Skip to main content
Animals : an Open Access Journal from MDPI logoLink to Animals : an Open Access Journal from MDPI
. 2022 Aug 1;12(15):1954. doi: 10.3390/ani12151954

KAT2B Gene Polymorphisms Are Associated with Body Measure Traits in Four Chinese Cattle Breeds

Xiaoding Lin 1, Bo Li 2, Yuhan Chen 1, Hong Chen 2,*, Mei Liu 1,*
Editors: Waiyee (Lloyd) Low, Guohua Hua
PMCID: PMC9367347  PMID: 35953943

Abstract

Simple Summary

Genetic improvement is one of the most important keys to overcoming the shortcomings of beef production. Identifying molecular markers related to growth characteristics and meat quality is significant in improving beef cattle breeds. Studies have shown that KAT2B, a transcriptional co-activator regulating the acetylation modification of histones, may be involved in the development and metabolism of muscle and adipose. However, there are no reports on investigating KAT2B genetic variation in Chinese native cattle. Firstly, this manuscript reports the initial bioinformatics analysis of KAT2B, finding that KAT2B protein is highly conserved among ruminants. The KAT2B gene expression profile in Qinchuan cattle was characterized, showing the spatiotemporal specificity of KAT2B gene expression in tissues such as adipose and liver during fetal and adult periods. Then, the investigation of KAT2B gene polymorphisms was carried out. Three SNPs of the KAT2B gene were identified and were found to be correlated with multiple body measurements in Fu, Qinchuan, Yak, and Chaidam cattle. These findings suggest that these three SNPs of KAT2B can serve as the molecular markers to select individuals for beef cattle breed improvement.

Abstract

Identifying molecular markers related to growth characteristics or meat quality is significant for improving beef cattle breeds. K(lysine) acetyltransferase 2B (KAT2B) is a transcriptional co-activator regulating the acetylation modification of histones, which may be involved in the development and metabolism of muscle and adipose. However, investigations of KAT2B genetic variations in Chinese native cattle are still limited. This study aimed to identify crucial single nucleotide polymorphisms (SNPs) influencing the body measurements of Chinese native cattle. Biological evolution and conservation analysis showed that KAT2B was highly conserved among the ruminants. By qPCR assay, KAT2B gene expression was found to be spatiotemporally specific in bovine tissues such as adipose and liver. By the RFLP-PCR method, three SNPs of KAT2B (g.T61908C, g.T62131C, and g.C73406T) were identified in 827 individuals of four Chinese cattle breeds, including Qinchuan (n = 658), Fu (n = 52), Yak (n = 48), and Chaidam (n = 69) cattle. Association analysis between these KAT2B polymorphisms and the body measurements of Chinese native cattle revealed significant observations. The genetic effects of g.T61908C, g.T62131C, and g.C73406T on the associated phenotypes were illustrated in each breed. In Qinchuan cattle, g.T62131C was significantly associated with better body height, chest width, hip width, and withers height, for which TC and/or TT were the advantageous genotype. In Fu cattle, TT genotype of g.T61908C was associated to better body length, while individuals with TT or CC of g.T62131C showed higher circumference of cannon bone than those with TC genotype. In Yak, individuals with TT genotype of g.C73406T had heavier body weight. In Chaidam cattle, TC genotype of g.C73406T was associated to superior body weight, while CC genotype of g.C73406T was associated to superior chest girth and circumference of cannon bone. These findings suggest that KAT2B gene polymorphisms can be used as the molecular markers for the early molecular marker-assisted selection in beef cattle breeding programs.

Keywords: KAT2B, SNP, cattle, body measure traits, association analysis

1. Introduction

China has a wealth of local cattle breeds, but most of them have obvious shortcomings in beef production, such as small body size, low growth rate, and low meat yield [1], which limit their use in industrial production and economic value. Most of the body measure traits are heritable to varying levels and have been widely reported in cattle. Among the factors contributing to the economic traits of livestock, genetic improvement is very crucial because genetic information is permanent and cumulative when inherited by subsequent generations [2]. DNA is inherited through generations by vertical transmission from parents to offspring and from ancestor to descendant species. Therefore, identifying the functional genes and their DNA genetic variation is very import for the beef cattle industry.

Molecular marker-assisted selection using SNPs is an effective means to improve livestock in modern animal breeding. It selects a phenotype based on a genotype tightly linked to the phenotype [3]. Early selective breeding based on genomics can increase the rate of genetic modification and reduces the cost of progeny testing [4,5,6]. Therefore, the selection of potential sites that affect the beef quality and yield has attracted widespread attention in cattle breeding [7]. Many SNPs and genes have been reported to be useful for breeding purposes in cattle [7]. However, only a few genes and QTLs (quantitative trait loci) have been determined for body measurements in Chinese cattle breeds [8]. An urgent need is to find more causal loci of cattle growth and beef characteristics, to facilitate the genetic improvement of Chinese native cattle breeds.

K(lysine) acetyltransferase 2B (KAT2B), also known as PCAF (p300/CBP-associated factor), is a transcriptional co-activator. It can bind histones and other proteins to form large protein complexes to regulate histone acetylation modification [9]. Studies have shown that KAT2B could dramatically reduce acetylation of H3K9 in mammalian cells [9,10]; and have functions in DNA replication and repair [11], cell cycle and death, actin-mediated cell contraction, protein transport, and regulation of centrosome duplication [12]. Moisa, S. J., et al. [13] found that the expression of KAT2B in the longissimus muscle had a time × feed treatment interaction during the development of Angus and Angus × Simmental steers, suggesting that KAT2B might be involved in cattle’s nutritional metabolism and growth. Furthermore, in our previous study, KAT2B was found to be significantly differentially expressed between the fetal and adult Qinchuan cattle, implying that it may be a candidate gene involved in bovine fat deposition [14]. However, up to now, there are no reports on investigating KAT2B genetic variation in Chinese native cattle. Thus, it is necessary to detect whether genetic variation in the KAT2B gene can affect the body measurements of Chinese native cattle.

This study first reports the initial bioinformatics analysis for biological evolution and conservation of KAT2B in different species. Then, the KAT2B gene expression profile was investigated in Qinchuan cattle. The detection of KAT2B gene polymorphisms was carried out in four Chinese native cattle breeds (Fu, Qinchuan, Yak, and Chaidam cattle). The association analysis between the candidate SNPs of the KAT2B gene and body measurements of those Chinese native cattle was performed in this study. Our findings provide novel molecular markers, the SNPs of the KAT2B gene, for Chinese beef cattle breeding.

2. Materials and Methods

2.1. Bioinformatics Analysis

The amino acid sequences of the KAT2B protein were downloaded from NCBI (https://www.ncbi.nlm.nih.gov/protein, accessed on 29 January 2022). Sequence alignment and phylogenetic tree of KAT2B protein forming were performed among different species, including Bos taurus (XP_024853358.1), Bos idicus (XP_019822500.1), Bos mutus (ELR48408.1), Capra hircus (XP_017908727.1), Ovis aries (XP_027817893.1), Bubalus bubalis (XP_025150061.1), Sus scrofa (XP_020927025.1), Homo sapiens (NP_003875.3), Rattus rattus (XP_032756718.1), Mus musculus (NP_001177775.1), and Gallus gallus (XP_040519860.1) by MEGA X 10.2.6 (Philadelphia, PA, USA) (https://www.megasoftware.net/, accessed on 21 February 2022) [15]. Aligning multiple sequences and forming a phylogenetic tree were performed by MUSCLE sequencing alignment and neighbor-joining (NJ) method, respectively [15]. To reveal the structural characteristics and functions of KAT2B proteins in the above 11 species, we investigated the motifs through the MEME suite (https://meme-suite.org/, accessed on 22 Febuary 2022) [16]. The conserved domains were analyzed through CDD from NCBI (https://www.ncbi.nlm.nih.gov/cdd/, accessed on 4 March 2022) [17].

2.2. Animals, DNA Sampling, and Phenotype Data Collection

According to the relevant local laws and policies on animal welfare and institutional guidelines of the Institutional Animal Protection and Use Committee of Northwest A&F University (protocol number: NWAFAC1008), the following animal experiments in this study were approved and conducted.

A total of 827 female cattle blood samples were collected from four Chinese local cattle breeds, including Qinchuan (n = 658), Fu (n = 52), Yak (n = 48) and Chaidam (n = 69). Among them, Qinchuan cattle, one of the most representative Chinese local cattle breeds, ranks first among the yellow cattle in China. Chaidam cattle is the local yellow breed in Qinhai province. Fu is the Angus–Yak–Chaidam crossbreed. For individuals in each population, the animals were non-relatives for at least three generations. All the individuals were two years old. According to standard procedures, genomic DNA was isolated from blood samples and stored at −80 °C.

We measured phenotypic traits in cattle according to the method provided in Molecular Cloning—a laboratory manual [18]—including body mass (BM), body height (BH), body length (BL), chest width (CW), the circumference of the cannon bone (CCB), hip width (HIW), chest girth (CG), and waist height (WH). The analysis of these phenotypic traits’ distribution in each breed was performed by GraphPad Prism version 8.0.0 software (San Diego, CA, USA) (Figure S1).

2.3. RNA Extraction, cDNA Synthesis, and Real-Time Quantitative PCR (qPCR)

Six female Qinchuan cattle individuals, including three fetal bovines and three female adult bovines, were randomly selected for slaughter. Seven tissues, including spleen, lung, kidney, heart, longissimus dorsi, liver, and the subcutaneous fat of the back, were collected and frozen in liquid nitrogen immediately after slaughter and then stored in a −80 °C refrigerator for further analysis. The RNA was extracted using Trizol. The cDNA was synthesized with a PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara, Kusatsu, Japan) based on the recommended procedure.

Using the SYBR Green series (Takara), real-time quantitative PCR (qRT-PCR) was performed to detect the gene expression. β-actin was used as a reference gene for normalization [19]. The primer P (Table 1) for qRT-PCR was designed based on the KAT2B gene mRNA sequence (XM_019966941.1) with Primer 5.0 software (Sangon Biotech (Shanghai) Co., Ltd., China). The PCR was run as the previous protocol [1]: in brief, 95 °C for 5 min, 34 cycles, 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s. The qRT-PCR was conducted in triplicate for each sample.

Table 1.

Primers for PCR in this study.

Targeted SNP or Gene Accession Number Primer Pair Tm
(°C)
Name Position Sequence
(5′-3′)
g.T61908C AC_000158.1 P1 68 F1 61,883–61,907 GGGTTCCCACTGCACAGGCCAAGCT
R1 61,936–61,960 GTCCATCAGACGCCCCCACACAGAG
g.T62131C AC_000158.1 P2 64 F2 62,105–62,129 ACCTTCAAGGCCTTTTACATGCGGG
R2 62,298–62,322 TCAAAGAGGAATGGACACAGGCAGA
g.C73406T AC_000158.1 P3 61 F3 73,379–73,403 CTCTTCCCAGTCTCACTTTTGTGGG
R3 73,668–73,692 AGGCACACTGTTTGATGAGTTTCTA
KAT2B XM_019966941.1 P 60 F 7–26 CGGTCTCTTGACCTTCGTGA
R 158–177 TTTGCCGGGTATGGAAGGAG
β-actin NM_173979.3 Pr 58 Fr 831–851 GTCATCACCATCGGCAATGAG
Rr 896–914 AATGCCGCAGGATTCCATG

2.4. Detection of KAT2B SNPs by DNA Pool Sequencing

To explore the allele variation of the bovine KAT2B gene, a total of 17 primer pairs were designed to cover the exons and the adjacent introns (Table S1, GenBank accession number: AC_000158.1). Forty DNA samples were randomly selected from each cattle breed, to construct for DNA pools of four breeds [19]. PCR reactions were carried out using a Touchdown PCR System Thermal Cycler Dice (TaKaRa, Dalian, China) and a PCR protocol which was described in a previous study [20]. DNA pool sequencing for the PCR productions using a Sanger sequencing strategy was applied to screen the genetic variations. The sequences were imported into the BioXM software (version 2.6) to search for SNPs.

2.5. Genotyping for KAT2B SNPs by PCR–RFLP

Based on the results of KAT2B SNPs detection, the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique was used for genotyping of the candidate SNPs of KAT2B gene. Three pairs of primers were designed by Primer 5.0 software (Sangon Biotech (Shanghai) Co., Ltd., Shanghai China), targeting the fragments of g.C61908T (P1), g.T62131C (P2), and g.C73406T (P3) polymorphic sites of the KAT2B gene (Table 1). The PCR reactions were carried out in a 25 μL volume which contained 1 μL cattle genomic DNA (50 ng/μL), 0.5 μL each primer (10 μmol/L), 12.5 μL 2 × Taq PCR MasterMix (Taq DNA polymerase, Mg2+, dNTPs, et al.), and ddH2O. The PCR tests were carried out with the PCR System Thermal Cycler Dice (TaKaRa, Dalian, China), with the following amplification protocol: 94 °C for 5 min; followed by 35 cycles of 94 °C for 30 s, annealing at selected temperatures (Table 1) for 30 s, and extension at 72 °C for a 30 s; and a final extension at 72 °C for 10 min [20].

Then, to genotype the three SNPs of KAT2B, the PCR products of g.C61908T, g.T62131C, and g.C73406T were digested, respectively, with restriction endonucleases Hind III, Apa I, and Apa I (TaKaRa, Tokyo, Japan), with the method described in our previous study [20]. The digested products were detected by electrophoresis in 3.0% agarose gel stained with 200 ng/mL ethidium bromide at a constant voltage (120 V) for 40 min. The patterns of DNA bands were observed and photographed with the Bio-rad Gel Doc 2000 Gel Imaging system.

2.6. Statistical Analysis

The relative expression levels of the KAT2B gene were calculated via 2−∆∆Ct method [21]. The mRNA expression levels of KAT2B in tissues were analyzed through GraphPad Prism 6 software.

The allelic and genotypic frequencies of all three SNPs were calculated by Haploview software [22]. He (gene heterozygosity), Ne (effective allele numbers), and PIC (polymorphism information content) were calculated according to Nei’s methods, respectively [23,24]. The Hardy–Weinberg equilibrium (HWE) was calculated using the chi-square test [25].

The association analysis between genotypes and growth traits was performed with a general linear model procedure, and they were compared by Duncan’s Multiple Range Test (SPSS V19.0, Inc., Chicago, IL, USA) software. The equation is as follows: Yijk=μ+Gi+Fj+Bk+eijk. Yijk represents the phenotypic observations; μ represents the average values; Gi is the fixed effect of genotype; Fj represents the fixed effect of farm; Bk is the fixed effect of cattle breeds; eijk is the residual effect. All values are presented as the mean ± SE. p values < 0.05 were considered as statistically significant.

3. Results

3.1. Biological Evolution and Conservation Analysis of KAT2B

The multiple sequence alignment of KAT2B proteins was performed for eleven mammalian or domestic animals, including cattle (Bos taurus), zebu cattle (Bos indicus), yaks (Bos mutus), buffalo (Bubalus bubalis), goats (Capra hircus), sheep (Ovis aries), pigs (Sus scrofa), humans (Homo sapiens), mice (Mus musculus), rats (Rattus rattus), and chickens (Gallus gallus). The results show that KAT2B protein structure was highly conserved among the ruminants, such as cattle, zebu cattle, yak, buffalo, goats, and sheep; but was somewhat different from pig, rat, mouse, human, and chicken versions (Figure 1A). MEGA created the phylogenetic tree of KAT2B proteins under neighbor-joining analysis. As shown in Figure 1B,C, cattle, buffalo, yak, goats, and sheep were clustered together; and the humans, pigs, mice, rats, and chickens are away from the bovine. Seven significant motifs of the KAT2B proteins were found among the 11 species by MEME, and the motifs occupied the exact locations (Figure S2). By searching for KAT2B protein structures through NCBI CDD, three specific conserved domains, including homology (Cdd: pfam06466), NAT (N-Acyltransferase) superfamily (Cdd: cd04301), and bromodomain (Cdd: cd05509), were found in all 11 species (Figure S3). These findings suggest that the KAT2B protein is highly conserved and may play key roles in animals.

Figure 1.

Figure 1

Biological evolution and conservation of KAT2B. (A) Multiple sequence alignment of KAT2B for the 11 species. The degree of similarity is delineated using different background shading: black−100%, blue−80%, pink−60%, yellow−30%, and white−not conserved. (B) Phylogenetic tree (Left) and motif structural analysis (Right) for the 11 species. Seven significant motifs were identified. The length of the color block shows the position, strength, and significance of a particular motif site. The motif length is proportional to the negative logarithm of the p-value of the motif site, truncated at the height for a p-value of 1 × 10−10. These were are given by motif analysis performed through the MEME suite system. (C) Phylogenetic tree for the 11 species.

3.2. Bovine KAT2B Gene Expression Profile

To verify whether KAT2B regulates cattle growth and development, we detected KAT2B mRNA expression in seven fetal and adult bovine tissues (spleen, lung, kidney, heart, muscle, liver, and adipose). In fetal bovines, the highest KAT2B expression level was found in the liver, followed by the spleen and muscle, and the lowest was found in the adipose. In adult bovines, the highest KAT2B expression level was found in the kidney, followed by the adipose and spleen. The KAT2B mRNA was dramatically increased in the adult bovine spleen, kidney, and adipose, whereas it was almost absent in the adult bovine heart and muscle tissues (Figure 2). These findings suggest that the KAT2B gene expression has spatiotemporal specificity during fetal and adult periods, particularly in tissues (e.g., liver, adipose, and muscle) that are closely related to economic traits.

Figure 2.

Figure 2

The KAT2B gene mRNA expression profile in Qinchuan cattle. * Indicates a significant difference between two groups (p < 0.05). Heart in the fetal bovines was the control tissue.

3.3. Identification of KAT2B SNPs

To find potential molecular markers in the KAT2B gene for improvement in cattle breeding, we firstly detected the variations of the KAT2B gene using the DNA pooling sequencing method. Three polymorphic sites were detected, including g.T61908C (SNP1), g.T62131C (SNP2), and g.C73406T (SNP3) (Figure 3). Then, the genotype frequency and allele frequency of the three SNPs of KAT2B genes in four cattle breeds were calculated (Table 2). SNP1 had mid-genetic diversity in Qinchuan, Chaidam, Yak, and Fu cattle (0.25 < PIC < 0.50). SNP2 showed low genetic diversity in Yak cattle (PIC < 0.25) and mid-genetic diversity in the other three cattle breeds (0.25 < PIC < 0.50). SNP3 had mid-genetic diversity in all four cattle breeds (0.25 < PIC < 0.50). Furthermore, SNP1 and SNP3 were within the Hardy–Weinberg equilibrium in all four cattle breeds (p > 0.05). SNP2 was within the Hardy–Weinberg equilibrium for all but Yak.

Figure 3.

Figure 3

Sequence variants of the KAT2B gene in bovines. (A) KAT2B gene polymorphism sites. (B) Genotyping of g.T61908C. TT genotype is represented by the combination of 21 and 57 bp bands; CC genotype is represented by 78 bp band; TC genotype is represented by the combination of 78, 57, and 21 bp bands. (C) Genotyping of g.T62131C. The combination of 191 and 27 bp bands represents the CC genotype; the 218 bp band represents the TT genotype; the combination of 218, 191, and 27 bp bands represents the TC genotype. (D) Genotyping of g.C73406T. The combination of 287 and 27 bp bands represents the CC genotype; the 314 bp band represents the TT genotype; the CT genotype is represented by the combination of 314, 287, and 27 bp bands.

Table 2.

Genotype and allele frequencies of SNP of the bovine KAT2B gene.

SNP Breed Genotype Frequency Allele Frequency χ2 (HWE) PIC He Ne
g.T61908C CC TC TT C T
Qinchuan (658) 0.13 0.61 0.26 0.43 0.57 p > 0.05 0.37 0.49 1.96
Fu (52) 0.23 0.56 0.21 0.51 0.49 p > 0.05 0.37 0.50 2.00
Yak (48) 0.27 0.58 0.15 0.56 0.44 p > 0.05 0.37 0.49 1.97
Chaidam (69) 0.45 0.35 0.20 0.62 0.38 p > 0.05 0.36 0.47 1.89
g.T62131C CC TC TT C T
Qinchuan (658) 0.39 0.43 0.18 0.61 0.39 p > 0.05 0.36 0.48 1.91
Fu (52) 0.28 0.37 0.35 0.47 0.53 p > 0.05 0.37 0.50 1.99
Yak (48) 0.80 0.10 0.10 0.84 0.16 p < 0.01 0.23 0.27 1.37
Chaidam (69) 0.29 0.38 0.33 0.48 0.52 p > 0.05 0.37 0.50 2.00
g.C73406T CC CT TT C T
Qinchuan (658) 0.47 0.43 0.10 0.69 0.31 p > 0.05 0.34 0.43 1.75
Fu (52) 0.40 0.33 0.27 0.57 0.43 p > 0.05 0.37 0.49 1.96
Yak (48) 0.02 0.44 0.54 0.24 0.76 p > 0.05 0.30 0.36 1.57
Chaidam (69) 0.23 0.55 0.21 0.51 0.49 p > 0.05 0.37 0.50 2.00

Note: HWE, Hardy–Weinberg equilibrium; PIC, polymorphism information content; He, gene heterozygosity; Ne, effective allele numbers.

3.4. Correlation Analysis of Bovine KAT2B Gene SNPs and Body Measure Traits

The relationships between the KAT2B SNPs and the body measurements among four Chinese native cattle breeds were investigated. The polymorphisms of g.T61908C and g.T62131C were significantly associated with body length and circumference of cannon bone in Fu cattle, and TT was the superior genotype. g.T62131C polymorphism was significantly associated with body height, chest width, hip width, and wither height in Qinchuan cattle; and TC was the superior genotype. The g.C73406T polymorphism was significantly associated with body mass; and TT and TC were superior genotypes in Yak and Chaidam cattle, respectively. In addition, g.C73406T was also associated with chest girth and circumference of the cannon bone in Chaidam cattle; and the CC was the superior genotype (Table 3).

Table 3.

Association analysis of three SNPs of the KAT2B gene and body measure traits.

SNP Breed Growth Traits Genotype
CC TC TT
g.T61908C Fu BL(cm) 84.00 ± 7.06 a,b 82.86 ± 8.22 b 89.73 ± 10.04 a
g.T62131C Fu CCB(cm) 11.6 ± 1.35 A 10.26 ± 1.49 B 11.39 ± 1.54 A
Qinchuan BH(cm) 127.3 ± 6.74 b 130.35 ± 6.07 a 129.26 ± 7.15 a,b
CW(cm) 36.52 ± 4.75 b 37.91 ± 4.43 a,b 39.48 ± 4.13 a
HIW(cm) 40.67 ± 5.38 b 43.06 ± 4.78 a 43.5 ± 5.02 a
WH(cm) 124.31 ± 6.47 b 129.63 ± 10.81 a 127 ± 7.05 a,b
g.C73406T Yak BM(cm) 151.00 ± 0.11 B 166.57 ± 9.53 B 177 ± 15.34 A
Chaidam BM(cm) 246.36 ± 30.29 A,B 272.27 ± 21.14 A 228.9 ± 57.21 B
CG(cm) 152.64 ± 7.59 A 141.92 ± 8.12 B 140.2 ± 13.75 B
CCB(cm) 16.09 ± 1.22 A 14.69 ± 0.95 B 14.3 ± 1.06 B

Note: Values are shown as the least squares means ± standard error. Different superscripts of A,B and a,b mean significant differences among groups (p < 0.01 or p < 0.05). BL = body length, WH = withers height, CCB = circumference of cannon bone, BH = body height, CW = chest width, HIW = hip width, BM = body mass, CG = chest girth.

4. Discussion

The growth and slaughter characteristics of livestock are important indexes for assessing their meat production and economic value. Early selection of individuals with superior phenotypes based on genotype will greatly improve the efficiency of the population. This study analyzed the protein structure and expression profile of KAT2B, and the associations of KAT2B polymorphisms with body measure traits in 827 bovine individuals. The spatiotemporal-specific expression profiles and three SNPs of the KAT2B gene were identified. We found that these SNPs were correlated with multiple body measurements in Fu, Qinchuan, Yak, and Chaidam cattle. This provides a potential molecular marker for improving Chinese cattle and may spark further interest in the underlying mechanism of the KAT2B gene’s regulation on bovine growth and development.

KAT2B is an acetyltransferase that belongs to the GNAT family, one of the three prominent acetyltransferases [26]. The KAT2B protein has three conserved functional domains: the homology domain, AT domain, and bromodomain [26]. The homology domain is located in the N-terminal domain. The AT domain and bromodomain are located in the C-terminal domain [27]. Meanwhile, the central region of the AT domain mediates acetyl CoA binding and catalysis. The areas at both ends mediate histone substrate specificity [28]. The KAT2B protein function needs the combined actions of homology and AT domains [29]. It can affect transcription initiation by modifying the position of the chromatin domain, and consequently playing an essential role in cell proliferation [30]. This work found that KAT2B protein motifs and structure were highly conserved among bovines, implicating that the gene can be inherited stably and functions similarly in bovines; it has crucial roles. The KAT2B gene expression profile in Qinchuan cattle revealed the spatiotemporal specificity for bovine adipose tissue. This is consistent with our previous observation by the RNA-seq method, which also detected markedly different expression in the adipose tissue of Qinchuan cattle in a different period [14]. The high mRNA expression level of KAT2B in the adult period indicates its key role in bovine fat deposition. Teruo Yamauchi et al. [31] found that KAT2B was expressed early in E12.5 embryos and played an important role in mouse embryo development [31]. A study found that KAT2B can affect the growth and development of murine skeletal muscle by affecting the β-catenin signaling pathway in myoblasts [32]. Tushar K. et al. [33] reported that KAT2B regulated heart and forelimb development by acetylating TBX5. According to Rabhi et al. [34], mice’s germline and β cell-specific disruption of the KAT2B gene led to impaired insulin secretion and glucose intolerance. Taking these findings together, KAT2B is possible to be a candidate gene regulating the development and metabolism of muscle and adipose, and the genetic effects may vary from species and developmental period.

The body measurements are the key indicators of beef cattle’s economic value. Body measure traits, such as body mass and body length, can be utilized to assess carcass meat production. Multiple SNPs in various genes have been demonstrated to be associated with body measurement and meat quality traits [8]. Identification of a gene’s causal variant can promote the accuracy of genomic selection, which is considered as an efficient way of analyzing the associations between genetic polymorphisms and traits of economic importance [4,35]. This study identified three SNPs of the KAT2B gene that were associated with different body measure traits among cattle breeds but varied within breeds. These results might result from the differences in the genetic backgrounds of different breeds. Body measure traits are quantitative traits that are usually controlled by multiple genes and their interactions [36]. A candidate gene may have striking effects in one breed while having quite limited effects in another breed due to the negative effects of other genes or epistatic interaction of the candidate gene with other genes [36]. For example, Zhang et al. [37] reported that two indels (14 bp indel and 17 bp indel) in the SPAG17 gene were related to the Shaanbei white cashmere goat’s body measurement traits but had no significant association with those of Hainan black goat. Liu et al. [38] found that the individuals with copy-number-gain of SHH exhibited better performance across breeds, but its effects on body measure traits were different—e.g., chest depth in Qinchuan cattle; body weight and length in Nanyang cattle; and chest girth and body weight in Jinnan cattle. Therefore, breed difference is another factor that should be taken into account in cattle selection breeding. For example, in Fu cattle, individuals with the TT genotype at the g.T61908C locus had better performance in BL, whereas individuals with the CC genotype at the g.T62131C locus had the worst performance in CCB. Hence, in Fu cattle breeding, increasing the TT (g.T61908C) genotype’s frequency or reducing the rate of the CC (g.T62131C) genotype’s frequency in the population may improve growth performance. For Qinchuan cattle, individuals with the TC and TT (g.T62131C) genotypes (respectively) performed better in body height, chest width, hip width, and wither height than those with the CC (g.T62131C) genotype. Therefore, increasing the TC or TT (g.T62131C) genotype frequency in the population may lead to better body measurements in Qinchuan cattle breeding. For Yaks, individuals with the TT (g.C73406T) genotype performed better in body mass. However, for Chaidam cattle, individuals with TT (g.C73406T) performed worst in body mass, chest girth, and circumference of the cannon bone. Therefore, different genotypes should be selected according to their different effects on phenotype.

Meanwhile, we acknowledge that the samples were limited in this study, especially those of Fu, Yak, and Chaidam cattle. Thus, the results need to be verified in more samples. Additionally, further investigation on the mechanisms of KAT2B’s influences on bovine body measure traits is necessary for the future.

5. Conclusions

This study was the first investigation of the KAT2B gene and its SNPs’ effects in four Chinese cattle populations. The analysis of bioinformatic function and expression levels in different bovine tissues suggests important roles of KAT2B in cattle. The association analysis revealed the significant effects of three KAT2B gene polymorphisms, T61908C, g.T62131C, and g.C73406T, on body measure traits in Qinchuan, Fu, Yak, and Chaidam cattle. These findings suggest that KAT2B gene polymorphisms can be used as the molecular markers for early molecular-marker-assisted selection in beef cattle breeding programs.

Acknowledgments

We thank J.Z. and J.C. for their experimental assistance.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani12151954/s1, Figure S1: Distribution of phenotypes in Qinchuan cattle; Figure S2: Significant motifs of KAT2B across the 11 species; Figure S3: Structure of KAT2B protein domain families in the 11 species; Table S1: Primers for exploring genetic variations of bovine KAT2B gene.

Author Contributions

M.L. designed and supervised the study. X.L., B.L. and Y.C. performed experiments and analyzed data. X.L. and M.L. discussed the study and wrote the manuscript. H.C. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

All animal experiments were conducted following relevant laws and institutional guidelines and approved by the Institutional Animal Protection and Use Committee of Northwest A&F University (protocol number: NWAFAC1008).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors report no conflict of interest.

Funding Statement

This work was supported by the National Natural Science Foundation of China (No. 32002166, No. 31972558, and No. 31772574).

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Zhao C., Raza S.H.A., Khan R., Sabek A., Khan S., Ullah I., Memon S., El-Aziz A.H.A., Shah M.A., Shijun L., et al. Genetic variants in MYF5 affected growth traits and beef quality traits in Chinese Qinchuan cattle. Genomics. 2020;112:2804–2812. doi: 10.1016/j.ygeno.2020.03.018. [DOI] [PubMed] [Google Scholar]
  • 2.Cheng J., Peng W., Cao X., Huang Y., Lan X., Lei C., Chen H. Differential Expression of KCNJ12 Gene and Association Analysis of Its Missense Mutation with Growth Traits in Chinese Cattle. Animals. 2019;9:273. doi: 10.3390/ani9050273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Liu M., Zhang C., Lai X., Xue J., Lan X., Lei C., Jia Y., Chen H. Associations between polymorphisms in the NICD domain of bovine NOTCH1 gene and growth traits in Chinese Qinchuan cattle. J. Appl. Genet. 2017;58:241–247. doi: 10.1007/s13353-016-0377-y. [DOI] [PubMed] [Google Scholar]
  • 4.Raza S.H.A., Shijun L., Khan R., Schreurs N.M., Manzari Z., Abd El-Aziz A.H., Ullah I., Kaster N., Shah M.A., Zan L. Polymorphism of the PLIN1 gene and its association with body measures and ultrasound carcass traits in Qinchuan beef cattle. Genome. 2020;63:483–492. doi: 10.1139/gen-2019-0184. [DOI] [PubMed] [Google Scholar]
  • 5.Meuwissen T.H., Hayes B.J., Goddard M.E. Prediction of total genetic value using genome-wide dense marker maps. Genetics. 2001;157:1819–1829. doi: 10.1093/genetics/157.4.1819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Schaeffer L.R. Strategy for applying genome-wide selection in dairy cattle. J. Anim. Breed. Genet. 2006;123:218–223. doi: 10.1111/j.1439-0388.2006.00595.x. [DOI] [PubMed] [Google Scholar]
  • 7.Tong B., Zhang L., Li G.P. Progress in the molecular and genetic modification breeding of beef cattle in China. Yi Chuan. 2017;39:984–1015. doi: 10.16288/j.yczz.17-181. [DOI] [PubMed] [Google Scholar]
  • 8.Abd El-Hack M.E., Abdelnour S.A., Swelum A.A., Arif M. The application of gene marker-assisted selection and proteomics for the best meat quality criteria and body measurements in Qinchuan cattle breed. Mol. Biol. Rep. 2018;45:1445–1456. doi: 10.1007/s11033-018-4211-y. [DOI] [PubMed] [Google Scholar]
  • 9.Helmlinger D., Tora L. Sharing the SAGA. Trends Biochem. Sci. 2017;42:850–861. doi: 10.1016/j.tibs.2017.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Jin Q., Yu L.R., Wang L., Zhang Z., Kasper L.H., Lee J.E., Wang C., Brindle P.K., Dent S.Y., Ge K. Distinct roles of GCN5/PCAF-mediated H3K9ac and CBP/p300-mediated H3K18/27ac in nuclear receptor transactivation. EMBO J. 2011;30:249–262. doi: 10.1038/emboj.2010.318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bondy-Chorney E., Denoncourt A., Sai Y., Downey M. Nonhistone targets of KAT2A and KAT2B implicated in cancer biology. Biochem. Cell Biol. 2019;97:30–45. doi: 10.1139/bcb-2017-0297. [DOI] [PubMed] [Google Scholar]
  • 12.Fournier M., Orpinell M., Grauffel C., Scheer E., Garnier J.M., Ye T., Chavant V., Joint M., Esashi F., Dejaegere A., et al. KAT2A/KAT2B-targeted acetylome reveals a role for PLK4 acetylation in preventing centrosome amplification. Nat. Commun. 2016;7:13227. doi: 10.1038/ncomms13227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Moisa S.J., Shike D.W., Meteer W.T., Keisler D., Faulkner D.B., Loor J.J. Yin yang 1 and adipogenic gene network expression in longissimus muscle of beef cattle in response to nutritional management. Gene Regul. Syst. Biol. 2013;7:71–83. doi: 10.4137/GRSB.S11783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Zhou Y., Sun J., Li C., Wang Y., Li L., Cai H., Lan X., Lei C., Zhao X., Chen H. Characterization of transcriptional complexity during adipose tissue development in bovines of different ages and sexes. PLoS ONE. 2014;9:e101261. doi: 10.1371/journal.pone.0101261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kumar S., Stecher G., Li M., Knyaz C., Tamura K., Battistuzzi F.U. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018;35:1547–1549. doi: 10.1093/molbev/msy096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Bailey T.L., Boden M., Buske F.A., Frith M., Grant C.E., Clementi L., Ren J., Li W.W., Noble W.S. MEME SUITE: Tools for motif discovery and searching. Nucleic Acids Res. 2009;37:W202–W208. doi: 10.1093/nar/gkp335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Marchler-Bauer A., Bo Y., Han L., He J., Lanczycki C.J., Lu S., Chitsaz F., Derbyshire M.K., Geer R.C., Gonzales N.R., et al. CDD/SPARCLE: Functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 2017;45:D200–D203. doi: 10.1093/nar/gkw1129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Sambrook J., Russell. D.W. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press; New York, NY, USA: 2001. [Google Scholar]
  • 19.Zhang D., Xu J., Yang P., Wen Y., He H., Li J., Liang J., Zheng Y., Zhang Z., Wang X., et al. Genetic variant of SPARC gene and its association with growth traits in Chinese cattle. Arch. Anim. Breed. 2020;63:31–37. doi: 10.5194/aab-63-31-2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Liu M., Liu M., Li B., Zhou Y., Huang Y., Lan X., Qu W., Qi X., Bai Y., Chen H. Polymorphisms of FLII implicate gene expressions and growth traits in Chinese cattle. Mol. Cell. Probes. 2016;30:266–272. doi: 10.1016/j.mcp.2016.07.005. [DOI] [PubMed] [Google Scholar]
  • 21.Gui L.S., Raza S.H.A., Garcia M., Sun Y.G., Ullah I., Han Y.C. Genetic variants in the SIRT6 transcriptional regulatory region affect gene activity and carcass quality traits in indigenous Chinese beef cattle (Bos taurus) BMC Genom. 2018;19:785. doi: 10.1186/s12864-018-5149-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lv Y., Jia C., Jiang A., Zhang H., Wang Y., Liu F., Yang L., Sun Y., Lv R., Song X. Analysis of Association between MGMT and p53 Gene Single Nucleotide Polymorphisms and Laryngeal Cancer. Anticancer Res. 2017;37:4399–4403. doi: 10.21873/anticanres.11834. [DOI] [PubMed] [Google Scholar]
  • 23.Zhou Y., Li C., Cai H., Xu Y., Lan X., Lei C., Chen H. Novel polymorphisms of the APOA2 gene and its promoter region affect body traits in cattle. Gene. 2013;531:288–293. doi: 10.1016/j.gene.2013.08.081. [DOI] [PubMed] [Google Scholar]
  • 24.Nei M., Roychoudhury A.K. Sampling variances of heterozygosity and genetic distance. Genetics. 1974;76:379–390. doi: 10.1093/genetics/76.2.379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wang J., Shete S. Testing Departure from Hardy-Weinberg Proportions. Methods Mol. Biol. 2012;850:77–102. doi: 10.1007/978-1-61779-555-8_6. [DOI] [PubMed] [Google Scholar]
  • 26.Nagy Z., Tora L. Distinct GCN5/PCAF-containing complexes function as co-activators and are involved in transcription factor and global histone acetylation. Oncogene. 2007;26:5341–5357. doi: 10.1038/sj.onc.1210604. [DOI] [PubMed] [Google Scholar]
  • 27.Sterner D.E., Berger S.L. Acetylation of histones and transcription-related factors. Microbiol. Mol. Biol. Rev. 2000;64:435–459. doi: 10.1128/MMBR.64.2.435-459.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Clements A., Rojas J.R., Trievel R.C., Wang L., Berger S.L., Marmorstein R. Crystal structure of the histone acetyltransferase domain of the human PCAF transcriptional regulator bound to coenzyme A. EMBO J. 1999;18:3521–3532. doi: 10.1093/emboj/18.13.3521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Carré C., Szymczak D., Pidoux J., Antoniewski C. The histone H3 acetylase dGcn5 is a key player in Drosophila melanogaster metamorphosis. Mol. Cell. Biol. 2005;25:8228–8238. doi: 10.1128/MCB.25.18.8228-8238.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Fang M., Zhang M., Wang Y., Wei F., Wu J., Mou X., Zhang Y., Liang X., Tang J. Long Noncoding RNA AFAP1-AS1 Is a Critical Regulator of Nasopharyngeal Carcinoma Tumorigenicity. Front. Oncol. 2020;10:601055. doi: 10.3389/fonc.2020.601055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Yamauchi T., Yamauchi J., Kuwata T., Tamura T., Yamashita T., Bae N., Westphal H., Ozato K., Nakatani Y. Distinct but overlapping roles of histone acetylase PCAF and of the closely related PCAF-B/GCN5 in mouse embryogenesis. Proc. Natl. Acad. Sci. USA. 2000;97:11303–11306. doi: 10.1073/pnas.97.21.11303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Suzuki A., Minamide R., Iwata J. The role of acetyltransferases for the temporal-specific accessibility of beta-catenin to the myogenic gene locus. Sci. Rep. 2018;8:15057. doi: 10.1038/s41598-018-32888-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ghosh T.K., Aparicio-Sánchez J.J., Buxton S., Ketley A., Mohamed T., Rutland C.S., Loughna S., Brook J.D. Acetylation of TBX5 by KAT2B and KAT2A regulates heart and limb development. J. Mol. Cell. Cardiol. 2018;114:185–198. doi: 10.1016/j.yjmcc.2017.11.013. [DOI] [PubMed] [Google Scholar]
  • 34.Rabhi N., Denechaud P.D., Gromada X., Hannou S.A., Zhang H., Rashid T., Salas E., Durand E., Sand O., Bonnefond A., et al. KAT2B Is Required for Pancreatic Beta Cell Adaptation to Metabolic Stress by Controlling the Unfolded Protein Response. Cell Rep. 2016;15:1051–1061. doi: 10.1016/j.celrep.2016.03.079. [DOI] [PubMed] [Google Scholar]
  • 35.Fragomeni B.O., Lourenco D.A.L., Legarra A., VanRaden P.M., Misztal I. Alternative SNP weighting for single-step genomic best linear unbiased predictor evaluation of stature in US Holsteins in the presence of selected sequence variants. J. Dairy Sci. 2019;102:10012–10019. doi: 10.3168/jds.2019-16262. [DOI] [PubMed] [Google Scholar]
  • 36.Liu M., Li M., Wang S., Xu Y., Lan X., Li Z., Lei C., Yang D., Jia Y., Chen H. Association analysis of bovine Foxa2 gene single sequence variant and haplotype combinations with growth traits in Chinese cattle. Gene. 2014;536:385–392. doi: 10.1016/j.gene.2013.11.046. [DOI] [PubMed] [Google Scholar]
  • 37.Zhang S., Jiang E., Wang K., Zhang Y., Yan H., Qu L., Chen H., Lan X., Pan C. Two Insertion/Deletion Variants within SPAG17 Gene Are Associated with Goat Body Measurement Traits. Animals. 2019;9:379. doi: 10.3390/ani9060379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Liu M., Li B., Shi T., Huang Y., Liu G.E., Lan X., Lei C., Chen H. Copy number variation of bovine SHH gene is associated with body conformation traits in Chinese beef cattle. J. Appl. Genet. 2019;60:199–207. doi: 10.1007/s13353-019-00496-w. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

Not applicable.


Articles from Animals : an Open Access Journal from MDPI are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES