Potential of stem cell seeded three-dimensional scaffold for regeneration of full-thickness skin wounds

Abstract

Hypoxic wounds are tough to heal and are associated with chronicity, causing major healthcare burden. Available treatment options offer only limited success for accelerated and scarless healing. Traditional skin substitutes are widely used to improve wound healing, however, they lack proper vascularization. Mesenchymal stem cells (MSCs) offer improved wound healing; however, their poor retention, survival and adherence at the wound site negatively affect their therapeutic potential. The aim of this study is to enhance skin regeneration in a rat model of full-thickness dermal wound by transplanting genetically modified MSCs seeded on a three-dimensional collagen scaffold. Rat bone marrow MSCs were efficiently incorporated in the acellular collagen scaffold. Skin tissues with transplanted subcutaneous scaffolds were histologically analysed, while angiogenesis was assessed both at gene and protein levels. Our findings demonstrated that three-dimensional collagen scaffolds play a potential role in the survival and adherence of stem cells at the wound site, while modification of MSCs with jagged one gene provides a conducive environment for wound regeneration with improved proliferation, reduced inflammation and enhanced vasculogenesis. The results of this study represent an advanced targeted approach having the potential to be translated in clinical settings for targeted personalized therapy.

1. Introduction

Full-thickness wounds develop after tissue disintegration due to extensive surgeries, cuts, burns and long-term pressures [1,2]. The healing process is highly regulated, however, it can be disrupted by multiple factors, such as insufficient oxygen supply, bacterial infection and prolonged inflammation at the wound site [3–5]. These factors not only contribute to the development of the hypoxic microenvironment but also disrupt the vasculature, thus delaying the healing process. With insufficient oxygen, the wound healing phases i.e. inflammation, proliferation and remodelling, become impaired which leads to the dysregulation and degradation of wound healing mediators, such as cytokines, growth factors and extracellular matrix (ECM), which can contribute to wound bed hypoxia [3,5].

The appropriate functioning of cells and tissues in the body depends on the sufficient supply of nutrients and oxygen through an efficient vascular system [3]. Hypoxia, which occurs due to vasculature damage, is primarily regulated by a master transcription regulator of oxygen hemostasis, hypoxia inducible factor-1α (HIF-1α). HIF-1α is critically involved in almost all wound healing phases. During the initial phase of wound healing (inflammatory phase), hypoxia leads to a prompt influx of inflammatory cells contributing to the healing process [5,6]. Accumulation of these inflammatory cells in the hypoxic environment plays a critical role in the next overlapping phases of wound healing (proliferation, granulation and re-epithelialization). However, elevated consumption of oxygen by inflammatory and stromal cells further reduces the tissue oxygen tension which ultimately leads to prolonged and chronic hypoxia [5]. Along with the inflammatory cells, fibroblasts also migrate to the wound bed and secrete collagen, fibronectin and matrix metalloproteinases that degrade damaged ECM and replace it with new ECM [7].

Available wound care measures include wound dressings to control bacterial infections. Wound bed preparation, tissue debridement, oedema control and vascular optimization are important parameters to address successful wound healing [8]. Dermal substitutes, which either replace dermis or epidermis, promote wound healing [9,10]. Stem cell therapy has been used to treat a wide range of skin injuries [2,11,12]. The use of multipotent adult stem cells for the treatment of cutaneous wounds is an attractive option, as these cells can differentiate into multiple cell types. These cells secrete a variety of cytokines and growth factors which are crucial for the process of wound healing. Moreover, bone marrow-derived mesenchymal stem cells (BM-MSCs) are potential candidates for the regeneration of functional tissue following tissue injury [12]. However, little improvement in organ function has been reported due to poor survival of the transplanted cells at the injured site. Therefore, tissue engineering approaches using natural or synthetic biomaterials have been proposed for efficient wound healing [2,13,14]. The incorporation of stem cells into biomaterials provides a suitable niche to the transplanted stem cells to enhance their survival and therapeutic effect. Different biomaterials have been used to improve the function and engraftment of implanted cells [15], including artificial skin grafts for efficient wound healing [1,16]. Collagen-based scaffolds are preffered options, as collagen is the main component of the ECM and is responsible for mechanical strength and structural integrity [17]. To further enhance tissue regeneration, genes involved in the wound healing process can be delivered through viral or non-viral vectors, to induce their transient expression in the endogenous cells [1,17].

The current study aims to improve wound healing following full-thickness skin injury in a rat model. We hypothesize that the use of a three-dimensional collagen scaffold and jagged 1 transfected BM-MSCs can improve the wound healing process. Jagged 1 is the angiogenic ligand of the Notch receptor pathway and plays a significant role in wound healing specifically through improved angiogenesis in the hypoxic wound tissue, while the three-dimensional collagen scaffold would provide mechanical strength for the transplanted cells, thus mimicking the natural tissue microenvironment.

2. Methods

2.1. Animals

Adult male Wistar rats (150–200 g) were housed in the institutional Animal Resource Facility. The animals had access to sterile water and standard food ad libitum. All animals were kept in a controlled environment, at a temperature of 22°C (± 4°C) with a relative humidity of 55% (±5%), and 12 h of light and dark cycles. The experimental protocol was approved by the institutional ethical committee (protocol no. 2017-0060), and all experiments were carried out according to the standard international guidelines.

For in vivo study, total n = 50 animals were used according to the study design. Initially, n = 25 animals were sacrificed for optimization of the wound model and isolation of bone marrow derived MSCs, while the remaining animals were divided into experimental groups. The details of the experimental groups are mentioned in table 1.

Table 1.

List of the experimental groups.

s. no	experimental groups	number of animals
Group 1	hypoxic wound	6
Group 2	hypoxic wound with scaffold	6
Group 3	hypoxic wound with scaffold seeded with normal MSCs	6
Group 4	hypoxic wound with scaffold seeded with transfected MSCs	6

2.2. Isolation and culture of mesenchymal stem cells

Rat bone marrow was isolated, as reported previously [18]. Briefly, bone marrow was cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, streptomycin (100 µg ml⁻¹), penicillin (100 units ml⁻¹) and sodium pyruvate (1 mM) (referred to as complete DMEM) in a humidified CO₂ incubator (NuAire, USA) at 37°C and 5% CO₂. MSCs adhered to the flask surface and expanded in culture, while floating haematopoietic cells were removed. MSCs were sub-cultured when they were 70–80% confluent. MSCs of passages 1–2 (P1–P2) were used in all experiments.

2.3. Immunocytochemistry of mesenchymal stem cells

MSCs were cultured on glass coverslips in a 24-well cell culture plate. Cells were fixed with 4% paraformaldehyde for 10 min at room temperature and permeabilized with 0.1% Triton X-100. Blocking solution (2% BSA) was added for 1 h. Primary antibodies against CD44, CD90, CD29, CD117 and CD45 were added to the cells in the recommended dilutions, and incubated overnight at 4°C. Cells were washed with PBS followed by the addition of fluorescently labelled secondary antibody solution for 1 h in dark at 37°C. Cells were washed again three to five times with PBS. Nuclei were stained with DAPI. Cells were observed under a fluorescence microscope (NiE, Nikon, Japan).

2.4. Isolation of plasmid vector

Jagged 1 plasmid was obtained from Addgene (Addgene plasmid no. 17336) in the form of agar stabs. Escherichia coli was grown in Luria broth containing 100 µg ml⁻¹ ampicillin as a selective agent. The plasmid was isolated using a maxiprep plasmid DNA isolation kit (Thermo Scientific, USA) according to manufacturer's instructions. Plasmid DNA was quantified at 260 nm and run on 1% agarose gel to determine its purity.

2.5. Electroporation

Transfection of MSCs with the jagged 1 plasmid was carried out through electroporation using Neon transfection system (MPK5000, Invitrogen, Life Technologies, USA) according to the previously described protocol [19]. Transfected MSCs were incubated for 48 h in an antibiotic-free DMEM at 37°C in a CO₂ incubator.

2.6. Gene expression analysis of transfected mesenchymal stem cells

Transfection of MSCs with the jagged 1 gene was confirmed via quantitative real-time polymerase chain reaction (qRT-PCR). Total RNA was extracted by Trizol method followed by cDNA synthesis using Revert Aid First Strand cDNA synthesis kit (K1621, Thermo Fischer Scientific, USA) according to manufacturer's instructions. cDNA was amplified by qRT-PCR using bright green 2× qPCR master mix (Applied Biological Materials, Canada) to determine the over-expression of jagged 1 gene before and after transfection (table 2). GAPDH was used as an internal control.

Table 2.

List of gene primers.

genes	primer sequence (5′–3′)	annealing temperature (°C)
GAPDH	forward: GGAAAGCTGTGGCGTGATGG	60
	reverse: GTAGGCCATGAGGTCCACCA
Jagged 1	forward: GCGGGACTGATACTCCTTGA	59
	reverse: GGGTCAATTTGAGCTGGAGA
Ang-1	forward: TATGCCAGAAACCCAAAAAGG	58
	reverse: CATCAGCTCAATCCTCAGCA
HIF-1α	forward: CCCAATGGATGATGATTTCC	54
	reverse: TGGGTAGAAGGTGGAGATGC
TGF- β1	forward: CACTGCTCTTGTGACAGCAAA	58
	reverse: CGGTTCATGTCATGGATGGTG
VEGF	forward: CCAATTGAGACCCTGGTGGA	58
	reverse: TCCTATGTGCTGGCTTTGGT
FGF	forward: AGCAGAAGAGAGAGGAGTTGTG	58
	reverse: TATTTCCGTGACCGGTAAGTGT
EGF	forward: TAACGGGCCTGACAGCA	58
	reverse: TGCACTGGCCCGAGTTA
PDGF	forward: TCACCAGAGCGGAC	58
	reverse: TGTGGAGGTGGAAGCGAG

2.7. Protein expression analysis of transfected mesenchymal stem cells

Transfection was also confirmed by the expression of jagged 1 protein. Both normal and transfected MSCs were immunolabelled with jagged 1 antibody (Thermo Fisher Scientific, USA). Immunolabelled cells were observed under a fluorescence microscope. The images were analysed with ImageJ software (v. 1.50i) to quantify protein intensity.

2.8. Angiogenic potential of transfected mesenchymal stem cells

MSCs were seeded on collagen based gel, Matrigel (Corning, USA) to evaluate in vitro tube formation. Around 150 µl of the gel was gently aspirated with a cold pipette tip directly from the stock and added to each well of a 24-well plate. The plate was gently tapped to obtain a uniform layer of the gel. The coated plates were incubated at 37°C for gel solidification. Next, the cells were detached, and suspended in 500 µl of complete medium. Around 50 000 cells were seeded in each well containing the solidified gel. An additional 600 µl medium was added to each well. The plates were incubated in standard conditions and observed after 12 h under phase contrast microscope for tube formation.

2.9. Seeding of mesenchymal stem cells on three-dimensional collagen scaffold

Both normal and transfected MSCs were seeded on three-dimensional collagen scaffolds. Collagen sponges (Pangen^®, URGO, France) measuring 2.5 × 3.5 cm² were cut into two pieces of 2.5 × 1.75 cm² each with the help of sterile scissors, and placed separately in each well of a six-well plate. Normal and transfected MSCs (0.8 × 10⁶) were seeded on the surface of the collagen sponge. The plate containing cells and collagen scaffold was placed in a CO₂ incubator for 1–2 h for cell adsorption. Next, 2.5 ml of complete and antibiotic-free media were added gently to the normal and transfected MSC seeded scaffolds, respectively. These matrices were then used for in vivo transplantation.

2.10. Development of hypoxic wound model

A skin flap-based hypoxic wound model was developed in rats to evaluate the in vivo angiogenic potential of normal and transfected MSC seeded three-dimensional collagen scaffold. Rats were given intraperitoneal injections at optimized doses of 60 mg kg⁻¹ of ketamine hydrochloride and 7 mg kg⁻¹ of xylazine hydrochloride. Hair was removed from the dorsal surface using hair trimmer and depilatory cream. An area measuring 1.5 × 2 cm² was marked. The skin was then disinfected with povidone–iodine solution. The skin flap was raised by incising the skin from three sides and dissecting it up to the level of panniculus carnosus leaving the skin attached at one side. In this way, the blood supply remained intact to one side only. Skin flap was then re-sutured with 4–0 Prolene suture (Ethicon, USA) at 0.4 cm intervals. Rats were given diclofenac sodium and streptomycin/penicillin and monitored daily for any signs of discomfort and/or infection, until the completion of the experiment.

2.11. Confirmation of hypoxic wound model

Hypoxic wound model was confirmed by the analysis of HIF-1α gene expression in the rat skin tissue. Rats were euthanized and skin was harvested after 3 days following injury. Gene expression analysis was performed using HIF-1α gene primer (table 2). GAPDH was used as an internal control.

2.12. Transplantation of cell-seeded scaffold

Normal and transfected MSC-seeded collagen scaffolds were washed carefully with PBS to remove traces of DMEM, and placed beneath the skin flap. The skin flap was then placed in its original position and re-sutured. Animals were kept for 14 days post-surgery and skin was harvested for histological evaluation and gene expression analysis.

2.13. Gene expression analysis

Gene expression analysis was performed using proliferation and anti-inflammatory genes using corresponding gene primers (table 2). GAPDH was used as an internal control.

2.14. Histological assessment

Histological evaluation was performed on frozen/paraffin-embedded tissues to evaluate the angiogenic potential of normal and transfected cell-seeded collagen scaffold. H&E and Masson's trichrome stainings were performed as previously described in [20].

2.15. Statistical analysis

Data were analysed and represented as mean ± s.e.m. or s.d. Variations among the groups were analysed using independent t-tests and one-way ANOVA. Further comparisons were made by Bonferroni's/Tucky's post hoc test. Results were considered statistically significant when p < 0.05.

3. Results

3.1. Morphology of mesenchymal stem cells

Bone marrow consisted of a heterogeneous of cells at the initial stage of culture. MSCs started to adhere to the flask surface, while haematopoetic cells floated. As the medium was replaced with fresh medium, haematopoietic cells were removed. MSCs proliferated and showed fibroblast-like morphology. After about 12–14 days, cells became confluent and formed a monolayer. P1 and P2 MSCs maintained the same morphology in culture.

3.2. Characterization of mesenchymal stem cells

MSCs were characterized based on their markers by immunocytochemistry. The cells were positive for CD44, CD90, CD29 and CD117, and negative for CD45, a haematopoietic marker (figure 1). These characteristics confirmed that the isolated cells were MSCs.

Figure 1.

Characterization of MSCs: immunofluorescent micrographs showing MSC markers CD44, CD90, CD29 and CD117, haematopoietic marker CD45, and control MSCs stained only with Alexa fluor 546 goat anti-mouse secondary antibody. Nuclei were stained with DAPI.

3.3. Transfection of mesenchymal stem cells with jagged 1

MSCs were transfected with jagged 1 vector through electroporation. Significant upregulation of jagged 1 gene in the transfected MSCs confirmed successful overexpression of tranfected vector. This was further validated by the presence of jagged 1 protein in the transfected MSCs (figure 2).

Figure 2.

Jagged 1 expression in MSCs. (a) Gene expression of jagged 1 in normal and transfected MSCs. (b) Protein expression of jagged 1 in normal and transfected MSCs. (c) Quantification of fluorescent intensity for jagged 1 by ImageJ. (d) Immunostaining for MSC stemness marker stro-1. (e) Quantification of fluorescent intensity for stro-1 by ImageJ. Data are presented as mean ± s.e.m. (n = 3) with significance level ***p < 0.001.

3.4. Tube formation assay

Normal and jagged 1 transfected MSCs seeded on the matrigel showed significantly higher numbers of tube-like structures in the transfected MSCs when compared with normal MSCs (figure 3).

Figure 3.

In vitro tube formation assay: normal and transfected MSCs showing tube formation in Matrigel assay. Number of tubes were counted from three biological replicates and plotted. Data are presented as mean ± s.e.m. (n = 3) with significance level ***p < 0.001.

3.5. Confirmation of hypoxic wound model

The rat model of the hypoxic wound was confirmed by the significantly increased expression of HIF-1α gene in the hypoxic wound tissue. Figure 4 shows rat hypoxic wound model and the expression of HIF-1α by qPCR analysis.

Figure 4.

Hypoxic wound model. (a) Hypoxic wound model was developed on the dorsal surface of rat skin. (b) Gross macroscopic examination of wound tissues at Day 14. (c) Gene expression analysis of HIF-1α was performed by qRT-PCR to confirm that the wound is of hypoxic nature. Data are presented as mean ± s.e.m. (n = 3) with significance level *p < 0.05.

3.6. Analysis of cell survival, anti-inflammatory and angiogenic genes

Analysis of cell survival and proliferation (epidermal growth factor (EGF), fibroblast growth factor (FGF) and PDGF), as well as anti-inflammatory (TGFβ1) and angiogenesis genes (Ang-1, vascular endothelial growth factor (VEGF), jagged 1) showed significant downregulation of these genes in the hypoxic wound tissue after 14 days of wound induction. However, the transfected MSC seeded scaffold group showed significant upregulation in the transfected MSC group when compared with control. The transfected MSC group showed significantly higher gene expression compared to that of normal MSCs. These results are presented in figure 5.

Figure 5.

Gene expression analysis: bar graphs showing the expression levels of cell survival and proliferation, anti-inflammatory, and angiogenesis genes in normal skin, wound model, collagen scaffold only transplanted group, and groups transplanted with normal MSC and jagged 1 transfected MSC seeded scaffolds. For statistical analysis, one-way ANOVA was performed, followed by the Bonferroni post hoc test. Data are presented as mean ± s.e.m. (n = 3). *p < 0.05, **p < 0.01 and ***p < 0.001.

3.7. Histological analysis of hypoxic wound model

Histological analysis showed skin degeneration in the hypoxic wound model as evident from H&E, and Masson's trichrome staining. Collagen fibres were disrupted in the wound tissue. Animals transplanted with collagen scaffold, MSC seeded scaffold, and jagged 1 transfected MSC seeded scaffold showed better tissue architecture and intact collagen fibres, as shown in figure 6.

Figure 6.

Histological analysis of wound tissue sections: H&E and Masson's trichrome staining showing tissue architecture after 14 days of wound induction and transplantation. Jagged 1 transfected MSC seeded scaffold group showed complete re-epithelialization with collagen ECM, vascularization and remodelling of the tissue framework with a distinct layer of epidermis and dermis without scar.

3.8. Immunohistochemical staining for the evaluation of angiogenesis

Angiogenesis in the hypoxic wound was evaluated by immunohistochemical staining against α-smooth muscle actin and VEGF. Significantly increased number of stained cells was observed in the jagged 1 transfected MSCs when compared with the control, confirming increased angiogenesis (figure 7).

Figure 7.

Immunohistochemical staining for α-SMA and VEGF. (a) Representative images of harvested tissue from normal, scaffold only, MSC seeded scaffold and jagged 1 transfected MSC seeded scaffold groups showing enhanced angiogenesis and VEGF expression. (b,c) Quantification of fluorescent intensity for α-SMA and VEGF by ImageJ. (d) Quantitative analysis of blood vessels in normal, scaffold only, MSC seeded scaffold, and jagged 1 transfected MSC seeded scaffold groups. Data are presented as mean ± s.e.m. (n = 3) with significance level ***p < 0.001.

4. Discussion

Healing of hypoxic wounds with complete anatomical and functional integrity of the skin, is a major clinical challenge [21,22]. MSCs have been explored for wound repair and regeneration in pre-clinical and clinical studies due to their tremendous potential to differentiate and regenerate injured tissue [21]. Novel methods have been employed to increase the delivery and efficacy of MSCs [21,23]. For better outcomes and to accelerate the wound healing process, stem cell therapy can be used in combination with tissue engineering approaches [23–25]. Some of our previous reports have demonstrated the effect of genetic and chemical modification of MSCs on improved angiogenesis. This includes genetic modification of MSCs with IL-7 with enhanced angiogenesis and wound tissue regeneration [26], and chemical modification of MSCs using isorhamnetin with upregulation in the gene and protein expression of growth factors involved in angiogenesis [20]. Similarly, dinitrophenol has been shown to modulate gene expression levels of angiogenic and cell survival factors in bone marrow derived MSCs [27]. In this study, we used genetically modified MSCs with three-dimensional collagen scaffold to treat hypoxic skin wounds. Genetic modification of stem cells with angiogenic factors and incorporation of these modified stem cells in an acellular collagen scaffold is expected to improve survival, homing and integration of the transplanted stem cells.

MSCs were isolated from rat bone marrow and characterized on the basis of their specific markers. These cells were transfected with the jagged 1 gene, and successful transfection was confirmed by the increased expression of jagged 1 gene and protein. Jagged 1, a Notch 1 ligand, is involved in a highly conserved Notch signalling pathway that plays a critical role in cellular fate determination and is active throughout the process of development. It is the potential target for the therapeutic modulation of angiogenesis. In the context of wound healing, jagged 1 has been reported in the initiation and maturation of angiogenesis [28,29]. Our findings of the in vitro matrigel assay showed that the transfected MSCs resulted in significantly higher numbers of tube-like structures, reflecting the angiogenic potential of transfected MSCs.

We successfully developed a hypoxic wound model in Wistar rats by incising a full-thickness skin flap. Increased expression of HIF-1α gene confirmed the successful development of the hypoxic wound. Normal and transfected MSC seeded three-dimensional collagen scaffolds were implanted in the wound tissues. Skin was harvested for macroscopic, as well as histochemical and gene expression analysis. We further analysed the protein expression of α-SMA and VEGF in both groups through immunohistochemical analysis. Angiogenesis is positively regulated via multiple paracrine factors, most importantly VEGF [30,31]. The process of angiogenesis is modulated by the action of thrombin via different mechanisms, including direct and indirect effects on the endothelium. Direct effects include strong stimulation of endothelial cell proliferation and migration, while the indirect effect is induced by the response of angiogenic stimuli and increased expression of adhesion receptors and integrin for endothelial cell survival and migration [32–34]. On the other hand, α-SMA is strongly expressed on different cell types, i.e. myofibroblasts, endothelial cells, hair follicles etc. In the process of wound healing, migration and deposition of fibroblasts are activated, resulting in the formation of mature myofibroblasts, which are characterized by the expression of α-SMA [30,33,35]. A similar pattern was observed in our study, when the skin wound tissues were stained with angiogenic factors, VEGF and α-SMA. Enhanced expression of α-SMA and VEGF confirmed neovascularization in the wound tissue treated with jagged 1 transfected MSC seeded scaffold when compared with the control.

These findings were further confirmed through the analysis of proliferation, anti-inflammatory and angiogenic genes. Wound tissues of all groups were harvested at Day 14 and transcriptional analysis was performed. A variety of wound healing mediators has been identified that aids in the wound healing phases. Skin usually secretes these mediators at the basal levels, to maintain skin homeostasis [36]. However, due to tissue insult or trauma, a highly coordinated cellular interaction via complex cytokine networks, is activated to restore the integrity and functionality of the injured tissue [37]. Proliferative cytokines (TGF-β, PDGF, FGF and EGF) interact mainly in the cell proliferation phase which begins with the production of new collagen fibres to reform the ECM. Fibroblasts are the predominant cells in this phase that can be triggered by increased level of FGF, PDGF and TGF-β [38,39]. In the case of hypoxic microenvironment, fibroblasts release various cytokines including VEGF, FGF, transforming growth factor (TGF) and EGF that promote neovascularization and re-epithelialization [7]. Based on these properties, we analysed these cytokines, and observed that they are upregulated in the wound tissues transplanted with jagged 1 transfected MSC scaffolds. We further analysed the expression of angiogenic genes (VEGF, jagged 1 and Ang-1) in the transplanted groups. Our results are consistent with the reported studies that time-dependent expression of wound healing mediators is crucial for the progression of wound healing process especially for proliferation and neovascularization.

Furthermore, we observed increased granulation tissue, collagen deposition and remodelling due to enhanced vascularization in the regenerated tissue, which showed tissue integrity after transplantation of the three-dimensional scaffolds. Histological examination of the wound tissue transplanted with collagen scaffold showed destruction of the dermal layer and loose collagen network when compared with the other groups. In the case of wound tissue that received MSC seeded scaffold, intact layers with dense collagen fibres were observed indicating active healing process. We also noted enhanced neovascularization and re-epithelialization in the wound tissue treated with jagged 1 transfected MSC seeded scaffold, implying a significant role of jagged 1 transfected MSC seeded scaffold in the acceleration of the wound healing process and wound tissue regeneration.

5. Conclusion

Findings of this study revealed that the application of a three-dimensional scaffold played a potential role in the better survival and adherence of bone marrow MSCs at the wound site. The jagged 1-transfected MSC-seeded scaffold in the hypoxic wound significantly improved wound healing. Tissue architecture exhibited better healing of dermal and epidermal layers with a significantly higher number of blood vessels. It can be concluded from this study that the combination of a three-dimensional collagen scaffold along with jagged 1 transfected MSCs enhanced the wound healing process of full-thickness hypoxic wounds in rats. Genetically modified adult stem cells incorporated into an acellular scaffold is an advanced targeted approach that could effectively heal the wound and has the potential to be translated into clinical settings for targeted personalized therapy.

Ethics

This study was performed in compliance with the international standards. The experimental protocol was approved by the institutional ethical committee for use and care of laboratory animals (protocol no. 2017-0060).

Data accessibility

This article has no additional data.

Authors' contributions

I.K.: investigation, supervision, validation, writing—original draft; M.N.S.: formal analysis, investigation, methodology; F.J.: formal analysis, investigation, methodology, writing—original draft; R.Q.: formal analysis, investigation, methodology; A.S.: conceptualization, project administration, supervision, writing—review and editing; S.A.: formal analysis, investigation, methodology; M.B.Z.: formal analysis, investigation, methodology.

All authors gave final approval for publication and agreed to be held accountable for the work performed therein.

Conflict of interest declaration

We declare we have no competing interests.

Funding

We received no funding for this study.