In vitro Transformation and Selection of Treponema pallidum subsp. pallidum

Abstract

Although the isolation of Treponema pallidum subsp. pallidum (T. pallidum) from a syphilis patient dates to 1912, this pathogen has remained an exceedingly difficult organism to study due to the lack of a system to support its viability in vitro for the duration of the 20^th century. Such limitation, in turn, precluded the application of genetic engineering techniques via transformation and subsequent selection of T. pallidum transformants. A recently described method for in vitro cultivation of T. pallidum, however, has made it possible for us to experiment with transformation and selection methods. Here, we describe the approach we adopted to successfully transform T. pallidum with foreign DNA and select the resulting recombinant strain using kanamycin.

Basic Protocol 1: Transformation of T. pallidum.

Support Protocol 1: Quantification of T. pallidum in suspensions using dark-field microscopy.

Support Protocol 2: Counting cells using a hemacytometer.

Basic Protocol 2: Selection, initial passaging, and expansion of transformed cultures.

Basic Protocol 3: Isolation of a clonal strain through limiting dilution.

INTRODUCTION

Because of the importance of syphilis to human health, considerable effort has been placed to understand the biological basis for the virulence of Treponema pallidum subsp. pallidum (T. pallidum) and the pathogenesis of this serious infection since the isolation of the first syphilis strain over a century ago (Nichols & Hough, 1913). A better understanding of the biological basis for syphilis would help devise more effective measures for disease control. To this end, the ability to apply genetic engineering approaches to ablate T. pallidum genes and evaluate their contribution to virulence would be of significant help. Despite more than a century of research, however, genetic manipulation of T. pallidum had not previously been achieved, mostly due to the inability of investigators to propagate this pathogen outside of the rabbit host. A recently described method to continually propagate T. pallidum in vitro using a cell culture-based system (Edmondson, Hu, & Norris, 2018), however, paved the way to experimenting with transformation and selection procedures to introduce foreign DNA into T. pallidum. Here, we describe a protocol (Basic Protocol 1) to introduce exogenous DNA into T. pallidum using a CaCl₂-based transformation buffer and to select the resulting recombinant strain using kanamycin (Basic Protocol 2). Additionally, because T. pallidum in vitro growth does not result in formation of macroscopic colonies that can be picked and expanded in fresh culture media, we report our post-transformation approach to obtain a clonal T. pallidum strain using limiting dilution (Basic Protocol 3). Recently, these combined protocols allowed us to obtain the first ever knock-out T. pallidum strain, where the tprA (tp0009) locus was entirely replaced with a kanamycin resistance cassette (kan^R) under control of a strong T. pallidum promoter (Romeis et al., 2021). This transformation/selection protocol will enable investigators to selectively eliminate T. pallidum genes and assess their role in the virulence of the microorganism. This protocol will also allow experimenting with more advanced genetic tools available for other spirochetes (Chi, Chauhan, & Kuramitsu, 1999; Kuramitsu, Chi, & Ikegami, 2005; Li & Kuramitsu, 1996; Saraithong et al., 2020) to attain transposon mutagenesis or T. pallidum-specific shuttle vectors for complementation of knock-out strains. Furthermore, attenuated strains that might result from ablating non-essential virulence factors could help current endeavors aimed at developing an effective syphilis vaccine.

CAUTION: T. pallidum is a Biosafety Level 2 (BSL-2) pathogen. Appropriate guidelines and regulations for the use and handling of pathogenic microorganisms must be followed while handling T. pallidum. Review the Biosafety paragraph (Strategic Planning section, below) prior to engaging in the procedure described in this protocol. Personal protective equipment (lab coat, eye protection, gloves) should be used whenever risk of exposure to infected materials is possible.

NOTE: T. pallidum cells kept in equilibrated TpCM-2 media alone (without Sf1Ep cells) can survive for several hours if kept in the tri-gas incubator, but cells will quickly lose viability in presence of normal atmospheric oxygen concentrations. Do not allow treponemes to be outside of the tri-gas incubator culture plates for more than 1 hour following harvest. Procedures need to be carried out quickly, but not to the detriment of the operator’s safety.

NOTE: Reagents and equipment should be prepared in advance because rapid harvesting and re-inoculation of treponemes into culture plates is essential for optimal survival and to maximize the yield of organisms.

NOTE: T. pallidum growth is dependent on co-cultivation with rabbit Sf1Ep epithelial cells (Edmondson et al., 2018). Successful cell culture depends -aside from factors that pertain to T. pallidum biology - on keeping cells free from contamination by environmental microorganisms. Cultures are grown without antibiotics prior to transformation, and kanamycin for selection is not added immediately. Therefore, all necessary precautions must be taken to avoid contamination with environmental microorganisms. Nonsterile supplies and reagents, unclean incubators and work surfaces are sources of biological contamination, and great attention should be taken to implement procedures (aseptic technique) that decrease the probability of contamination with environmental microorganisms. Proper aseptic technique encompasses the use of a disinfected work area, observation of hand hygiene, sterile reagents, and proper sterile handling. To this end:

1. Before and after use, the work surface should be disinfected with 10% bleach and 70% ethanol.

2. The cell culture hood work surface should only contain items required for a procedure.

3. Wash hands before and after working with cultures, even if you will be wearing gloves.

4. In addition of reducing the possibility of exposure to T. pallidum, wearing personal protective equipment (PPE) also reduces the probability culture exposure to microorganism-carrying dust from clothes.

Proper sterile handling requires the following:

1. Always wipe your (gloved) hands with 70% ethanol.

2. Wipe the outside of containers (e.g., flasks, plates, tubes of media, etc.), with 70% ethanol before placing them in the hood.

3. Avoid pouring media and reagents directly from bottles or flasks but use disposable plastic pipettes and a pipettor. Use each pipette only once and unwrap it only when it is to be used.

4. If a cap or cover is removed from a flask or a bottle, place the cap with the opening facing down. Always cap bottles and flasks after use.

5. Perform your experiments as rapidly as possible, but not to the detriment of safety.

STRATEGIC PLANNING

Biosafety

Handling of T. pallidum cultures requires a BSL-2 laboratory. All personnel working with T. pallidum should be properly trained to avoid exposure to the pathogen. In certain cases, but not all, exposure to the pathogen will require antibiotic treatment to prevent infection. All personnel working with T. pallidum should wear appropriate personal protective equipment (PPE) which includes lab coat, gloves, and eye splash protection. Masks are not required but encouraged. Spontaneous aerosolization of T. pallidum from suspensions should not occur during the procedures described herein, although splashing of organisms from pipettes and other liquid handling tools is possible. The transformation procedures do not require the use of syringes and therefore the risk of accidental self-inoculation via needlestick is null. Nonetheless, infections of laboratory personnel can occur by spillage or splashing of suspensions of treponemes on mucosal surfaces or open skin. Although this infection is not transmitted through intact skin, in case of exposure, skin should be washed with soap and disinfected thoroughly. In case of suspected or known accidental exposure that might lead to infection, laboratory personnel should receive treatment with an antibiotic regimen known to be effective for incubating syphilis without waiting for symptoms to develop. Additionally, the allegedly exposed individual should be monitored serologically at the time of treatment and three months post-treatment completion to confirm lack of infection. An exposure plan with clear directions to react to an exposure incident and guidelines for prophylactic treatment protocol approved by the institution’s Environmental Health and Safety and Employee Health offices must be always available in the laboratory. All waste from T. pallidum cultures should be disposed of in a properly labeled biohazard container to minimize risk of exposure. Suspensions of treponemes can be disinfected using Clidox (chlorine dioxide), phenol-based disinfectants (e.g., vesphene), or 5% bleach (sodium hypochlorite). Spills or splashes should be immediately contained, and the area disinfected with one of the agents listed above.

Suicide vector design

We clone the sequence to be inserted into T. pallidum genome into a pUC57 plasmid backbone (https://www.addgene.org/vector-database/4509/). This sequence consists of the Proteus vulgaris kanamycin resistance gene (kan^R, available at https://www.ncbi.nlm.nih.gov/nuccore/AP004237.1; nt 117878-118693) under transcriptional control of the tp0574 promoter-ribosomal binding site (AGCGGATCCTCCCAAAAAGAGGAAGGACGCGCCTGTGTG TGCTC TGCATAAGACGTTGACAAT CCCTGTGGGGCGTGCCTATACTCAGGCCCTCTATACGGAGGTGTAATC) followed by the ATG of the kan^R gene. In the plasmid, the kan^R insert is surrounded by two 1-Kb homology arms to trigger a double cross-over recombination event. The homology arms-tp0574 promoter-kan^R insert is produced as a synthetic DNA molecule that is cloned within the pUC57 polylinker between one or two restriction sites chosen based on the compatibility between the insert sequence and the pUC57 sites in the polylinker. Final orientation of the insert is unimportant. Gene synthesis for our experiments is generally performed by Genscript (https://www.genscript.com/).

Sf1Ep cells

T. pallidum in vitro propagation requires co-cultivation of this spirochete with rabbit Sf1Ep cells. These cells need to be low-passage. We use Sf1Ep that were passages fewer than 60 times. Upon reaching the 60^th passage, a new stock of low-passage cells is expanded and used to continue T. pallidum propagation.

BASIC PROTOCOL 1 Transformation of Treponema pallidum subsp. pallidum

Introductory paragraph

Upon performing the steps of Basic Protocol 1 (BP1) correctly, one should expect to attain transformation of T. pallidum cells with a foreign DNA construct. A flowchart of the procedures is reported in Fig.1. The protocol requires a) a highly concentrated, pre-designed/engineered DNA construct, b) T. pallidum and Sf1Ep cells from routine propagation, and c) a CaCl₂-based transformation buffer. The hazards of handling T. pallidum cells have been described above. This protocol does not require additional materials or reagents that could constitute a biological, chemical, or physical hazard to the operator. Culturing of T. pallidum is performed according to Edmondson et al. (Edmondson & Norris, 2021). In the first published use of this protocol (Romeis et al., 2021), we transformed T. pallidum with a pUC57-based plasmid construct carrying a Proteus vulgaris kanamycin resistance (kan^R) cassette in its polylinker. In the construct, the kan^R gene was preceded by a strong T. pallidum promoter from the tp0574 gene, previously described (Weigel, Brandt, & Norgard, 1992). The resistance gene was cloned between two 1-Kb homology arms to drive integration of the kan^R gene into the tprA (tp0009) locus of T. pallidum, harboring a pseudogene. As a result, the tprA (tp0009) pseudogene was entirely replaced by the kan^R cassette through a double-crossover homologous recombination event. A schematic of the transformation (Basic Protocol 1) and subsequent selection (Basic Protocol 2, below) is provided in Fig.2. In the protocol below, the actual transformation step occurs at Day 0, and a series of procedures are needed in the 5 days leading to Day 0 to successfully arrive to this step. Materials are organized below accordingly.

Figure 1.

Flowchart representing the steps of the transformation/selection experiment reported in Basic Protocols 1/2.

Figure 2.

Schematic of the steps of the transformation/selection experiment reported in Basic Protocols 1/2.

Materials

For Day −5 procedure

• Trypsin-EDTA (Sigma, cat. no. T4049)

• Cottontail Rabbit Epithelial Cells (Sf1Ep cells; ATCC® CCL-68 or equivalent) routinely propagated in vitro in T-25 flask, as in (Edmondson & Norris, 2021)

• Sf1Ep media (see Reagents and Solutions section for formulation) *

  * Media needs to be prepared in advance. Prepare 5 ml for each T-25 flask and 30 ml for each transformation experiment, in addition to what is needed for routine propagation.

• Trypan-blue solution (Sigma, cat. no. T8154)

• Water bath set at 42°C

• T-25 flask containing Sf1Ep ongoing culture

• Tissue culture incubator set at 37°C and 5% CO₂ atmosphere

• Inverted microscope (Nikon Ts2 or equivalent)

• Sterile 50 ml conical centrifuge tubes (ThermoFisher Scientific, cat. no. 339660)

• Motorized pipettor (Pipet-X Pipet Controller PX-100, Raining cat. no. 17011733 or equivalent)

• 5 ml serological pipettes (Corning, cat. no. CLS4487 or equivalent)

• Transfer pipette (Sigma, cat. no. Z350605)

• Single channel 20 μl manual pipette (Rainin, cat. no. 17014392)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2749-HR)

• Hemacytometer (ThermoFisher Scientific, cat. no. 0267110)

• Light microscope with 40X objective (Leica DM750 or equivalent)

• Sterile 24-well culture plates with low-evaporation lids (Sigma, cat. no. SIAL0524)

• Single channel 1000 μl manual pipette (Rainin, cat. no. 17014382)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2779-HR)

• Disposable sterile polyethersulfone (PES) vacuum filtration unit with 0.2-μm pore size (Thermo Fisher Scientific, cat. no. 564-0020)

• Humidified tri-gas incubator maintained at 34°C, 1.5% O₂, 5% CO₂ and 93.5% N₂

For Day −4 procedure

• TpCM-2 media (see Reagents and Solutions section for formulation)

• Trypsin-EDTA (Sigma, cat. no. T4049)

• T. pallidum cells routinely propagated in vitro in 6-well plate, as in (Edmondson & Norris, 2021)

• 24-well culture plate containing seeded Sf1Ep cells from Day −5

• Vacuum aspirator device (inside the biosafety cabinet)

• Single channel 1000 μl manual pipette (Rainin, cat. no. 17014382)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2779-HR)

• Motorized pipettor (Pipet-X Pipet Controller PX-100, Raining cat. no. 17011733 or equivalent)

• 10 ml serological pipettes (ThermoFisher Scientific, cat. no. 170356 or equivalent)

• Water bath set at 42°C

• 6-well culture plate containing T. pallidum cells from routine propagation

• Sterile 50 ml conical centrifuge tubes (ThermoFisher Scientific, cat. No 339650)

• Tissue culture incubator set at 37°C and 5% CO₂ atmosphere

• Sterile 15 ml conical centrifuge tubes (ThermoFisher Scientific, cat. No 339651)

• Centrifuge (Eppendorf 5702 R or equivalent)

• Single channel 20 μl manual pipette (Rainin, cat. no. 17014392)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2749-HR)

• Microscope equipped with a dark-field condenser or dark-field microscope (Nikon Eclipse NiU darkfield microscope, or equivalent)

• Humidified tri-gas incubator maintained at 34°C, 1.5% O₂, 5% CO₂ and 93.5% N₂

For Day 0 procedure

• CaCl₂ transformation buffer with and without foreign DNA (see Reagents and Solutions section for formulation)

• TpCM-2 media (see Reagents and Solutions section for formulation)*

  * Media needs to be prepared in advance. Prepare 20 ml for each transformation plate, in addition to what is needed for routine propagation.

• 24-well culture plate containing seeded Sf1Ep and T. pallidum cells from Day −4

• Vacuum aspirator device (inside the biosafety cabinet)

• Single channel 1000 μl manual pipette (Rainin, cat. no. 17014382)

• Single channel 200 μl manual pipette (Rainin, cat. no. 17014391)

• Single channel 20 μl manual pipette (Rainin, cat. no. 17014392)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2779-HR, 2769-HR, and 2749-HR)

• Humidified tri-gas incubator maintained at 34°C, 1.5% O₂, 5% CO₂ and 93.5% N₂

Protocol steps with step annotations

Preparation of transformation plates (Day −5)

Seeding Sf1Ep cells

• 1Retrieve a 10 ml trypsin-EDTA aliquot from the freezer and place in the 42°C water bath until fully thawed, then remove and place in the biosafety cabinet.
• 2Remove the T-25 flask containing Sf1Ep cells (seeded a week earlier as in (Edmondson & Norris, 2021)) from the tissue culture incubator and roughly assess confluency by observing the flask with the inverted microscope*.

  *Cells should be at ~70% (or higher) confluency. This ensures that enough cells will be retrieved for the subsequent steps.

• 3Place the T-25 flask into the biosafety cabinet, open the lid and pour exhausted media into a 50 ml centrifuge tube.
• 4Using a 5 ml serological pipette, add 1 ml of trypsin-EDTA to the flask, gently rotate the flask to rinse off any remaining media and discard into the 50 ml conical tube.
• 5Using a 5 ml serological pipette, add 4 ml of trypsin into the flask.
• 6Return the flask to the tissue culture incubator and incubate for 5 minutes, then remove the flask from the incubator.
• 7Assess cell detachment using the inverted microscope. If necessary, gently agitate the flask to facilitate the cell dissociation process and then place the flask back into the biosafety cabinet*.

  *If detachment has not occurred, incubate additional 5 minutes in tissue culture incubator, not exceeding 10 minutes total incubation time. If detachment is still unsuccessful, discard trypsin and repeat steps 4–7 with a different 10-mL trypsin-EDTA aliquot.

• 8Retrieve Sf1Ep cell growth media from the refrigerator (4°C).
• 9Using a 5 ml serological pipette, add 4 ml of Sf1Ep media to flask to stop trypsinization and gently agitate the flask.
• 10Using a transfer pipette, homogenize the cell suspension by pipetting up and down and by washing the flask surface where cells were previously attached*.

  *This process reduces cell clumping and ensures a more accurate cell count.

• 11Perform a formal count of the viable Sf1Ep cells using the hemacytometer (See Support Protocol 2).
• 12In the biosafety cabinet, open a sterile 24-well culture plate and seed four wells with Sf1Ep cells using the 1000 μl single-channel pipette*.

  *To achieve the requisite number of Sf1Ep cells, prepare a dilution of harvested Sf1Ep cells to a concentration of 2×10⁴ cells/ml, then use 1 ml to seed each well.

• 13Add 1 ml of Sf1Ep media to each well using the 1000 μl single channel pipette, bringing the total volume to 2 ml per well.
• 14Transfer the plate to the tissue culture incubator overnight to allow for Sf1Ep cell adhesion to the well bottom.
• 15Disinfect and discard the 50 ml conical tube containing exhausted media and residual trypsin.

Preparing TpCM-2 Medium

• 16Prepare 50 ml of TpCM-2 media as instructed in the Reagents and Solutions section*.

  *If performing routine propagation of T. pallidum in addition to the transformation plate, prepare enough TpCM-2 as needed for 6-well plate, as in (Edmondson et al., 2018).

• 17Filter-sterilize prepared TpCM-2 media using a disposable sterile vacuum filtration unit with 0.22-μm pore size. Following filtration, cap the media reservoir.
• 18Incubate the filtered TpCM-2 media overnight in the tri-gas incubator to equilibrate the media. Loosen the reservoir lid to allow gas exchange.

T. pallidum inoculation (Day −4)

• 19Retrieve the 24-well plate seeded the previous day from the tissue incubator and transfer to the biosafety cabinet.
• 20Retrieve the equilibrated TpCM-2 from the tri-gas incubator and transfer it to the biosafety cabinet.
• 21Remove the Sf1Ep media from each well by vacuum aspiration.
• 22To remove any residual Sf1Ep media, rinse each well with equilibrated TpCM-2 by slowly adding 1 ml from the side of the well with the 1000 μl single channel pipette, being careful not to disturb attached cells. Aspirate media to discard the TpCM-2 rinse.
• 23Using a 10 ml serological pipette, add 2.5 ml of fresh equilibrated TpCM-2 to each well.
• 24Place plate into tri-gas incubator for no less than three hours*.

  *After ~3 hours, continue with step 25.

• 25Retrieve a 10 ml trypsin-EDTA aliquot from the freezer and place it in the 42°C water bath until fully thawed, then remove and place in the biosafety cabinet.
• 26Retrieve from the tri-gas incubator the 6-well plate containing T. pallidum cells that have been growing for one week as per (Edmondson & Norris, 2021) and place it in the biosafety cabinet*.

  *Do not proceed with step 9 if contamination is seen in the wells. If there are contaminated wells, the media will appear cloudy instead of clear.

• 27Remove all media from the 6-well plate with a 10 ml serological pipette and move into a 50 ml conical tube. Save this media for later steps.
• 28Rinse each well of the plate containing the T. pallidum culture by adding 350 μl of trypsin-EDTA per well and quickly aspirating the rinse from each well to avoid cell trypsinization, moving rinse to same 50 ml conical tube containing old media.
• 29Add again 350 μl of fresh trypsin-EDTA to each of the wells.
• 30Move plate to the tissue culture incubator (not the tri-gas incubator) and incubate for five minutes.
• 31Remove plate from the incubator and assess cell detachment using the inverted microscope*.

  *If detachment has not occurred, incubate additional 5 minutes in tissue culture incubator, not exceeding 10 minutes total incubation time. If detachment is still unsuccessful, discard trypsin and repeat steps 28–31 with different 10-mL trypsin-EDTA aliquot.

• 32Add 650 μl of previously saved TpCM-2 media (step 27) back into each well to stop the trypsinization reaction.
• 33Using single channel pipette set at 650 μl, gently pipet cell suspension up and down across the bottom of the well while holding plate at an angle to ensure that all trypsinized cells are in the suspension.
• 34Using a 1000 μl single channel pipette, pool the cell suspension resulting from trypsinization into a single 15 ml conical tube.
• 35Centrifuge suspension at 130 RCF for 5–10 minutes at room temperature to pellet Sf1Ep cells. Transfer the supernatant to a new 15 ml conical tube without disturbing the pellet*.

  *Centrifuging the cell suspension mixture will not pellet treponemes, which will remain in the supernatant. This will allow for a more accurate formal count of T. pallidum cells.

• 36Remove 18μL of the T. pallidum cell suspension from the supernatant and proceed to formally count treponemes using a dark-field microscope. (See Support Protocol 1)*.

  *Treponemes will not survive for long in suspension. Complete the formal count quickly and return to the biosafety cabinet to complete preparation of the 24-well plate wells previously seeded with Sf1Ep cells to add treponemes.

• 37Remove the prepared 24-well plate from the tri-gas incubator and place it in the biosafety cabinet, then remove TpCM-2 media by vacuum aspiration.
• 38Quickly add T. pallidum from the cell suspension to the 24-well plate. Aim at adding no less than 5×10⁷ T. pallidum cells (or more)* in a volume not exceeding 1.5 ml/well**.

  *Inoculating below 5×10⁷ T. pallidum cells is not recommended. The higher the T. pallidum inoculum, the faster transformed treponemes will be recovered following transformation and selection. We not yet have data on transformation efficiency for T. pallidum. Whenever possible, inoculate above 5×10⁷ cells.

  **If the inoculum exceeds 1.5 ml in volume, a media exchange is recommended 24 hours after the addition of treponemes. In this case, retrieve the plate, discard 1 ml of the old TpCM-2 media from each well using the 1000 μl single channel pipette and replace with 1 ml of fresh equilibrated TpCM-2 medium.

• 39Add fresh equilibrated TpCM-2 medium to bring final volumes in each well to 2.5 ml.
• 40Return the 24-well plate to the tri-gas incubator and let the suspension incubate for two days.
• 41Prepare a stock of 2X CaCl₂ transformation buffer to be used on transformation day (Day 0) and store at 4⁰C.
• 42Ensure that the DNA construct to be used in the transformation experiment is ready by Day 0.

T. pallidum transformation (Day 0)

• 43
  Retrieve the 2X CaCl₂ transformation buffer prepared earlier from storage (4°C) and use it to prepare:

  1. 1 ml of 1X CaCl₂-based transformation buffer containing foreign DNA* (see Reagents and Solutions section for formulation).
  2. 1 ml of 1X CaCl₂ transformation buffer without any foreign DNA (see Reagents and Solutions section for formulation).
     *For the experiment described in Romeis et al. (2021) we used 15 μg of plasmid DNA (final concentration: 30 ng/μl). To obtain sufficiently concentrated plasmid to be diluted to the necessary concentration, we use the Qiagen Plasmid Mega Kit (Qiagen, Cat. No./ID:12181).
• 44Retrieve the 24-well plate from the tri-gas incubator and place it in the biosafety cabinet along with the transformation buffers from step 1.
• 45Aspirate the TpCM-2 media from two of the wells and discard*.

  *One of the two wells will be used for the actual transformation experiment, while the second will be used as control, to test whether T. pallidum is not harmed by exposure to the CaCl₂ buffer alone.

• 46Apply 500 μl of 1X CaCl₂ transformation buffer (w/o transforming DNA) to one of the two wells and apply 500 μl of 1X CaCl₂ solution with transforming DNA to the other well. Make sure the wells are appropriately labelled.
• 47Return the plate to the tri-gas incubator and incubate it for 10 minutes.
• 48Retrieve the plate, remove the transformation buffer from both wells using a 1000 μl single channel pipette and discard.
• 49Gently rinse wells twice with 500 μl of fresh equilibrated TpCM-2 medium, being careful not to disturb the cells, and remove each rinse with the vacuum aspirator.
• 50Add 2.5 ml of fresh equilibrated TpCM-2 medium to the well.
• 51Aspirate exhausted media from wells 3 and 4 and replace with 2.5 ml fresh equilibrated TpCM-2.
• 52Return plate back into the tri-gas incubator and leave the plate for 24 hours.

SUPPORT PROTOCOL 1 Quantification of T. pallidum in suspensions using dark-field microscopy

Introductory paragraph

Neither bright-field microscopy or typical bacteriological stain protocols are useful to quantify T. pallidum in suspensions. However, this spirochete can be clearly visualized using a microscope equipped with a dark-field condenser. In addition to quantify treponemal concentration and total burden, this approach allows the count of viable treponemes by assessing their motility as a surrogate for viability. In such case, however, operator needs to be able to distinguish spirochetal motility from Brownian motion. Because multiple microscopic fields need to be counted for accuracy, it is recommended to use dilutions of the suspensions to attain 10–20 cells per microscopic field, and then account for the dilution factor in the subsequent calculations. We employ dark-field microscopy to quantify treponemes as described below.

Materials

• Treponemes harvested from culture wells (See Basic Protocol 1)

• Microscope equipped with a dark-field condenser or dark-field microscope (Nikon Eclipse NiU darkfield microscope or equivalent)

• Condenser oil (Resolve, Immersion Oil, Epredia, VWR cat. no. 48218-402)

• Slide micrometer (AmScope Microscope Stage Micrometer Calibration Slide TCM-H with a 0.01 mm line resolution, cat. no. MR095)

• Microscope slides and 22 × 40–mm coverslips (ThermoFisher Scientific, cat. no. 12-550-109 and Corning cat. no. 2980224, respectively)

Protocol steps with step annotations

1. Measure the radius (r) of the 40× microscope field using the slide micrometer and calculate the area (A) using the formula A=2πr.

2. Place a measured amount (e.g., 18 μl) of treponemal suspension on a microscope slide and cover with a 22 × 40–mm coverslip*, avoiding bubbles.

   Calculate the fluid depth by dividing the volume (ml or cm³) by the area of the coverslip (cm²). In this case: 0.019 cm³/8.8 cm² = 0.02 mm.

   *Other suspension volumes and coverslips sizes may also be used.

3. Calculate the volume of fluid (ml) viewed in a microscope field by multiplying the field area (step 1) by the fluid depth (step 2).

4. Count the number of treponemes in 10 microscope fields, being certain to count organisms in all planes of focus in each field.

5. Calculate the number of treponemes per ml of suspension by applying the formula below: treponemes/ml = total treponemes counted in 10 fields/(10 fields × field volume in ml).

SUPPORT PROTOCOL 2 Counting Sf1Ep cells using a hemacytometer

Introductory paragraph

For the majority of manipulations using cell lines, including routine subculturing, it is necessary to quantify the number of cells prior to use. Using a consistent number of cells will maintain optimum cell and treponemal growth and help standardize procedures to ensure reproducibility.

Materials

• 70% (v/v) Ethanol in water

• Trypsinized Sf1Ep cells (See Basic Protocol 1)

• Trypan Blue solution, 0.4% (Sigma, cat. no. T8154)

• Hemacytometer (ThermoFisher Scientific, cat. no. 0267110)

• Single channel 20 μl manual pipette (Rainin, cat. no. 17014392)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2749-HR)

• Light microscope with 10X objective (Leica DM750 or equivalent)

• Tally counter

Protocol steps with step annotations:

Preparing the hemacytometer

• 1Clean with 70% ethanol the hemacytometer and coverslip before use if they do not appear clean.
• 2Affix the coverslip to the hemacytometer and affix to the hemacytometer.

Preparing the Sf1Ep cell suspension

• 3Gently swirl the Sf1Ep cell suspension to ensure cells are evenly distributed.
• 4Before the cells settle, take out 0.1 ml of cell suspension with a 100-μl pipette and place in an Eppendorf tube.
• 5Add 400 μl of 0.4% Trypan Blue. Mix gently.

Cell Counting

• 6Using a pipette, take 100 μl of Trypan Blue-treated cell suspension and apply to the hemacytometer.
• 7Fill both chambers underneath the coverslip, allowing the cell suspension to be drawn out by capillary action.
• 8Transfer hemacytometer to the microscope and focus on the grid lines of the hemacytometer with a 10X objective.
• 9Use the tally counter to count unstained cells (live cells do not take up Trypan Blue) in one set of 16 squares. Only count cells when they are set within a square or on the right-hand or bottom boundary line.
• 10Move the hemacytometer to the next set of 16 corner squares and carry on counting until all 4 sets of 16 corners are counted.

Calculating the number of viable cells/ml

• 11Take the average cell count from each of the sets of 16 corner squares.
• 12Multiply by 10,000.
• 13Multiply by 5 to correct for the 1:5 dilution from the Trypan Blue addition.
• 14The final value is the number of viable cells/ml in the original cell suspension.

BASIC PROTOCOL 2 Selection and expansion of transformed cultures

Introductory paragraph

Following transformation, selection of treponemes that have successfully incorporated the kan^R cassette is necessary to rid the culture of non-transformed, wild-type treponemes. This is achieved by adding kanamycin to the TpCM-2 media. The kanamycin concentration was established based on in vitro susceptibility assay performed in prior studies and reported in (Romeis et al., 2021). Upon addition of kanamycin, one should expect a rapid decline in T. pallidum yield due to negative selection of non-transformed treponemes, and a slow recovery of resistant cells over a time variable from two to several weeks, during which the population of recombinant treponemes is expanded to obtain enough cells to assess kan^R integration into the genome. These assays may include qualitative PCR, digital droplet quantitative PCR, and whole-genome sequencing as described in (Romeis et al., 2021), but are ultimately dependent on the experimental design and the target gene. Kanamycin is added on the first day of this experiment and, two days later, a growth media exchange is performed to keep supporting treponemal growth and maintain antibiotic pressure. On the nineth day post-kanamycin addition, cultures are passaged until cellular yield is sufficient to move T. pallidum to a 24-well plate. The hazards of handling T. pallidum cultures have already been described above, and this protocol does not pose any additional safety concern for the operator.

Materials

For Day 1 procedure

• Kanamycin (aliquot) stock, 25 mg/mL

• 24-well transformation plate from Day 0

• Single channel 200 μl manual pipette (Rainin, cat. no. 17014391)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2769-HR)

• Humidified tri-gas incubator maintained at 34°C, 1.5% O2, 5% CO2 and 93.5% N2

For Day 3 procedure

• TpCM-2 media as instructed in the Reagents and Solutions section

• Kanamycin (aliquot) stock (25 mg/ml)

• 24-well transformation plate from Day 1

• Vacuum aspirator device (inside a biosafety cabinet)

• 10 ml Serological pipettes (ThermoFisher Scientific, cat. no. 170356 or equivalent)

• Motorized pipettor (Pipet-X Pipet Controller PX-100, Raining cat. no. 17011733 or equivalent)

• Single channel 200 μl manual pipette (Rainin, cat. no. 17014391)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2769-HR)

For Day 9 procedure

• Trypsin-EDTA (Sigma, cat. no. T4049)

• Cottontail Rabbit Epithelial Cells (Sf1Ep cells; ATCC CCL-68 or equivalent) routinely propagated in vitro in T-25 flask, as in (Edmondson & Norris, 2021)

• Sf1Ep media (see Reagents and Solutions section for formulation)*

  *Media needs to be prepared in advance. Prepare 5 ml for each T-25 flask and 10 ml for each transformation experiment, in addition to what is needed for routine propagation.

• Trypan-blue solution (Sigma, cat. no. T8154)

• Water bath set at 42°C

• T-25 flask containing Sf1Ep ongoing culture

• Tissue culture incubator set at 37°C and 5% CO₂ atmosphere

• Inverted microscope (Nikon Ts2 or equivalent)

• Sterile 50 ml conical centrifuge tubes (ThermoFisher Scientific, cat. no. 339660)

• Motorized pipettor (Pipet-X Pipet Controller PX-100, Raining cat. no. 17011733 or equivalent)

• 5 ml serological pipettes (Corning, cat. no. CLS4487 or equivalent)

• Transfer pipette (Sigma, cat. no. Z350605)

• Single channel 20 μl manual pipette (Rainin, cat. no. 17014392)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2749-HR)

• Hemacytometer (ThermoFisher Scientific, cat. no. 0267110)

• Light microscope with 40X objective (Leica DM750 or equivalent)

• Sterile 24-well culture plates with low-evaporation lids (Sigma, cat. no. SIAL0524)

• Single channel 1000 μl manual pipette (Rainin, cat. no. 17014382)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2779-HR)

• Disposable sterile polyethersulfone (PES) vacuum filtration unit with 0.2-μm pore size (Thermo Fisher Scientific, cat. no. 564-0020)

• Humidified tri-gas incubator maintained at 34°C, 1.5% O₂, 5% CO₂ and 93.5% N₂

For Day 10 procedure

• Trypsin-EDTA (Sigma, cat. no. T4049)

• TpCM-2 media (See Reagents and Solutions section for formulation)*

  *Media needs to be prepared in advance. Prepare 20 ml for each transformation experiment, in addition to what is needed for routine propagation.

• Sterile glycerol (if taking glycerol stocks)

• 1X Lysis Buffer or equivalent (if collecting samples for DNA isolation) (See Reagents and Solutions section for formulation)

• TRIzol Reagent or equivalent (if collecting samples for RNA isolation) (ThermoFisher Scientific, cat. no. 15596026)

• Water bath set at 42°C

• 24-well transformation plate from Day 3

• Vacuum aspirator device (inside biosafety cabinet)

• Tissue culture incubator set at 37°C and 5% CO₂ atmosphere

• Sterile 50 ml conical centrifuge tubes (ThermoFisher Scientific, cat. no. 339660)

• Single channel 1000 μl manual pipette (Rainin, cat. no. 17014382)

• Inverted microscope (Nikon Ts2 or equivalent)

• 1.5 ml microcentrifuge tubes (ThermoFisher Scientific, cat. no. 05-408-130)

• Centrifuge (Eppendorf 5702 R or equivalent)

• Motorized pipettor (Pipet-X Pipet Controller PX-100, Raining cat. no. 17011733 or equivalent)

• 10 ml Serological pipettes (ThermoFisher Scientific, cat. no. 170356 or equivalent)

• Single channel 200 μl manual pipette (Rainin, cat. no. 17014391)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2769-HR)

• 2 ml cryogenic vials (if taking glycerol stocks) (Corning, cat. no. 430488)

• Transfer pipette (Sigma, cat. no. Z350605)

• Vortex shaker (Cole-Parmer, cat. no. UX-04720-00 or equivalent)

For preparation of 6-well plates for expansion

• Trypsin-EDTA (Sigma, cat. no. T4049)

• Cottontail Rabbit Epithelial Cells (Sf1Ep cells; ATCC CCL-68 or equivalent) routinely propagated in vitro in T-25 flask, as in (Edmondson & Norris, 2021)

• Sf1Ep media (see Reagents and Solutions section for formulation)*

  * Media needs to be prepared in advance. Prepare 5 ml for each T-25 flask and 15 ml for each 6-well plate, in addition to what is needed for routine propagation.

• Trypan-blue solution (Sigma, cat. no. T8154)

• Water bath set at 42°C

• T-25 flask containing Sf1Ep ongoing culture

• Tissue culture incubator set at 37°C and 5% CO₂ atmosphere

• Inverted microscope (Nikon Ts2 or equivalent)

• Sterile 50 ml conical centrifuge tubes (ThermoFisher Scientific, cat. no. 339660)

• 10 ml Serological pipettes (ThermoFisher Scientific, cat. no. 170356 or equivalent)

• Motorized pipettor (Pipet-X Pipet Controller PX-100, Raining cat. no. 17011733 or equivalent)

• Transfer pipette (Sigma, cat. no. Z350605)

• Single channel 20 μl manual pipette (Rainin, cat. no. 17014392)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2749-HR)

• Hemacytometer (ThermoFisher Scientific, cat. no. 0267110)

• Light microscope with 40X objective (Leica DM750 or equivalent)

• Sterile 6-well culture plates with low-evaporation lids (Falcon, cat. no. 353046)

• Single channel 1000 μl manual pipette (Rainin, cat. no. 17014382)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2779-HR)

• Disposable sterile polyethersulfone (PES) vacuum filtration unit with 0.2-μm pore size (ThermoFisher Scientific, cat. no. 564-0020)

• Humidified tri-gas incubator maintained at 34°C, 1.5% O₂, 5% CO₂ and 93.5% N₂

For expansion of transformed cultures into 6-well plates

• Trypsin-EDTA (Sigma, cat. no. T4049)

• TpCM-2 media (see Reagents and Solutions section for formulation)*

  *Media needs to be prepared in advance. Prepare 50 ml for each transformation experiment, in addition to what is needed for routine propagation.

• Sterile glycerol (if taking glycerol stocks)

• 1X Lysis Buffer (if isolating DNA) (See Reagents and Solutions section for formulation)

• TRIzol Reagent (if isolating RNA) (ThermoFisher Scientific, cat. no. 15596026)

• Water bath set at 42°C

• 24-well transformation plate

• Vacuum aspirator device (inside biosafety cabinet)

• Tissue culture incubator set at 37°C and 5% CO₂ atmosphere

• 5 ml serological pipettes (Corning, cat. no. CLS4487 or equivalent)

• Motorized pipettor (Pipet-X Pipet Controller PX-100, Raining cat. no. 17011733 or equivalent)

• Sterile 50 ml conical centrifuge tubes (ThermoFisher Scientific, cat. no. 339660)

• Single channel 1000 μl manual pipette (Rainin, cat. no. 17014382)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2779-HR)

• Single channel 20 μl manual pipette (Rainin, cat. no. 17014392)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2749-HR)

• Inverted microscope (Nikon Ts2 or equivalent)

• Sterile 1.5 ml microcentrifuge tubes (Eppendorf, cat. no. 022364111 or equivalent)

• Centrifuge (Eppendorf 5424 or equivalent)

• 2 ml cryogenic vials (Corning, cat. no. 430488)

• Transfer pipette (Sigma, cat. no. Z350605)

• Vortex shaker (Cole-Parmer, cat. no. UX-04720-00 or equivalent)

Protocol steps with step annotations

Adding kanamycin for selection of transformed cultures (Day 1)

• 1Retrieve the 24-well plate with treponemes from the tri-gas incubator and place in the biosafety cabinet.
• 2Retrieve an aliquot of kanamycin from frozen storage and let it thaw. Once thawed, add 25 μl to well #1 and #3 (also see Fig.3)*.

  *Final concentration of kanamycin in the culture should be 200 μg/ml.

• 3Place the 24-well plate back in the tri-gas incubator.

Figure 3.

Schematic of the 24-well plate where treponemes are inoculated prior to transformation. In well #1 (top left) treponemes are exposed to transformation buffer containing CaCl₂ and foreign DNA. In well #2 (top right), treponemes are exposed to CaCl₂-buffer without transforming DNA. In well #3 (bottom left), treponemes are exposed to kanamycin alone as control, and in well #4 (bottom right), wild type treponemes are propagated as control. Physical separation of these cultures and controls allows for reduction in chances of cross-contaminating cultures and avoids excessive use of plates. White wells are kept empty.

Replacing exhausted media and kanamycin (Day 3)

• 4Retrieve the 24-well plate from the tri-gas incubator and place in the biosafety cabinet.
• 5Being careful not to disturb the cells, vacuum aspirate exhaust media from all wells and replace with 2.5 ml of fresh equilibrated TpCM-2 media.
• 6Retrieve an aliquot of kanamycin from frozen storage and let thaw. Once it has been thawed, add 25 μl to well #1 and #3 (also see Fig.3).
• 7Place the 24-well plate back into the tri-gas incubator.

Preparation of TpCM-2 media (Day 4)

While culturing in the 24-well plate, transformation cultures are passaged every 2 weeks, although TpCM-2 media and kanamycin need to be exchanged weekly. Prepare fresh TpCM-2 media weekly.

• 8Prepare 15 ml TpCM-2 media as instructed in the Reagents and Solutions section (See TpCM-2 media preparation protocol).
• 9Place TpCM-2 media in the tri-gas incubator to equilibrate for at least 3 hours. Loosen the reservoir lid to allow gas exchange.

Exchange of exhausted media and kanamycin (Day 5)

• 10Retrieve the 24-well plate from the tri-gas incubator and place in the biosafety cabinet.
• 11Being careful not to disturb the treponemes, vacuum aspirate exhausted media from all wells and replace with 2.5 ml of newly equilibrated TpCM-2 media.
• 12Retrieve an aliquot of kanamycin from frozen storage and let thaw. Once it has been thawed, add 25 μl to well #1 and #3 (See Fig.3). Place the 24-well plate back into the tri-gas incubator until ready for sub-culturing again in a week. To subculture, repeat Basic Protocol 2.

Preparation of first passage of transformed cultures (Day 9)

Steps performed on Day 9 are the same steps at Day −5 of Basic Protocol 1 (above) using ongoing Sf1Ep cell culture.

Seeding Sf1Ep cells

• 13Retrieve a 10 ml trypsin-EDTA aliquot from the freezer and place in the 42°C water bath until fully thawed, then remove and place in the biosafety cabinet.
• 14Remove the T-25 flask containing Sf1Ep cells (seeded during routine weekly passaging of Sf1Ep cell culture) from the tissue culture incubator and assess confluency with the inverted microscope*.

  *Cells should be at ~70% (or higher) confluency. This ensures that enough cells will be retrieved for the subsequent steps.

• 15Place the T-25 flask into the biosafety cabinet, open the lid and pour old media into a 50 ml centrifuge tube.
• 16Using a 5 ml serological pipette, add 1 ml of trypsin-EDTA to the flask and gently rotate to rinse off any exhausted media, then discard into the 50 ml conical tube.
• 17Using a 5 ml serological pipette, add 4 ml of trypsin into the flask.
• 18Return the flask to the tissue culture incubator and incubate for 5 minutes.
• 19Remove flask from the incubator and assess cell detachment using the inverted microscope. If necessary to facilitate the dissociation process, gently agitate the flask, then place it back into the biosafety cabinet*.

  *If detachment has not occurred, incubate additional 5 minutes in tissue culture incubator, not exceeding 10 minutes total incubation time. If detachment is still unsuccessful, discard trypsin and repeat steps 16–19 with different 10-mL trypsin-EDTA aliquot.

• 20Retrieve growth media for Sf1Ep cells from storage (4°C).
• 21Using a 5 ml serological pipette, add 4 ml of fresh Sf1Ep media to flask to stop trypsinization and gently agitate the flask.
• 22Using a transfer pipette, homogenize the cell suspension by pipetting up and down and by washing the flask surface where cells were previously attached*.

  *This process reduces cell clumping and ensures a more accurate cell count.

• 23Conduct a formal count of the viable Sf1Ep cells using the hemacytometer (See Support protocol 2).
• 24Open a sterile 24-well culture plate and seed four wells Sf1Ep cells using single-channel pipette*.

  *To achieve the requisite number of Sf1Ep cells, prepare a dilution of harvested Sf1Ep cells to a concentration of 2×10⁴ cells/ml, then use 1 ml to seed each well.

• 25Add 1 ml of Sf1Ep media to each well using a 1000 μl single channel pipette, bringing the total volume to 2 ml per well.
• 26Transfer the plate to the tissue culture incubator overnight to allow for Sf1Ep cell adhesion.
• 27Disinfect and discard the 50 ml conical tube containing exhausted media and residual trypsin.

Preparing TpCM-2 Medium

• 28Prepare 50 ml of TpCM-2 media as instructed in the Reagents and Solutions section.
• 29Filter-sterilize prepared TpCM-2 media using a disposable sterile vacuum filtration unit with 0.22-μm pore size. Following filtration, cap the media reservoir.
• 30Incubate the filtered TpCM-2 media overnight in the tri-gas incubator to equilibrate the media. Loosen the reservoir lid to allow gas exchange.

First passage of transformed cultures (Day 10)

• 31Retrieve a 10 ml trypsin-EDTA aliquot from the freezer and thaw in a 42 °C water bath until fully thawed, then place in a biosafety cabinet.
• 32Retrieve the 24-well plate containing Sf1Ep cells from the tissue culture incubator from the previous day, as well as TpCM-2 media from the tri-gas incubator.
• 33Vacuum aspirate exhausted media in the 24-well plate and replace with 2.3 ml of freshly equilibrated TpCM-2 media.
• 34Return the plate into the tri-gas incubator to equilibrate for at least 3 hours*.

  *Proceed with step 5 after the 3-hour equilibration period.

• 35Retrieve the 24-well plate with transformed treponemes and controls from the tri-gas incubator and place in the biosafety cabinet. This plate will be referred to as “transformation plate” here thereafter.
• 36Using a dedicated 5 ml serological pipette for each well, remove exhausted media from all wells of the transformation plate and place in a 50 ml conical centrifuge tube for waste.
• 37Using the 200 μl single channel manual pipette, rinse with 200 μl trypsin-EDTA and quickly remove the rinse and discard it into the 50 ml conical tube.
• 38Add another 200 μl of trypsin-EDTA to all four wells and let incubate in the tissue culture incubator for 5 minutes.
• 39Remove plate from the incubator and assess detachment of cells using the inverted microscope*.

  *If detachment has not occurred, incubate additional 5 minutes in tissue culture incubator, not exceeding 10 minutes total incubation time. If detachment is still unsuccessful, discard trypsin and repeat steps 37–39 with different 10 ml trypsin-EDTA aliquot.

• 40Add 300 μl of freshly equilibrated TpCM-2 media to each well to stop the trypsinization process. This brings the total volume in each well to 500 μl.
• 41Using the 1000 μl single channel pipette (set at 300 μl), gently pipet cell suspension up and down across the bottom of the well while holding plate at an angle to ensure all trypsinized cells are resuspended.
• 42Retrieve four 1.5 ml microcentrifuge tubes and transfer all contents of each well to its own properly labelled centrifuge tube.
• 43Centrifuge cell suspensions at 130 RCF for 5–10 minutes at room temperature to pellet Sf1Ep cells.
• 44Conduct a formal count of viable treponemes harvested from each well (See Support Protocol 1).
• 45Retrieve the newly equilibrated 24-well culture plate from the tri-gas incubator and place in the biosafety cabinet.
• 46Transfer 200 μl of cell suspension from each microcentrifuge tube into its respective well in the 24-culture plate to achieve 2.5 ml final volume per well*.
• 47Place the newly obtained 24-well transformation plate back into tri-gas incubator.

  *If NOT collecting glycerol stocks, or isolating DNA and RNA, use all 500 μL cell suspension to re-seed the new 24-well plate wells, adjusting the TpCM-2 media to maintain 2.5 ml final volume per well.

Collecting glycerol stocks

• 48Transfer 100 μl of cell suspension from each tube to a respective 2 ml cryogenic vial using a single channel manual pipette.
• 49Add ~6 drops of sterile glycerol to each of the tubes using a transfer pipette*.

  *6 drops of sterile glycerol is the approximate volume needed to achieve a 1:2 dilution with the 100 μL of cell suspension.

• 50Vortex the tubes to create a homogeneous suspension and freeze immediately at −80°C.

Collecting samples for DNA extraction

• 51Transfer 80 μl cell suspension from each tube to its own properly labelled 1.5 ml microcentrifuge tube using a 200 μl single channel manual pipette*.

  *After seeding new plates, conducting a formal count, and making glycerol stocks, we can only use ~80 μl for the purpose of DNA extraction.

• 52Centrifuge the tubes at 20K RCF (14,000 rpm on a tabletop centrifuge) for 10 minutes to pellet treponemes.
• 53Being careful not to disturb the pellet, vacuum aspirate the supernatant.
• 54Add 180 μl of 1X lysis buffer to each of the tubes using a single channel manual pipette.
• 55Pipette up and down to resuspend the pellet and store sample at −80°C until ready to isolate DNA.

Collecting samples for RNA extraction

• 56Transfer 80 μL cell suspension from each tube to its own properly labelled 1.5 ml microcentrifuge tube using a 200 μl single channel manual pipette*.

  *After seeding new plates, conducting a formal count, and making glycerol stocks, we can only use ~80 μl for the purpose of RNA extraction.

• 57Centrifuge the tubes at 20K RCF (14,000 rpm on a tabletop centrifuge) for 10 minutes to pellet treponemes.
• 58Being careful not to disturb the pellet at the bottom of the tube, vacuum aspirate the supernatant.
• 59Add 400 μl of TRIzol reagent (or equivalent) to each of the tubes using the 1000 μl single channel manual pipette.
• 60Pipette up and down to resuspend the pellet and store at −80°C until ready to isolate RNA.

Preparation of TpCM-2 media (Day 16)

While culturing in the 24-well plate, transformation cultures are passaged every 2 weeks, although TpCM-2 media and kanamycin need to be exchanged weekly. Prepare fresh TpCM-2 media weekly.

• 61Prepare 15 ml TpCM-2 media as instructed in the Reagents and Solutions section (See TpCM-2 media preparation protocol).
• 62Place TpCM-2 media in the tri-gas incubator to equilibrate for at least 3 hours. Loosen the reservoir lid to allow gas exchange.

Exchange of exhausted media and kanamycin (Day 17)

• 63Retrieve the 24-well plate from the tri-gas incubator and place in the biosafety cabinet
• 64Being careful not to disturb the treponemes, vacuum aspirate exhausted media from all wells and replace with 2.5 ml of newly equilibrated TpCM-2 media.
• 65Retrieve an aliquot of kanamycin from frozen storage and let thaw. Once it has been thawed, add 25 μl to well #1 and #3 (See Fig.3).
• 66Place the 24-well plate back into the tri-gas incubator until ready for sub-culturing again in a week. To subculture, repeat Basic Protocol 2.

Preparation of 6-well plates for expansion

Continued propagation of transformed cultures and control treponemes in 24-well plates should proceed for at least another three passages following Basic Protocol 2. By the fifth passage, enough treponemes should be countable to upscale of transformed cultures into 6-well plates. Like the procedure of passaging into 24-well plates, there is a preparation of a 6-well plate with the initial seeding of Sf1Ep cells and preparation of TpCM-2 media the day proceeding the actual transfer of treponemes into new plates. Once cultures are expanded to 6-well plates, it is recommended each culture is seeded into its own separate plate to reduce risk of cross-contamination. The protocol below describes the steps for one 6-well plate. Increase reagent volumes proportionally if more than one 6-well plate is used.

Seeding Sf1Ep cells

• 67Retrieve a 10 ml trypsin-EDTA aliquot from frozen storage and place in the 42°C water bath until fully thawed, then remove and place in the biosafety cabinet.
• 68Remove the T-25 flask containing Sf1Ep cells (seeded for continued propagation of Sf1Ep cultures in Basic Protocol 1) from the tissue culture incubator and assess confluency with the inverted microscope*.

  *Cells should be at ~70% (or higher) confluency. This ensures that enough cells will be retrieved for the subsequent steps.

• 69Place the T-25 flask into the biosafety cabinet, open the lid and pour old media into a 50 ml centrifuge tube.
• 70Using a 5 ml serological pipette, add 1 ml of trypsin-EDTA to the flask, and gently rotate it to rinse off any exhausted media and discard into a 50 ml conical tube.
• 71Using a 5 ml serological pipette, add 4 ml of trypsin into the flask.
• 72Return the flask to the tissue culture incubator and incubate for 5 minutes.
• 73Remove flask from the incubator and assess cell detachment using the inverted microscope. If necessary, gently agitate the flask to facilitate the dissociation process, then place flask back into the biosafety cabinet*.

  *If detachment has not occurred, incubate additional 5 minutes in tissue culture incubator, not exceeding 10 minutes total incubation time. If detachment is still unsuccessful, discard trypsin and repeat steps 70–73 with different 10-mL trypsin-EDTA aliquot.

• 74Retrieve growth media for Sf1Ep cells from storage (4°C).
• 75Using a 5 ml serological pipette, add 4 ml of fresh Sf1Ep media to flask to stop trypsinization and gently agitate the flask.
• 76Using a transfer pipette, homogenize the cell suspension by pipetting up and down and by washing the flask surface where cells were previously attached*.

  *This process reduces cell clumping and ensures a more accurate cell count

• 77Perform a formal count of the viable Sf1Ep cells using the hemacytometer (See Support Protocol 2).
• 78Open a sterile 6-well culture plate and seed all wells with 1×10⁵ Sf1Ep cells using the 1000 μl single-channel pipette*.

  *To achieve the necessary number of Sf1Ep cells, prepare a dilution of harvested Sf1Ep cells to a concentration of 1×10⁵ cells/ml and use 1 ml to seed each well.

• 79Add 1 ml of Sf1Ep media to each well using a 1000 μl single channel pipette, bringing the total volume to 2 ml per well.
• 80Transfer the plate to the tissue culture incubator overnight to allow for Sf1Ep cell adhesion to the well.
• 81Disinfect and discard the 50 ml conical tube containing exhausted media and residual trypsin.

Preparing TpCM-2 Medium

• 82Prepare 50 ml of TpCM-2 media as instructed in the Reagents and Solutions section.
• 83Filter-sterilize prepared TpCM-2 media using a disposable sterile vacuum filtration unit with 0.22-μm pore size. Following filtration, cap the media reservoir.
• 84Incubate the filtered TpCM-2 media overnight in the tri-gas incubator to equilibrate the media. Loosen the reservoir lid to allow gas exchange.

Expansion of transformed cultures into 6-well plates

Harvesting of the 24-well plate culture follows the same protocol described above (First passage of transformed cultures- Day 10; steps 31–47), but treponemes will now be seeded in a 6-well plate instead of a new 24-well plate. The first passage in the 6-well plate should be allowed to grow for 2 weeks, replacing the TpCM-2 and kanamycin after 1 week. All subsequent passages follow the same 6-well plate weekly passaging protocol as described in (Edmondson & Norris, 2021).

• 85Retrieve a 10 ml trypsin-EDTA aliquot from the freezer and thaw in a 42 °C water bath until fully thawed, then place in a biosafety cabinet.
• 86Retrieve the 6-well plate containing Sf1Ep cells from the tissue culture incubator from the previous day, as well as TpCM-2 media from tri-gas incubator.
• 87Vacuum aspirate exhausted media in new plate and replace with 4 ml of newly equilibrated TpCM-2 media.
• 88Return the plate into the tri-gas incubator to let equilibrate at least 3 hours before harvesting treponemes from the 24-well transformation plate.
• 89Retrieve the 24-well transformation plate from the tri-gas incubator and place in the biosafety cabinet.
• 90Using dedicated 5 ml serological pipette for each well, remove exhausted media from all wells of the transformation plate and place in a 50 ml conical centrifuge tube for waste.
• 91Using a 200 μl single channel manual pipette, rinse with 200 μl trypsin-EDTA and quickly remove and discard the rinse.
• 92Add 200 μl of trypsin-EDTA to all four wells and incubate in the tissue culture incubator for 5 minutes.
• 93Remove plate from the incubator and assess detachment of cells using the inverted microscope.

  *If detachment has not occurred, incubate additional 5 minutes in tissue culture incubator, not exceeding 10 minutes total incubation time. If detachment is still unsuccessful, discard trypsin and repeat steps 90–93 with different 10-mL trypsin-EDTA aliquot.

• 94Add 300 μl of freshly equilibrated TpCM-2 media to stop the trypsinization process.
• 95Using the 1000 μl single channel pipette (set at 300 μl), gently pipet cell suspension up and down across the bottom of the well while holding plate at an angle to capture all trypsinized cells into the suspension.
• 96Prepare four 1.5 ml microcentrifuge tubes and transfer all contents of each well to its own respective centrifuge tube.
• 97Centrifuge cell suspensions at 130 RCF for 5–10 minutes at room temperature to pellet Sf1Ep cells.
• 98Conduct a formal count of viable treponemes for each well’s culture (See Support Protocol 1).
• 99Retrieve the 6-well culture plate that has been equilibrating in the tri-gas incubator.
• 100Transfer approximately 33 μl of cell suspension from the microcentrifuge tubes into the wells of the 6-well culture plate*.

  *If taking glycerol stocks, or samples for DNA or RNA isolation, following the steps from the “First passage of transformed cultures- Day 10” procedure above.

• 101Add 40 μl kanamycin stock to the transformation wells, to obtain a final concentration of 200 μg/ml.
• 102Place 6-well plate back into the tri-gas incubator.
• 103Exchange exhausted media and kanamycin after 1 week as previously described.

BASIC PROTOCOL 3 Isolation of a clonal T. pallidum strain through limiting dilution.

Introductory paragraph

T. pallidum clonal strains can be obtained in culture even if this pathogen does not form colonies using limiting dilution. Using this approach, pre-seeded Sf1Ep cells in TpCM-2 media can be inoculated with approximately 1 cell per well in a 96-well plate. Cultures are then passaged every two weeks until T. pallidum cells become quantifiable using DF microscopy or detectable by PCR amplification. These wells can then be transferred into larger dishes to be expanded to sufficient cell density to perform experiments. Assessment of clonality is performed through high-throughput sequencing of the only intra-strain variable gene of T. pallidum, namely tp0897 (tprK) as reported by Addetia et al. (Addetia et al., 2020). A T. pallidum strain temporarily isogenic for tprK indicates a successful isolation of a clone. The hazards of handling T. pallidum cultures have already been described, and this protocol does not pose any additional safety concern for the operator.

Except for a few procedural details, this protocol is slightly different from the one reported in (Edmondson et al., 2018) for isolation of clonal wild-type strains. We report our protocol version here for completeness’ sake.

Materials

For Day −1 procedure

• Sf1Ep media (see Reagents and Solutions section for formulation)* supplemented with kanamycin (200 μg/ml final concentration)

  * Media needs to be prepared in advance. Prepare 15 ml for each 96-well plate, in addition to what is needed for routine propagation.

• In vitro T. pallidum ongoing culture

• Sterile 96-well culture plates with low-evaporation lids (Sigma, cat. no. CLS3931)

• Multichannel pipette (200 μL) (Rainin, cat. no. 17013807)

• Filtered pipette tips (matching pipette specifications) (ART, cat. no. 2779-HR)

• Tissue culture incubator set at 37°C and 5% CO₂ atmosphere

• Humidified tri-gas incubator maintained at 34°C, 1.5% O₂, 5% CO₂ and 93.5% N₂

For Day 0 procedure

• Trypsin-EDTA (Sigma, cat. no. T4049)

• One 96-well plate containing seeded Sf1Ep cells from Day −1

• TpCM-2 media (see Reagents and Solutions section for formulation) supplemented with kanamycin (200 μg/ml final concentration)*

  *Media needs to be prepared in advance. Prepare 25 ml for each 96-well plate, in addition to what is needed for routine propagation.

• 6-well plate containing T. pallidum ongoing culture

• Vacuum aspirator device (inside biosafety cabinet)

• Multichannel pipette (200 μL) (Rainin, cat. no. 17013807)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2779-HR)

• Sterile reagent reservoir (100 ml) (ThermoFisher Scientific, cat. no. NC052890)

• Humidified tri-gas incubator maintained at 34°C, 1.5% O₂, 5% CO₂ and 93.5% N₂

• Serological pipette (10 ml) (ThermoFisher Scientific, cat. no. 170356)

• Sterile 50 ml conical centrifuge tubes (ThermoFisher Scientific, cat. No 339650)

• Motorized pipettor (Pipet-X Pipet Controller PX-100, Raining cat. no. 17011733 or equivalent)

• Single channel 1000 μl manual pipette (Rainin, cat. no. 17014382)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2779-HR)

• Serological pipette (5 ml) (ThermoFisher Scientific, cat. no. 170355)

• Centrifuge (Eppendorf 5702 R or equivalent)

• Microscope equipped with a dark-field condenser or dark-field microscope (Nikon Eclipse NiU darkfield microscope, or equivalent)

For Day 7 procedure

• TpCM-2 media (see Reagents and Solutions section for formulation)* supplemented with kanamycin (200 μg/ml final concentration)

  *Media needs to be prepared in advance. Prepare 25 ml for each 96-well plate, in addition to what is needed for routine propagation and equilibrate overnight.

• Multichannel pipette (200 μL) (Rainin, cat. no. 17013807)

• Filtered pipette tips (matching pipette specifications) (Art, cat. no. 2779-HR)

• Sterile reagent reservoir (100 ml) (ThermoFisher Scientific, cat. no. NC052890)

For Day 13 procedure

• See “For Day −1 procedure” above for list of materials needed

For Day 14 procedure

• See “For Day 0 procedure” above for list of materials needed

For Day 21 procedure

• See “For Day 7 procedure” above for list of materials needed

For Day 27 procedure

• See “For Day −1 procedure” above for list of materials needed

For Day 28 procedure

• See “For Day 0 procedure” above for list of materials needed

• DNA isolation kit for 96-well plate format (Zymo Research cat. no. D3010 or equivalent)

• Aluminum plate sealing tape (ThermoFisher Scientific, cat. no. 12-565-475)

For Day 35 procedure

• See “For Day 7 procedure” above for list of materials needed

For Day 41 procedure

• See “For Day −1 procedure” above for list of materials needed

• Sterile 24-well culture plates with low-evaporation lids (Sigma, cat. no. SIAL0524)

• Single channel 1000 μl manual pipette (Rainin, cat. no. 17014382)

For Day 42 procedure

• See “For Day 0 procedure” above for list of materials needed

Protocol steps with step annotations

Preparation of 96-well plates to derive clonal isolates (Day −1)

Seeding Sf1Ep cells

• 1Retrieve a sterile 96-well plate (here thereafter referred to as a “cloning plate”) and place inside the biosafety cabinet.
• 2Retrieve a T-25 flask with 1-week old Sf1Ep cells from the tissue culture incubator and proceed to dissociation with trypsin*.

  *Preparation and counting of Sf1Ep cells from T-25 plates is reported above in Basic protocol 1 and Support Protocol 2 and will not be repeated here. Due to the employment of a multichannel pipette to dispense cells into wells, the use of a sterile disposable 100-mL reagent reservoir is necessary.

• 3Using the 200 μl multichannel pipette, seed each well of the two plates with approximately 3×10³ Sf1Ep cells per well*. Do not exceed 3×10³ Sf1Ep cells/well.

  *To achieve the requisite number of Sf1Ep cells, prepare a dilution of harvested Sf1Ep cells to a concentration of 2×10⁴ cells/ml, then use 150 μl to seed each well.

• 4Transfer plate into the tissue culture incubator and incubate overnight to let Sf1Ep cells adhere to the wells.

Preparing TpCM-2 Medium supplemented with kanamycin

• 5Prepare 50 ml of TpCM-2 media supplemented with kanamycin (200 μg/ml final concentration) as instructed in the Reagents and Solutions section*.

  *If performing routine propagation of T. pallidum in addition to the cloning plate, prepare enough TpCM-2 as needed for a 6-well plate, as in (Edmondson et al., 2018).

• 6Filter-sterilize prepared TpCM-2 media using a disposable sterile vacuum filtration unit with 0.22-μm pore size. Following filtration, cap the media reservoir.
• 7Retrieve from (−20⁰C) storage a kanamycin stock (25 mg/ml) aliquot and thaw at room temperature. Add appropriate volume of kanamycin stock to reach a 200 μg/ml final concentration.
• 8Incubate the filtered TpCM-2 media for at least three hours to overnight in the tri-gas incubator to equilibrate the media. Loosen the reservoir lid to allow gas exchange.

Addition of T. pallidum cells to the cloning plate (Day 0)

• 9Retrieve a 10-mL trypsin-EDTA aliquot from the freezer and place in the 42°C water bath until fully thawed, then remove and place in the biosafety cabinet.
• 10Remove the 96-well plate from the tissue culture incubator and place in the biosafety cabinet.
• 11Aspirate media from each of the wells in the 96-well plate with the vacuum aspirator device, being careful to not disturb the growing culture at the bottom of the wells.
• 12Transfer TpCM-2 media to a 100-mL sterile reagent reservoir. Using the 200 μl multichannel pipette, rinse each well with 50 μL pre-equilibrated TpCM-2.
• 13Remove the TpCM-2 rinse with the vacuum aspirator device and add 200 μL TpCM-2 to each well.
• 14Place the 96-well plate in the tri-gas incubator for at least three hours to allow Sf1 cells to equilibrate to TpCM-2 media.
• 15After three hours, remove the 96-well plate from the incubator and place in the biosafety cabinet.
• 16Retrieve from the tri-gas incubator the 6-well plate containing the T. pallidum strain that has been growing for one week and place in the biosafety cabinet.
• 17Remove all media from the 6-well plate with a 10 ml serological pipette and save into a 50 ml conical tube.
• 18Rinse each well of the plate containing the T. pallidum culture by adding 350 μl of trypsin-EDTA per well. Quickly aspirate the rinse from each well to avoid cell trypsinization.
• 19Add 350 μl fresh trypsin-EDTA to the wells and return the plates to the tissue culture incubator to complete trypsinization*.
• 20Incubate for five minutes to detach all cells.

  *Assess cell detachment using the inverted microscope after 5 minutes. If cells have not completely detached, gently shake and/or allow for more time in the incubator. Do not exceed 10 minutes total incubation in trypsin-EDTA.

• 21Add 650 μL of reserved TpCM-2 media (step 9) back into each well to stop the trypsinization reaction.
• 22Using a 5-mL serological pipette, pool the cell suspension resulting from the trypsinization of each well, and transfer it into a 15 ml conical tube.
• 23Centrifuge suspension at 130 RCF for 5–10 minutes at room temperature to pellet the Sf1Ep cells. Transfer the supernatant to a new 15 ml conical tube without disturbing the pellet.
• 24Remove 18 μl of T. pallidum cell suspension from the supernatant and proceed to count treponemes using dark-field microscopy (See Support Protocol 1).
• 25Dilute culture with pre-equilibrated TpCM-2 to a final concentration of 10 organisms/ml, and transfer suspension to a sterile 100 ml plastic reservoir.
• 26Using a 200 μl multichannel pipette, add 50 μl of the diluted T. pallidum culture, or an average of 0.5 T. pallidum, to each well of the 96-well plate.
• 27Transfer plates back into the tri-gas incubator and leave culture for 7 days.

Treponemal propagation (Day 6–28 procedures)

Preparing fresh TpCM-2 media supplemented with kanamycin (Day 6)

• 28Prepare 25 ml of TpCM-2 supplemented with kanamycin (200 μg/ml final concentration) as instructed in the Reagents and Solutions section and let equilibrate overnight in the tri-gas incubator.

Replacing exhausted media (Day 7)

• 29Retrieve the 96-well plates from the tri-gas incubator and place in the biosafety cabinet
• 30Using the 200 μl multichannel pipette, remove 100 μl exhausted media from each well column. Change tips between well columns to avoid cross contamination. Add 100 μl of freshly equilibrated TpCM-2 media using different tips for each well column.
• 31Return the plates into the tri-gas incubator and let incubate for 7 days.

Sub-culturing (Day 13–14)

• 32Repeat the steps of “Preparation of 96-well plates to derive clonal isolates (Day −1)” to seed a new 96-well plate with Sf1Ep cells*.

  *Proceed with step 2 on the following day (Day 14).

• 33Retrieve the newly seeded 96-well plates and place in the biosafety cabinet.
• 34Aspirate all media in the wells with the vacuum aspirator device and replace it with 200 μl of freshly equilibrated TpCM-2 (see steps 11–13 from Day 0 procedure).
• 35Retrieve the 96-well cloning plates seeded 14 days earlier with treponemes from the tri-gas incubator and place in the biosafety cabinet.
• 36Using the 200 μl multichannel pipette, transfer 50 μl of culture supernate from the 14-day old cloning 96-well plates into the corresponding wells of the new 96-well plates*.

  *trypsinization of the cultures in the 96-well plates is not performed to facilitate the process, but it could potentially accelerate the isolation of a clonal strain, as most treponemes adhere to Sf1Ep cells.

• 37Return plates back into the tri-gas incubator for one week.

Preparing fresh TpCM-2 media supplemented with kanamycin (Day 20)

• 38Prepare 25 ml of TpCM-2 media supplemented with kanamycin (200 μg/ml final concentration) as instructed in the Reagents and Solutions section and let equilibrate overnight in the tri-gas incubator.

Replacing exhausted media (Day 21)

• 39Retrieve the 96-well plates from the tri-gas incubator and place in the biosafety cabinet
• 40Using the 200 μl multichannel pipette, remove 100 μl exhausted media from each well column. Change tips between well columns to avoid cross contamination. Add 100 μl of freshly equilibrated TpCM-2 media using different tips for each well column.
• 41Return the plates into the tri-gas incubator and let incubate for 7 days.

Sub-culturing (Day 27–28)

• 42Repeat the steps of “Preparation of 96-well plates to derive clonal isolates (Day −1)” to seed a new 96-well plate with Sf1Ep cells*.

  *Proceed with step 2 on the following day (Day 28).

• 43Retrieve the newly seeded 96-well plate and place in the biosafety cabinet.
• 44Aspirate all media in the wells with the vacuum aspirator device and replace it with 200 μl of freshly equilibrated TpCM-2 (see steps 11–13 from Day 0 procedure).
• 45Retrieve the 96-well cloning plates seeded 14 days earlier with treponemes from the tri-gas incubator and place in the biosafety cabinet.
• 46Using the 200 μl multichannel pipette, transfer 50 μl of culture supernate from the 14-day old cloning 96-well plates into the corresponding wells of the new 96-well plates.
• 47Return plates back into the tri-gas incubator for one week.
• 48Aspirate all remaining media in the wells of the 96-well cloning plate from Day 14. Add 200 μl of genomic lysis buffer from Zymo Research Quick-DNA 96 kit to each well. Cover plates with aluminum plate sealer and incubate at room temperature for 30min, then move to −20°C for storage until DNA extraction and amplification. This plate will be used to determine which wells contain actively growing cultures and to select which ones to expand.

Selection and expansion of treponeme-containing wells (Day 28–42)

Identification of treponeme-containing wells (between Day 28 and 41)

• 49Thaw the plate from Day 28 Step 12 above and extract DNA using the Zymo Research Quick-DNA 96 kit (or equivalent 96-well plate DNA extraction kit) according to manufacturer’s instructions. Assess all wells for treponemal growth by quantitative PCR for the tp0574 (Tp47) gene according to.
• 50Select one or more wells to be expanded at Day 42 below.

Preparing fresh TpCM-2 media supplemented with kanamycin (Day 34)

• 51Prepare 25 ml of TpCM-2 media supplemented with kanamycin (200 μg/ml final concentration) as instructed in the Reagents and Solutions section and let equilibrate overnight in the tri-gas incubator.

Replacing exhausted media (Day 35)

• 52Retrieve the 96-well plates from the tri-gas incubator and place in the biosafety cabinet
• 53Using the 200 μl multichannel pipette, remove 100 μl exhausted media from each well column. Change tips between well columns to avoid cross contamination. Add 100 μl of freshly equilibrated TpCM-2 media using different tips for each well column.
• 54Return the plates into the tri-gas incubator and let incubate for 7 days.

Seeding 24-well plates (Day 41)

• 55Seed one or more 24-well plates with 2 × 10⁴ Sf1 Ep cells per well for each clonal isolate selected in “Identifcation of treponeme-containing wells”, Step 2 above, according to the procedure in Basic Protocol 1, Day −5.
• 56Prepare fresh TpCM-2 media supplemented with kanamycin (200 μg/ml) according to the procedure in Basic Protocol 1, Day −5. Equilibrate overnight in the tri-gas incubator.

T. pallidum expansion (Day 42)

• 57Retrieve the 24-well plate seeded the previous day from the tissue incubator and transfer to the biosafety cabinet.
• 58Retrieve the equilibrated TpCM-2 from the tri-gas incubator and transfer it to the biosafety cabinet.
• 59Remove the Sf1Ep media from each well by vacuum aspiration.
• 60To remove any residual Sf1Ep media, rinse each well with equilibrated TpCM-2 by slowly adding 1 ml from the side of the well with the 1000 μl single channel pipette, being careful not to disturb attached cells. Aspirate media to discard the TpCM-2 rinse.
• 61Using a 10 ml serological pipette, add 2.5 ml of fresh equilibrated TpCM-2 to each well.
• 62Place 24-well plate into tri-gas incubator for three hours.
• 63After three hours, retrieve the 96-well cloning plate from the tri-gas incubator and place in the biosafety cabinet.
• 64Aspirate all media in the selected wells with the vacuum aspirator device.
• 65Rinse each selected well of the plate containing the T. pallidum culture by adding 30 μl of trypsin-EDTA per well. Quickly aspirate the rinse from each well to avoid cell trypsinization.
• 66Add 30 μl fresh trypsin-EDTA to the wells and return the plates to the tissue culture incubator to complete trypsinization*.
• 67Incubate for five minutes to detach all cells.

  *Assess cell detachment using the inverted microscope after 5 minutes. If cells have not completely detached, gently shake and/or allow for more time in the incubator. Do not exceed 10 minutes total incubation in trypsin-EDTA.

• 68Remove the 30 μl trypsin-EDTA mixture containing detached cells and transfer the entire volume to one well of the prepared 24-well plate.
• 69Return the plates into the tri-gas incubator and let incubate for 7 days.
• 70Continue with the expansion of the selected clonal cultures according to Basic Protocol 2, Day 9 above.

REAGENTS AND SOLUTIONS:

Sf1Ep Medium (for 1000 ml total volume)

• 870 ml Eagle’s MEM (Sigma, cat. no. M4655)

• 10 ml MEM non-essential amino acids (Gibco, cat. no. 11140-050)

• 10 ml L- glutamine (Sigma, cat. no. G7513)

• 10 ml sodium pyruvate (Sigma, cat. no. S8636)

• 100 ml FBS, heat inactivated (Sigma, F0926)

  Thaw frozen components and prepare media by mixing reagents in the order given above in a sterile container. Filter-sterilize and store for up to 3 months at 4°C.

TpCM-2 Medium (for 50 ml total volume)

• 37 ml 1x CMRL 1066 without phenol red or L-glutamine (US Biological, cat. no. C5900-03A)

• 364 μl Sodium pyruvate (Sigma, cat. no. S8636)

• 50 μl 0.1% (w/v) resazurin (Sigma, cat. no. R7017)

• 1 ml 1M MOPS, pH 7.5 (Sigma, cat. no. M3183)

• 1.08 ml 7.5% (w/v) sodium bicarbonate (Sigma, cat. no. S8761)

• 500 μl 200 mM L-glutamine (Sigma, cat. no. G7513)

• 500 μl 100X D-glucose (15% in water) (Sigma, cat. no. M1902)

• 80 μl 10 g/dl D-mannitol (10% in water) (Sigma, cat. no. M1902)

• 80 μl 5 g/dl L-histidine (5% in water) (Sigma, cat. no. H6034)

• 4 mg DL-Dithiothreitol (Sigma, cat. no. D9779)

• 10 ml Fetal bovine serum, heat inactivated (Sigma, cat. no. F 4135)

  Prepare in a sterile 50 ml conical tube or sterile polyethylene medium receiver flasks. Filter-sterilize with filtration units with PES filters with 0.22-μm pore size. After preparation is complete, keep TpCM-2 in the tri-gas incubator until use.

2X CaCl₂ -based Transformation Buffer (for 100 ml)

• CaCl₂ (Sigma, cat. no. C5670)

• 1M Tris base pH 7.4 (ThermoFisher Scientific, cat. no. BP152-1)

  First prepare 1M Tris base stock by using 12.1 g Tris base and 99. 8 ml tissue culture-grade H₂O to achieve a final concentration of 1M Tris. Prepare by mixing and pH to 7.4 ml.

  Prepare buffer in a sterile polyethylene medium receiver flask by measuring out 1.11 g CaCl₂ and add 2 ml of 1M Tris base pH 7.4, as well as tissue culture-grade H₂O to reach to a final volume of 100 ml, with a concentration of 20 mM Tris and 100mM CaCl₂. Filter-sterilize with filtration units with 0.22-μm pore size and store in 4°C until use.

1X CaCl₂-based Transformation Buffer with Foreign DNA (for 1 ml)

• 500 μl 2X CaCl₂ buffer

• 30 μg foreign DNA (volume will vary depending on DNA concentration)

• Tissue culture-grade water to 1 ml final volume

  Prepare buffer by mixing reagents.

1X CaCl₂ Transformation Buffer w/o Foreign DNA (for 1 ml)

• 500 μl 2X CaCl₂ buffer

• 500 μl tissue culture-grade water

  Prepare buffer by mixing reagents

1X Lysis Buffer (for 50 ml)

• 37 ml molecular grade H₂O

• 0.5 ml 1M Tris-HCl (pH 8.0)

• 10 ml 0.5M EDTA (pH 8.0)

• 2.5 ml 10% SDS

  Adjust both Tris-HCl and EDTA pH to 8.0. Mix all other reagents to achieve a concentration of 20 mM Tris-HCl, 0.2M EDTA and 1% SDS. Lysis buffer can be stored at room temperature.

COMMENTARY

Background Information

Deepening our understanding of the molecular mechanisms underlying the pathogenesis of syphilis could, in turn, suggest new ways to mitigate the impact of this infection on human health. A pivotal step in this direction is the identification of bona fide treponemal virulence factors. To date, several experimental approaches have allowed investigators identify and functionally characterize these factors. These approaches include expression of putative virulence factors in heterologous hosts (e.g. Borrelia burgdorferi, Treponema denticola, and Treponema phagedenis), comparative genomics (Wang et al., 2011) and, to a slightly lesser extent, gene expression studies and proteomic analysis (Houston, Lithgow, Osbak, Kenyon, & Cameron, 2018; Smajs et al., 2005; Staudova et al., 2014). Genetic manipulation strategies, however, particularly those that satisfy Koch’s molecular postulates (Falkow, 1988), have not been available for T. pallidum. The lack of genetic tools is easily explained by the fact that until 2018 (Edmondson, DeLay, Kowis, & Norris, 2021; Edmondson et al., 2018; Edmondson & Norris, 2021) T. pallidum could not be continually propagated in vitro, a limitation that hindered any attempt aimed at genetically engineering this pathogen. The protocol we devised to allow foreign DNA (in our case a plasmid vector) to cross T. pallidum envelope was based on an early one used to introduce DNA into Chlamydia (Bastidas & Valdivia, 2016; Wang et al., 2011). The use of CaCl₂ was preferred to electroporation because the number of treponemal cells yielded by in vitro culture is still limited compared to other bacteria with a generation time significantly shorter than T. pallidum and that can be propagated in vitro in axenic cultures.

Our initial choice to derive a tprA knockout strain, as described in (Romeis et al., 2021) was driven by the high likelihood that, if removed, this region would not affect T. pallidum viability, being already non-functional in the wild-type strain. Ablating functional genes might, on the contrary, be problematic in the syphilis spirochete, because the small size genome of this pathogen (~1.13 Mbp) suggests that many of the genes that survived genomic reduction throughout evolution might be essential. In this scenario, inducible systems for silencing gene expression would be helpful to develop in the future. Future directions also include the development of shuttle plasmids that do not integrate into the T. pallidum genome but are suitable to express T. pallidum ORFs for complementation purposes or to express reporter proteins. Most of these goals have already been achieved for other spirochetes and could be adapted to T. pallidum (Cameron et al., 2008; Chi et al., 1999; Kuramitsu et al., 2005; Li & Kuramitsu, 1996; Saraithong et al., 2020) to fill the existing technical gap in tools available to study this important disease.

Critical Parameters and Troubleshooting

No treponemal growth

Assuming all the procedural steps are carried on correctly and the control cultures exhibit normal growth, a logical explanation for lack of growth of a transformed culture is the inactivation of an essential gene in T. pallidum, while the non-transformed cells are counter selected by kanamycin addition.

Contamination

Contamination of in vitro cultures is not common but can occur. Contaminating bacteria or fungi can easily outcompete the treponemes in the culture and this event requires restarting new cultures from stock. As described in Edmondson et al. [22], addition of phosphomycin or amphotericin B could mitigate or eliminate this problem.

Strain variation, media evaporation, and Sf1Ep cells

Different strains of T. pallidum have different growth rates, generally varying from 28 hours (Nichols strain) to 44 hours (SS14 strain), which should be taken into account when planning transformation experiments (Edmondson et al., 2021). Evaporation of TpCM-2 media can lead to decreased growth and death of treponemal cultures. Use of a humidified incubator is necessary in preventing evaporation and condensation problems. Sf1Ep cells have a finite passage limit as a co-culture in this system. High passage numbers, usually above 70, can lead to Sf1Ep cells outcompeting the treponemes in culture. These issues are also more extensively addressed in (Edmondson & Norris, 2021).

Understanding Results

The goal of this protocol is to introduce foreign DNA into T. pallidum cells, and can be achieved by exposing this pathogen to a CaCl₂-based buffer carrying the foreign DNA (Romeis et al., 2021). Given that genetic engineering of T. pallidum is technically still in its infancy, we resorted to use a plasmid construct designed to trigger a double cross-over homologous recombination event that would replace a fragment of the T. pallidum genome with a kan^R cassette controlled by a strong T. pallidum promoter. This protocol is conceptually not different from transforming any chemically competent bacterium and subsequently select with a suitable antibiotic. In this case, however, the challenge is in the fact that in culture T. pallidum does not form colonies that can be picked and expanded in axenic culture like less difficult bacteria. On the contrary, T. pallidum grows on top of eukaryotic cells which needs to be sub-cultured frequently. In this context, a successful transformation event needs to be confirmed using molecular and/or functional assays (when available), as well as by assessing the ability of transformed cells to grow in treponemicidal concentrations of kanamycin. Molecular assays will however vary depending on the targeted T. pallidum gene and the type of transforming DNA used, and the overall experimental design and objective. In our case (Fig.4), transformed T. pallidum cells were propagated in kanamycin-supplemented media (25 μg/ml or higher, effective in selection experiments of this and other spirochete, even though the overall kanamycin concentration can be increased up to 200 μg/ml, which is the concentration recommended in this protocol for selection). Because the transformation buffer contained CaCl₂ to increase membrane permeability and facilitate plasmid intake, we also exposed the wild type strain to transformation buffer alone (without plasmid), to exclude detrimental effect of CaCl₂ on treponemal viability and proceeded to propagate these cells in culture media with no antibiotic. Furthermore, to ensure that non-transformed treponemes would not survive exposure to kanamycin, the wild type strain was propagated in selective media. Due to the long generation time of the SS14 strain (~44 hours), T. pallidum cells were sub-cultured every 14 days instead of every week until Passage #7 (Week 12 post-transformation; Fig.4), and weekly thereafter. Transformed tprA knockout (tprA^ko-SS14) treponemes could be microscopically counted 2 weeks post-transformation (Fig.4; Passage #2), even though only 2.4 treponemes per dark-field microscope field could be seen, corresponding to a concentration of 2.4×10⁶ T. pallidum cells/ml). For transformed treponemes, cell density increased four weeks post-transformation and remained steady throughout Passage #6 (Week 10 post-transformation). During this window (Passage #2–6), the average number of treponemes counted was 2.8×10⁷ cells/ml. The density of wild type SS14 treated with CaCl₂ alone was higher than that of tprA^ko-SS14 cells already at Passage #2 (Week 2 post-exposure; Fig.4), suggesting that treponemes were unharmed by CaCl₂. Propagation of this strain was halted at Passage #6 (Week 10 post-exposure; Fig.4). Wild-type SS14 cells propagated in kanamycin-containing media were readily killed in vitro. During Passage #7–10, the tprA^ko-SS14 treponemal inoculum was increased to obtain enough cells for subsequent experiments and molecular assays (listed in the boxes above the passage number). Overall, these data support that a kanamycin-resistant strain was obtained due to the transformation of the wild type SS14 strain with our foreign DNA. This is the main conclusion of our Romeis et al., manuscript (Romeis et al., 2021).

Figure 4.

Twenty-week in vitro growth curve of SS14 T. pallidum cells post-exposure to transformation plasmid in transformation buffer (orange), transformation buffer alone (pink), media containing kanamycin (black) and wild-type SS14 strain (blue). As described in Romeis et al. (Romeis et al., 2021), several techniques such as RT-PCR (reverse-transcription-PCR), ddPCR (droplet digital PCR), RT-ddPCR (reverse-transcription droplet digital PCR), WGS (whole-genome sequencing), KSA (kanamycin susceptibility assay), and qPCR (quantitative PCR) can be used to assess integration of the kanamycin resistance cassette.

DATA AVAILABILITY STATEMENT

The authors confirm that the data supporting the findings of this study are available within the article.