cows in the second experiment compared to the first. Although cows were managed with the calves under grazing conditions in the second experiment, body weight could partly compensate nutrition for gestation. This needs to be addressed in the ‘discussion’ section.

Please, provide how ADG was calculated for each animal category.

Please, improve the resolution of figures.

Minor comments:

L056: the citation is incorrect;

L072: the citation is incorrect;

L075-079: in my opinion, the hypothesis and the objectives are somewhat disconnected, especially with the sentence ‘genes related to lipid metabolism’;

L082: ‘conducted at Centro’ instead of ‘conducted Centro’;

L093: provide the country of the company. Please correct this throughout the text;

L107: muscle nomenclature is incorrect;

L108: please provide information of the manufacturer;

L116: ‘The calves were weighed’ instead of ‘The calves were weight’;

L120-121: provide a mean number with standard deviation for calves’ weaning;

L129-130: provide information on how the area was sampled, e.g. which height off the ground, etc.;

L141: the citation is incorrect;

L143: the citation is incorrect;

L144: the citation is incorrect;

L147: the citation is incorrect;

L158: provide the country of the company;

L201: muscle nomenclature is incorrect;

L208: ‘obtain’ instead of ‘obtained’;

L209: ‘sutured’ instead of ‘closed’;

L210: ‘few days’ is not scientific. Please, be assertive;

L216: muscle nomenclature is incorrect;

L236: ‘totaling’ instead of ‘total’;

L237: the citation is incorrect;

L263: the citation is incorrect;

L264: the citation is incorrect;

L355: muscle nomenclature is incorrect;

L355: ‘from’ instead of ‘to’;

L374: I do not understand what authors mean with this;

L382: muscle nomenclature is incorrect;

L383: ‘from’ instead of ‘to’;

L383: avoid terms such as ‘very important’;

L393: include a reference to support the affirmation;

L394: the citation is incorrect;

L401: the citation is incorrect;

L401-403: rewrite this sentence;

L403: why were you RFI variation lower compared to these other studies? Breed, animals’ weight, and diet were similar?

L403: the citation is incorrect;

L413: the citation is incorrect;

L418-420: what about the physiological differences between cows?;

L426: the citation is incorrect;

L426-427: what were the conditions of the experiment compared to this study?;

L439: the citation is incorrect;

L443: the citation is incorrect;

L444: ‘from’ instead of ‘to’;

L450: the citation is incorrect;

L455: the citation is incorrect;

L466: the citation is incorrect;

L473: avoid terms such as ‘extremely important’;

L512: ‘global’ instead of ‘national’;

L554: avoid using references which are not in English;

L564: check the references. For example, the journal in the citation is not abbreviated.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Rodolpho Martin do Prado

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Jul 29;17(7):e0272236. doi: 10.1371/journal.pone.0272236.r002

Author response to Decision Letter 0

13 Apr 2022

Dear Dr. Marcio Duarte,

We appreciated all the efforts you and the reviewers made to improve the quality of this manuscript. In the document attached are the responses for each comment and suggestion made. The changes in the text are highlighted using Word track changes tool in marked-up copy.

Thanks a lot,

The authors

Attachment

Submitted filename: Paz et al 2022_responses to reviewers.docx

Click here for additional data file.^{(33.1KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0272236.r003

Decision Letter 1

Marcio Duarte

27 May 2022

PONE-D-21-37544R1Performance and muscle lipogenesis of calves born to Nellore cows with different residual feed intake classificationPLOS ONE

Dear Dr. Bonilha,

Please submit your revised manuscript by June 10th. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Marcio Duarte, PhD

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: (No Response)

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #2: Yes

Reviewer #3: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

Reviewer #3: I Don't Know

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #2: Yes

Reviewer #3: No

**********

6. Review Comments to the Author

Reviewer #2: Ms. Ref. No.: PONE-D-21-37544R1

Title: Performance and muscle lipogenesis in offspring of Nellore cows of different residual feed intake classes

Major comments:

The manuscript has improved from its early version. However, several issues are pending, some more were raised, and some comments were not addressed at all. For example, the resolution of figures is still the same.

Minor comments:

L019: fifty-two, or fifty-three? Check L094;

L020: it is important to state that two FTAI protocol were used;

L024-25: check this sentence;

L059: there are several entries for ‘body weight’, thus I suggest abbreviating it;

L072: although it was changed, the phrase ‘Results showed that’ could be improved;

L101-106: the manuscript would benefit if authors could clarify as to why three extra cows were added in the second year of the experiment, and also if the 25 cows were all used in the second year;

L129: ‘(i.e. LEA, BF, and RF)’ instead of ‘(LEA, BF, and RF)’;

L133: ‘During pregnancy of year 1’ instead of ‘During pregnancy’;

L133-134: include the pasture management regimen, area and other relevant information, such as fertilization. Also, I suggest clarifying if all cows were kept in the same paddock;

L145: my previous request as completely overlooked, which is frustrating. Provide the country of the company. Please correct this throughout the text;

L145-154: the citations in this paragraph are mostly incorrect. Authors have modified them in the current version, but they are still incorrect;

L146: the numeral should have one space of the degree symbol;

L150: ‘ash’ instead of ‘ashes’;

L155: the term ‘in kg DM’ is incorrect;

L157: ‘t DM/ha’ is incorrect;

L165: provide the full list of information for the system;

L168: how was feed offering adjusted daily if leftovers were not evaluated daily?;

L171: ‘for the leaf fraction’ instead of ‘in the previous item’;

L184: be specific and modify ‘in the previous item’;

L187-191: include the pasture management regimen, area and other relevant information, such as fertilization;

L196: ‘t DM/ha’ is incorrect;

L208: indicate right side of what;

L251: if the work is not published, do not use it as literature, as it was not peer reviewed;

L260: the numeral should have one space of the degree symbol;

L267: if the work is not published, do not use it as literature, as it was not peer reviewed. Furthermore, the text is in a language other than English, which does not fit as a reference for the methodological part of the study;

L345-347: the difference was only for the FABP4 gene, and the others had a tendency. The sentence should be rewritten;

L402-403: the referencing in this sentence is odd;

L415: ‘interferes’ instead of ‘interfere’;

Figure 1: ‘Percent’ instead of ‘Porcent’;

Figure 1: ‘SCD1’ instead of ‘SCD’;

Figure 2: ‘SCD1’ instead of ‘SCD’.

Reviewer #3: This manuscript presents the results from two studies/years conducted to evaluate the effect of maternal RFI on calves’ performance and muscle gene expression. One of the limitations of this study is that the groups of cows were very similar in terms of RFI and the authors observed only a trend for this trait as well as the variables evaluated on claves. I am not convinced that the data was analyzed in the best way. Authors should describe better why FTAI was included in the model. The manuscript language is understandable, but it could be improved.

Overall questions:

1. Was the same group of cows used in both years? Should we consider these as two different experiments or the same experiment repeated for two consecutive years?

2. How can the authors justify the lack of differences between groups for RFI?

Specific comments:

L. 25 – carcass?

L. 25-26 . “Muscle gene expression was evaluated in calves at birth and weaning”

L. 27- Why FTAI is a factor? Was it different?

L. 28-29 – “There was no effect of maternal RFI on calves ADG in the first year.”

L. 36-38 – This conclusion sentence could be more specific to the current study

Introduction – The sentences could be more connected making the text more pleasant to read. I think the introduction could bring some information regarding the heritability of RFI and other characteristics evaluated in this study.

L. 49-50. “received and recorded by the genome” I think this sentence is strange. Please review it.

L.54-56 – This is a long and wordy sentence.

L. 61-65 . Again this is a long sentence and hard to follow. Please review it.

L.96-97. How good is this genomic prediction? Was the RFI evaluated or only predicted?

L. 109 – Ribeye area (REA) and backfat thickness (BFT) is more commonly used for cattle.

L. 113-114. Please, provide more details regarding the equipment and probe used as well as the technician's ability and/or certification to collect and analyze the images.

L. 135. Why not all gestation or the last two trimesters of gestation?

L. 171- Please reword this sentence removing “previous item”

L. 184. Please, be more specific here. What do you mean by “previous item”

Table 1 and 3. Would be possible to concatenate table 1 and 3? DM and TDN are as a % of what?

L. 213- Please delete “An”

L. 217. I suggest deleting “was complete”

L. 220-224. Where were these muscle samples removed from?

L. 228 – What was done with these samples?

L. 275- Again, why FTAI is a factor? Was it different?

L. 275. In my opinion, calves and cow BW should be evaluated as repeated measures.

L. 278. I couldn’t understand it. All data was not normally distributed?

L. 300. Did you evaluate fetal weight?

L. 332- “efficient”

Figures. Please review the axis label “porcent”

Table 7. Where is the DMI data for cows?

L. 400-402. Where is this data? Table 6 is showing a 0.1kg difference for year 1.

L. 400-407. So, how about the current study? Why the difference was so small and only tended to differ?

L. 422 – I think “weaning efficiency” would be a better term than “productive efficiency”. Please consider replacing it across the manuscript.

L. 428-433. This sentence is too long and confusing. Please rephrase it.

L. 444 – These are not body composition data. Please review it throughout the manuscript.

L.471. delete enzyme or protein. It is redundant

L. 488-489. I am not sure if this sentence is accurate. In my understanding, adipogenesis occurs throughout the animal’s life. Please review this sentence.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

Reviewer #3: No

PLoS One. 2022 Jul 29;17(7):e0272236. doi: 10.1371/journal.pone.0272236.r004

Author response to Decision Letter 1

11 Jul 2022

We appreciated all the efforts the editor and the reviewers made to improve the quality of this manuscript. In the attached file are the responses for each comment and suggestion made. Thank you.

Attachment

Submitted filename: Paz et al 2022_responses to reviewers.docx

Click here for additional data file.^{(30.3KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0272236.r005

Decision Letter 2

Marcio Duarte

15 Jul 2022

Performance and muscle lipogenesis of calves born to Nellore cows with different residual feed intake classification

PONE-D-21-37544R2

Dear Dr. Bonilha,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Marcio Duarte, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

All changes were greatly addressed. The manuscript is now ready for publication.

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0272236.r006

Acceptance letter

Marcio Duarte

21 Jul 2022

PONE-D-21-37544R2

Performance and muscle lipogenesis of calves born to Nellore cows with different residual feed intake classification

Dear Dr. Figueiredo Martins Bonilha:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Marcio Duarte

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Genetic value for RFI from the entire Nellore progeny group born in 2014 at Instituto de Zootenia.

(DOCX)

Click here for additional data file.^{(41.1KB, docx)}

S2 Fig. Experimental cow-calf pairs performance data.

(DOCX)

Click here for additional data file.^{(44.9KB, docx)}

Attachment

Submitted filename: Paz et al 2022_responses to reviewers.docx

Click here for additional data file.^{(33.1KB, docx)}

Attachment

Submitted filename: Paz et al 2022_responses to reviewers.docx

Click here for additional data file.^{(30.3KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting information files.

[pone.0272236.ref001] 1.Meyer AM, Reed JJ, Vonnahme KA, Soto-Navarro SA, Reynolds LP, Ford SP, et al. Effects of stage of gestation and nutrient restriction during Early tom id-gestation on maternal and fetal visceral organ mass and indices of jejunal growth and vascularity in beef cows. Journal of Animal Science. 2014; 88:2410–2424. doi: 10.2527/jas.2009-2220 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref002] 2.Robinson DL, Oddy VH, Smith C. Preliminary genetic parameters for feed intake and efficiency in feedlot cattle. Procedings: Association for the Advancement of Animal Breeding and Genetics. 1999; 13. [Google Scholar]

[pone.0272236.ref003] 3.Du M, Tong J, Zhao J, Underwood KR, Zhu M, Ford SP, et al. Fetal programming of skeletal muscle Development in ruminant animals. Journal of Animal Science. 2009; 88:E51–E60. doi: 10.2527/jas.2009-2311 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref004] 4.Funston RN, Larson DM, Vonnahme KA. Effects of maternal nutrition on conceptus growth and offspring performance: Implications for beef cattle production. Journal of Animal Science. 2010; 88:E205–E215. doi: 10.2527/jas.2009-2351 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref005] 5.Wu G, Bazer FW, Wallace JM, Spencer TE. Board-Invited Review: Intrauterine growth retardation: Implications for the animal sciences. Journal of Animal Science. 2006; 84:2316–2337. doi: 10.2527/jas.2006-156 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref006] 6.Koch RM, Swiger LA, Chambers D, Gregory KE. Efficiency of feed use in beef cattle. Journal of Animal Science. 1963; 22:486–494. [Google Scholar]

[pone.0272236.ref007] 7.Menezes ACB, Valadares SC, Benedeti PDB, Zanetti D, Paulino MF, Silva FF, et al. Feeding behavior, water intake, and energy and protein requirements of young Nellore bulls with different residual feed intakes. Journal of Animal Science. 2020; 98(9). doi: 10.1093/jas/skaa279 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0272236.ref008] 8.Ferrell CL, Jenkins TG. Energy utilization by mature, nonpregnant, nonlactating cows of different types. Journal of Animal Science. 1984; 58(1). doi: 10.2527/jas1984.581234x [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref009] 9.Fitzsimons C, Kenny DA, Fahey AG, McGee M. Feeding behavior, ruminal fermentation, and performance of pregnant beef cows differing in phenotypic residual feed intake offered grass silage. Journal of Animal Science. 2014; 92:2170–2181. doi: 10.2527/jas.2013-7438 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref010] 10.Berry DP, Kearney JF. Imputation of genotypes from low- to high-density genotyping platforms and Implications for genomic selection. The Animal Consortium. 2011; 5:1162–1169. doi: 10.1017/S1751731111000309 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref011] 11.VanRaden PM, Null DJ, Sargolzaei M, Wiggans GR, Tooker ME, Cole JB, et al. Genomic imputation and evaluation using high-density Holstein genotypes. Journal of Dairy Science. 2013; 96:668–678. doi: 10.3168/jds.2012-5702 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref012] 12.Silva RM, Souza JC, Fernandes HJ, Abreu UGP, Ferraz Filho PB, Rosa AN. Eficiência produtiva ao desmame de vacas Nelore criadas no Pantanal. Arquivos Brasileiros de Medicina Veterinária e Zootecnia. 2015; 67:1105–1110. doi: 10.1590/1678-4162-6909 [DOI] [Google Scholar]

[pone.0272236.ref013] 13.Beef Improvement Federation. Guidelines for uniform beef improvement programs. 2010; 9:1–183. [Google Scholar]

[pone.0272236.ref014] 14.AOAC—Association of Official Analytical Chemists. Official Methods of Analysis. 1990; 15th ed. [Google Scholar]

[pone.0272236.ref015] 15.Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. Journal of Dairy Science. 1991; 74:3583–3597. doi: 10.3168/jds.S0022-0302(91)78551-2 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref016] 16.Licitra G, Hernandez TM, Van Soest PJ. Standardization of procedures for nitrogen fraction of ruiminant feeds. Animal Feed Science and Technology. 1996; 57:347–358. doi: 10.1016/0377-8401(95)00837-3 [DOI] [Google Scholar]

[pone.0272236.ref017] 17.Goering HK, Van Soest PJ. Forage fiber Analysis: apparatus reagents, procedures and some applications. Agricultural Handbook. 1970; 18:379. [Google Scholar]

[pone.0272236.ref018] 18.Van Soest PJ, Robertson JB. Analysis of forages and fibrous foods. Cornel University. 1985; p.202. [Google Scholar]

[pone.0272236.ref019] 19.Weiss WP, Conrad HR, Shockey WL. Predicting digestible protein using acid detergent insoluble nitrogen. Journal of Dairy Science. 1983; 66:192. [Google Scholar]

[pone.0272236.ref020] 20.Rosa AN, Silva LOC, Nobre PRC. Avaliação do desempenho de animais Nelore em controle de desenvolvimento ponderal no Estado de Mato Grosso do Sul. Revista da Sociedade Brasileira de Zootecnia. 1986; 15:515–532. [Google Scholar]

[pone.0272236.ref021] 21.Pluske JR, Thompson MJ, Atwood CS, Bird PH, Williams IH, Hartmann PE. Maintenance of villus height and crypt depth, and enhancement of disaccharide digestion and monosaccharide absorption, in piglets fed on cows’ whole milk after weaning. British Journal of Nutrition. 1996; 76:409–422. doi: 10.1079/bjn19960046 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref022] 22.Teixeira PD, Oliveira DM, Chizzotti ML, Chalfun-Junior A, Coelho TC, Gionbelli MP, et al. Subspecies and diet affect the expression of genes involved in lipid metabolism and chemical composition of muscle in beef cattle. Meat Science. 2017; 133, 110–118. doi: 10.1016/j.meatsci.2017.06.009 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref023] 23.Oliveira DM, Chalfun-Junior A, Chizzotti ML, Barreto HG, Coelho TC, Paiva LV, et al. Expression of genes involved in lipid metabolism in the muscle of beef cattle fed soybean or rumen-protected fat, with or without monensin supplementation. Journal of Animal Science. 2014; 92, 5426–5436. doi: 10.2527/jas.2014-7855 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref024] 24.Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research. 2001; 29:2003–2007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0272236.ref025] 25.Arthur JPF, Herd RM. Residual feed intake in beef cattle. Revista Brasileira de Zootecnia. 2008; 37:269–279. doi: 10.1590/S1516-35982008001300031 [DOI] [Google Scholar]

[pone.0272236.ref026] 26.Black TE, Bischoff KM, Mercadante VRG, Marquezini GHL, DiLorenzo N, Chase CC Jr, et al. Relationship among performance, residual feed intake, and temperament assessed in growing beef heifers and subsequently as 3-year-old, lactating beef cows. Journal of Animal Science. 2013; 91:2256–2263. doi: 10.2527/jas2012-5242 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref027] 27.Souza LL, Zorzetto MF, Ricci TJT, Canesin RC, Silva NCD, Negrão JA, et al. Relationship between performance, metabolic profile, and feed efficiency of lactating beef cows. Tropical Animal Health and Production. 2019; 51:2045–2055. doi: 10.1007/s11250-019-01906-1 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref028] 28.Barros LV, Paulino MF, Chizzotti ML, Rennó LN, Cardenas JEG, Valente EEL, et al. Suplementação de bezerras de corte lactentes em sistema de creep-feeding e parâmetros nutricionais e produtivos de vaca de corte em pastejo. Semina: Ciências Agrárias. 2014; 35:2723–2738. doi: 10.5433/1679-0359.2014v35n4Suplp2723 [DOI] [Google Scholar]

[pone.0272236.ref029] 29.Larson DM, Martin JL, Adams DC, Funston RN. Winter grazing system and supplementation during late gestation influence performance of beef cows and steer progeny. Journal of Animal Science. 2015; 87:1147–1155. doi: 10.2527/jas.2008-1323 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0272236.ref030] 30.Radunz AE, Fluharty FL, Relling AE, Felix TL, Shoup LM, Zerby HN, et al. Prepartum dietary energy source fed to beef cows: II. Effects on progeny postnatal growth, glucose tolerance, and carcass composition. Journal of Animal Science. 2015; 90:4962–4974. doi: 10.2527/jas2012-5098 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref031] 31.Chmurzynska A. Fetal programming: link between early nutrition, DNA methylation, and complex diseases. Nutrition Reviews. 2010; 68:87–98. doi: 10.1111/j.1753-4887.2009.00265.x [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref032] 32.Bispham J, Gardner DS, Gnanalingham MG, Stephenson T, Symonds ME, Budge H. Maternal Nutritional Programming of Fetal Adipose Tissue Development: Differential Effects on Messenger Ribonucleic Acid Abundance for Uncoupling Proteins and Peroxisome Proliferator-Activated and Prolactin Receptors. Endocrinology. 2005; 146:3943–3949. doi: 10.1210/en.2005-0246 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref033] 33.Michal JJ, Zhang ZW, Gaskins CT, Jiang Z. The bovine fatty acid binding protein4 gene is significantly associated with marbling and subcutaneous fat depth in Wagyu x Limousin F₂ crosses. Animal Genetics. 2006; 37:400–402. doi: 10.1111/j.1365-2052.2006.01464.x [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref034] 34.Pickworth CL, Loerch SC, Velleman SG, Pate JL, Poole DH, Fluharty FL. Adipogenic differentiation state-specific gene expression as related to bovine carcass adiposity. Journal of Animal Science. 2011; 89:355–366. doi: 10.2527/jas.2010-3229 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref035] 35.Goldberg IJ, Soprano DR, Wyatt ML, Vanni TM, Kirchgessner TG, Schotz MC. Localization of lipoprotein lipase mRNA in selected rat tissues. Journal of Lipid Research. 1989; 30:1569–1618. doi: 10.1016/S0022-2275(20)38241-9 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref036] 36.Goodarzi MO, Guo X, Taylor KD, Quiñones MJ, Saad MF, Yang H, et al. Lipoprotein lipase is a gene for insulin resistance in Mexican Americans. Diabetes. 2004; 53:214–221. doi: 10.2337/diabetes.53.1.214 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref037] 37.Badaoui B, Serradilla JM, Tomàs A, Urrutia B, Ares JL, Carrizosa J, et al. Short Communication: Identification of two polymorphisms in the goat lipoprotein lipase gene and their association with milk production traits. Journal of Dairy Science. 2007; 90:3012–3017. doi: 10.3168/jds.2006-409 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref038] 38.Dong GF, Zou Q, Wang H, Huang F, Liu XC, Chen L, et al. Conjugated linoleic acid differentially modulates growth, tissue lipid deposition, and gene expression. Involved in the lipid metabolism of grass carp. Aquaculture. 2014; 432:181–191. doi: 10.1016/j.aquaculture.2014.05.008 [DOI] [Google Scholar]

[pone.0272236.ref039] 39.Gondret F, Hocquette JF. La teneur em lipides de la viande: une balance métabolique complexe. INRA Productions Animales. 2006; 5:327–338. doi: 10.20870/Productions-animales.2006.19.5.3499 [DOI] [Google Scholar]

[pone.0272236.ref040] 40.Sampath H, Ntambi JM. Role of stearoyl-CoA desaturase-1 in skin integrity and whole-body energy balance. Journal of Biological Chemistry. 2014; 289:2482–2488. doi: 10.1074/jbc.R113.516716 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0272236.ref041] 41.Taniguchi M, Utsugi T, Oyama K, Mannen H, Kobayashi M, Tanabe Y, et al. Genotype of stearoyl-CoA desaturase is associated with fatty acid composition in Japanese Black cattle. Mammalian Genome. 2004; 14:142–148. doi: 10.1007/s00335-003-2286-8 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref042] 42.Macciotta NPP, Mele M, Conte G, Serra A, Cassandro M, Dal Zotto R, et al. Association between a polymorphism at the stearoyl CoA desaturase locus and milk production traits in Italian Holsteins. Journal of Dairy Science. 2008; 91:3184–3189. doi: 10.3168/jds.2007-0947 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref043] 43.Wakil SJ. Fatty acid synthase, a proficient multifunctional enzyme. Biochemistry. 1989; 28:4523–4530. doi: 10.1021/bi00437a001 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref044] 44.Roy R, Taourit S, Zaragoza P, Eggen A, Rodellar C. Genomic structure and alternative transcript of bovine fatty acid synthase gene (FASN): comparative Analysis of the FASN gene between monogastric and ruminant species. Cytogenetic and Genome Research. 2005; 111:65–73. doi: 10.1159/000085672 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref045] 45.Du M, Ford SP, Zhu MJ. Optimizing livestock production efficiency through maternal nutritional management and fetal developmental programming. Animal Frontiers. 2017; 7, 5–11. doi: 10.2527/af.2017-0122 [DOI] [Google Scholar]

[pone.0272236.ref046] 46.Kim JB, Spiegelman BM. ADD1/SREBP1 promotes adipocyte differentiation and gene expression linked to fatty acid metabolism. Genes & Development. 1996; 10, 1096–1107. doi: 10.1101/gad.10.9.1096 [DOI] [PubMed] [Google Scholar]

[pone.0272236.ref047] 47.Ladeira MM, Schoonmaker JP, Gionbelli MP, Dias J, Gionbelli TRS, Carvalho JRR, et al. Nutrigenomics and Beef Quality: A Review about Lipogenesis. International Journal of Molecular Science. 2016; 17, 918. doi: 10.3390/ijms17060918 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0272236.ref048] 48.Bateman ME, Strong AL, McLachlan JA, Burow ME, Bunnell BA. The effects of endocrine disruptors on adipogenesis and osteogenesis in mesenchymal stem cells: a review. Frontiers in Endocrinology. 2017; 7:171. doi: 10.3389/fendo.2016.00171 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0272236.ref049] 49.del Pino LM, Arana A, Alfonso L, Mendizábal JA, Soret B. Adiposity and adipogenic gene expression in four different muscles in beef cattle. PloS One. 2017; 12, e0179604. doi: 10.1371/journal.pone.0179604 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Performance and muscle lipogenesis of calves born to Nellore cows with different residual feed intake classification

Ana Carolina Almeida Rollo de Paz

Márcio Machado Ladeira

Priscilla Dutra Teixeira

Roberta Carrilho Canesin

Camila Delveaux Araujo Batalha

Maria Eugênia Zerlotti Mercadante

Sarah Figueiredo Martins Bonilha

Roles

Abstract

Introduction

Material and methods

Cows

Calves

Nutritional management: Year 1

Prenatal nutrition

Table 1. Chemical composition of the leaf fraction of the pasture available for cows during the second trimester of gestation.

Postnatal nutrition

Table 2. Nutritional composition of the diet offered to lactating cows and calves.

Nutritional management: Year 2

Prenatal nutrition

Postnatal nutrition

Table 3. Chemical composition of the leaf fraction of the pasture available for cows and calves during the lactation period.

Weaning efficiency

Muscle biopsy

Histological analysis

Gene expression

Table 4. Sequence (5’ to 3’) and efficiency of the primers used for qRT-PCR.

Statistical analysis

Results

Table 5. Descriptive statistics of the variables studied in Nellore cows and calves of Years 1 and 2.

Table 6. Performance of Nellore cows of different residual feed intake (RFI) classes during the second trimester of gestation and postnatal growth of their calves in Year 1.

Fig 1. Gene expression in Longissimus muscle of Nellore calves born to cows classified as positive (dotted line) and negative (columns) residual feed intake (RFI) in Year 1.

Table 7. Performance of Nellore cows of different residual feed intake (RFI) classes during the second trimester of gestation and postnatal growth of their calves in Year 2.

Fig 2. Gene expression in Longissimus muscle of Nellore calves born to cows classified as positive (dotted line) and negative (columns) residual feed intake (RFI) in Year 2.

Discussion

Conclusion

Supporting information

Data Availability

Funding Statement

References

Decision Letter 0

Marcio Duarte

Roles

Author response to Decision Letter 0

Decision Letter 1

Marcio Duarte

Roles

Author response to Decision Letter 1

Decision Letter 2

Marcio Duarte

Roles

Acceptance letter

Marcio Duarte

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases