ABSTRACT.
In recent years, the number of leptospirosis cases, including the number of deaths, has exponentially increased in Malaysia. From June 2016 to February 2018, blood samples of 321 febrile patients with the presumptive diagnosis of dengue-like illness were examined for possible exposure to Leptospira. Two hundred fifty-five blood samples were tested as negative for dengue. Seminested polymerase chain reaction (PCR) and IgM ELISA for leptospirosis were performed. From the samples, an overall prevalence for leptospirosis based on PCR of 4.7% (12/255) was obtained. Eighteen percent (46/255) were positive for anti-Leptospira IgM antibodies. The genome sequences of six of 12 Leptospira PCR-positive samples showed > 97.0% similarity to Leptospira interrogans. One patient’s sample consisted of Leptospira and chikungunya virus, suggesting a coinfection. Findings from the study suggest that leptospirosis is prevalent among dengue-negative febrile patients in Malaysia.
Leptospirosis is a zoonotic, febrile illness caused by the pathogenic spirochetes of the genus Leptospira. Apart from being widely distributed throughout the world, the disease is endemic in tropical and subtropical regions, including Malaysia.1 Malaysia has reported an increasing prevalence of leptospirosis since the first recorded case in 1925. Between 2004 and 2012, approximately 12,325 leptospirosis cases were documented with a case fatality rate of 2.7%.2 The clinical manifestations of leptospirosis vary from self-limiting febrile disease to multiple organ failure that eventually leads to death.3 Leptospirosis-afflicted patients also exhibit nonspecific symptoms, including fever, headache, and myalgia, that resemble dengue fever (DF).4 Due to the favorable tropical climate with seasonal monsoon rains,4 DF and leptospirosis can occur concurrently, presenting a public health challenge to differentiate these two diseases. Disease management differs between leptospirosis and DF, and thus early diagnosis is pivotal for the prompt initiation of appropriate antibiotics to avoid fatal leptospirosis complications.5 Despite that, clinicians are prone to diagnosing febrile cases as dengue-like illness instead of leptospirosis,6 possibly due to the higher incidence rate of DF (361 cases per 100,000 population)7 compared with leptospirosis, which is at 30.2 cases per 100,000 population.8 Because leptospirosis is frequently unrecognized and mistakenly diagnosed as DF, the current study was conducted to determine the prevalence of leptospirosis among dengue-negative febrile patients in a country where both diseases are endemic.
Patients ≥ 5 years of age who underwent medical examination with the initial diagnosis of dengue-like illness were recruited for the study. In addition, the patients were recruited based on the body temperature of 37.0 to 37.5°C (if antipyretic was taken) or > 37.5°C (if no antipyretic was taken), and parental permission was obtained for patients aged between 5 and 18 years. Patients who were breastfeeding or HIV-positive were excluded from the study. After written consent, blood samples were obtained from 321 febrile patients at seven district health clinics in Selangor (Jenjarom, Telok Panglima Garang, Shah Alam, Kuang, Sungai Buloh, Hulu Klang, and Kampung Soeharto) (Figure 1) at different times from June 2016 to February 2018. The mean age of the recruited patients was 22.9 years (SD: 15.2; range: 5–71), and 156 (48.6%) of them were male. All patients exhibited fever (100%) during recruitment, with a mean fever duration of 2.3 days (range: 1–9). Sixteen samples tested positive for the presence of dengue virus. Blood samples that tested negative for the presence of dengue virus NS1, RNA, and antidengue IgM antibodies (n = 255) were subsequently used for the detection of leptospirosis. The patients’ sera were assayed using the Serion ELISA classic Leptospira IgM kit (Virion/Serion, Würzburg, Germany); DNA was extracted from the blood clots, and seminested PCR assay was performed, specifically targeting the lipL32 gene of the pathogenic Leptospira species (Table 1). Samples tested positive for the presence of Leptospira DNA were considered as confirmed leptospirosis, whereas samples that tested positive for the presence of anti-Leptospira IgM antibodies were considered presumptive leptospirosis.
Figure 1.
Location of the district health clinics where this study was conducted.
Table 1.
Primers for seminested PCR for the detection of Leptospira DNA
| Primer | Sequence (5'-3') | Product size (bp) | Reference |
|---|---|---|---|
| lipL32F*† | CGCTGAAATGGGAGTTCGTATGATT | 423 | 14 |
| lipL32R* | CCAACAGATGCAACGAAAGATCCTTT | ||
| L32-5-B3† | ATCGTCACCATCATCATCATC | 235 | 15 |
PCR = polymerase chain reaction.
First PCR.
Seminested PCR.
Eighteen percent of patients (46/255) were reactive to anti-Leptospira IgM antibodies, and 4.7% (12/255) showed the presence of Leptospira DNA. Hence, the overall prevalence of leptospirosis among the febrile DF-negative patients by PCR was 4.7%. The confirmed leptospirosis samples were obtained from four of seven district health clinics in Selangor: Kuang (N = 3), Shah Alam (N = 4), Telok Panglima Garang (N = 4), and Kampung Soeharto (N = 1). Anti-Leptospira IgM antibodies were detected in patients as early as 1 day and as late as 9 days after the onset of febrile disease (Table 2). One patient from the Shah Alam clinic tested positive for the presence of anti-Leptospira IgM antibodies and Leptospira DNA. The partial genome sequence was obtained from six of 12 Leptospira seminested PCR-positive patients. The sequences showed > 97.0% similarity to Leptospira interrogans (Table 2). The PCR-positive samples were obtained from patients seen between 1 and 5 days after disease onset. One patient from the Shah Alam clinic was also later tested positive for chikungunya virus (CHIKV) by RT-PCR (Table 2).
Table 2.
Data of Leptospira semi-nested PCR and IgM ELISA-positive patients
| Patient ID | Laboratory test | Days after disease onset | BLAST identity (similarity) | Accession no. | Coinfection | |
|---|---|---|---|---|---|---|
| Semi-nested PCR | IgM ELISA | |||||
| PSA008 | + | 1 | – | – | – | |
| PSA018 | + | 5 | Leptospira interrogans (97.87%) | LR792808 | – | |
| PSA020 | + | + | 3 | – | – | – |
| PSA035 | + | 1 | Leptospira interrogans (98.71%) | LR792809 | – | |
| PSA039 | + | 4 | – | – | – | |
| PSA043 | + | 2 | Leptospira interrogans (100%) | LR792804 | CHIKV | |
| PSA053 | + | 3 | – | – | – | |
| PSA055 | + | 3 | – | – | – | |
| KLTPG014 | + | 3 | – | – | – | |
| KLTPG015 | + | 3 | – | – | – | |
| KLTPG037 | + | 2 | – | – | – | |
| KLTPG041 | + | 3 | – | – | – | |
| KLTPG042 | + | 2 | – | – | – | |
| KLTPG048 | + | 3 | – | – | – | |
| KLTPG051 | + | 3 | – | – | – | |
| KLTPG052 | + | 2 | – | – | – | |
| GK003 | + | 2 | – | – | – | |
| GK006 | + | 2 | – | – | – | |
| GK009 | + | 1 | – | – | – | |
| GK014 | + | 1 | – | – | – | |
| GK016 | + | 3 | – | – | – | |
| GK022 | + | 1 | – | – | – | |
| GK024 | + | 1 | – | – | – | |
| GK025 | + | 1 | – | – | – | |
| GK032 | + | 3 | Leptospira interrogans (97.84%) | LR792805 | – | |
| GK040 | + | 1 | Leptospira interrogans (99.14%) | LR792806 | – | |
| GK048 | + | 1 | – | – | – | |
| GK053 | + | 4 | – | – | – | |
| HSFS009 | + | 1 | Leptospira interrogans (97.82%) | LR792807 | – | |
| KLJ004 | + | 1 | – | – | – | |
| KLJ005 | + | 1 | – | – | – | |
| KLJ007 | + | 3 | – | – | – | |
| KLJ023 | + | 2 | – | – | – | |
| KLJ026 | + | 1 | – | – | – | |
| KLJ032 | + | 1 | – | – | – | |
| KLJ037 | + | 4 | – | – | – | |
| KLJ039 | + | 2 | – | – | – | |
| KLJ041 | + | 3 | – | – | – | |
| KLJ042 | + | 1 | – | – | – | |
| KLJ043 | + | 2 | – | – | – | |
| KLJ045 | + | 5 | – | – | – | |
| KLJ046 | + | NR | – | – | – | |
| KLJ051 | + | 1 | – | – | – | |
| KLJ053 | + | 1 | – | – | – | |
| KLJ054 | + | 6 | – | – | – | |
| KLJ056 | + | NR | – | – | – | |
| GSB011 | + | 9 | – | – | – | |
| GSB013 | + | 1 | – | – | – | |
| GSB120 | + | 4 | – | – | – | |
| GHK002 | + | 2 | – | – | – | |
| GHK005 | + | 3 | – | – | – | |
| GHK013 | + | 2 | – | – | – | |
| GHK014 | + | 2 | – | – | – | |
| GHK015 | + | 1 | – | – | – | |
| GHK022 | + | 1 | – | – | – | |
| GHK026 | + | 2 | – | – | – | |
| GHK027 | + | 3 | – | – | – | |
= positive for the respective laboratory test; – = none; GHK = Hulu Klang; GK = Kuang; GSB = Sungai Buloh; HSFS = Kampung Soeharto; KLJ = Jenjarom; KLTPG = Teluk Panglima Garang; PCR = polymerase chain reaction; PSA = Shah Alam; NR = not recorded.
The state of Selangor recorded the highest number of leptospirosis and DF coinfection cases in Malaysia.5 However, with the vast overlapping spectrum of clinical manifestations and higher DF incidence rate, leptospirosis is more likely to be mistakenly diagnosed as DF. The present study hence sought to determine the prevalence of leptospirosis among the DF-negative patients. Our results of 4.7% confirmed for leptospirosis is lower compared with an earlier study reporting that 38.1% of leptospirosis cases from 10 Malaysian hospitals were misdiagnosed as DF or dengue hemorrhagic fever.6 The results nonetheless support the possibility of misdiagnoses of leptospirosis in the background of high DF incidence. Similar misdiagnoses were also observed among patients with the initial suspicion of DF in Brazil3 and Mexico.9
The febrile patient cohort in this study was first confirmed using serological and molecular assays as DF-negative before they were tested for leptospirosis. The overall leptospirosis prevalence of 4.7% among febrile patients who tested negative for dengue was lower than the 8.4%10 obtained in a previous study among the hospitalized febrile population. This could be explained by the differences in the diagnostic method used (PCR versus microscopic agglutination test [MAT]) and the studied population (outpatient versus inpatient) in the respective studies. The prevalence rate was also lower compared with a study in Brazil where the authors estimated that 20.3% of dengue-like cases may actually be leptospirosis in areas where both diseases are endemic.3 Contrasting prevalence rate was also observed between a population of high-risk workers exposed to environments contaminated with the urine of infected animals (33.6%)11 and the present study (4.7%).
Seminested PCR and IgM ELISA were used to detect the presence of Leptospira DNA and antibodies among the DF-negative patients in this study. Both diagnostic approaches are advantageous because they widen the diagnostic window for leptospirosis.3 PCR can detect the presence of Leptospira sp. during the early-acute phase, whereas IgM ELISA detects the late-acute phase.13 This explains the detection of Leptospira DNA (4.7%) in patients between 1 and 5 days of disease onset (Table 2), supporting detection at the early-acute phase of leptospirosis.12,13 The seminested PCR targets the lipL32 gene, found exclusively in pathogenic Leptospira strains.14,15 Nested PCR is suited for amplifying lesser quantities of genetic material because in some cases of leptospirosis, the leptospiremia stage could be short due to the rapid elimination of leptospires after empirical antibiotic treatment.12 Sequencing of the seminested PCR products resulted in identification of Leptospira interrogans, a pathogenic strain implicated in hospital infections in Malaysia.10
On the basis of the IgM-ELISA results, the presumptive leptospirosis patients had detectable anti-Leptospira IgM antibodies as early as 1 to 9 days after the onset of febrile disease. IgM antibodies, however, were reported to be generally present only from the fourth day after disease onset.12 Hence, the diagnosis of leptospirosis using IgM ELISA alone may contribute to false positives for early-acute phase samples. Therefore, the combination of seminested PCR and IgM ELISA could be the optimal diagnostic approach because it will allow for a larger window of detection, encompassing the early-acute bacteremic and late-acute phases of the infection. In the present study, only one patient was positive for the detection of both Leptospira DNA and anti-Leptospira IgM antibodies. The finding is not surprising because the laboratory features of leptospirosis are less prominent5 and may sometimes result in the concurrent detection of early- and late-acute phase markers. One of this study’s limitation was the exclusion of MAT, hence we were not able to identify the Leptospira serovars affecting the patients.
Detection of CHIKV in a patient with confirmed leptospirosis highlights the challenges in clinical diagnosis of infectious diseases in endemic regions. Diseases such as chikungunya share overlapping clinical symptoms with leptospirosis and DF,16 and if the coinfection is not identified, it can lead to severe, poor clinical outcome.5 Findings from the present study hence are consistent with earlier studies that highlighted the need to have better laboratory diagnostic tools to differentiate among dengue, chikungunya, and leptospirosis. Whereas dengue and chikungunya are usually symptomatically treated, leptospirosis can be rapidly treated with antibiotics if detected early. Otherwise, the infection may become progressively worse, leading to a fatal infection.
ACKNOWLEDGMENTS
We thank the Selangor state health department for supporting this study. The American Society of Tropical Medicine and Hygiene (ASTMH) assisted with publication expenses.
REFERENCES
- 1. Garba B Bahaman AR Bejo SK Zakaria Z Mutalib AR Bande F , 2017. Major epidemiological factors associated with leptospirosis in Malaysia. Acta Trop 178: 242–247. [DOI] [PubMed] [Google Scholar]
- 2. Benacer D Kwai LT Ng CM Verasahib KB Galloway RL Hartskeerl RA Souris M Mohd Zain SN , 2016. Epidemiology of human leptospirosis in Malaysia, 2004–2012. Acta Trop 157: 162–168. [DOI] [PubMed] [Google Scholar]
- 3. Fontes RM Cavalcanti LPD Oliveira ACA Bezerra LFD Gomes AMM Colares JKB Lima DM , 2015. A new possibility for surveillance: do we identify all cases of leptospirosis? Rev Inst Med Trop São Paulo 57: 443–446. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Loong SK et al. 2018. Serological evidence of high Leptospira exposure among indigenous people (Orang Asli) in Peninsular Malaysia using a recombinant antigen-based ELISA. Trop Biomed 35: 1–9. [PubMed] [Google Scholar]
- 5. Hishamshah M Ahmad N Ibrahim HM Halim NAN Nawi S Amran F , 2018. Demographic, clinical and laboratory features of leptospirosis and dengue co-infection in Malaysia. J Med Microbiol 67: 806–813. [DOI] [PubMed] [Google Scholar]
- 6. Noor Rafizah AA et al. 2012. Leptospirosis in northeastern Malaysia: misdiagnosed or coinfection? Int J Collab Res Intern Med Public Health 4: 1419–1427. [Google Scholar]
- 7. Mudin RN , 2015. Dengue incidence and the prevention and control program in Malaysia. IMJM 14: 5–9. [Google Scholar]
- 8. Abdullah NM et al. 2019. Leptospirosis and its prevention: knowledge, attitude and practice of urban community in Selangor, Malaysia. BMC Public Health 19: 628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Dircio Montes Sergio A González Figueroa E María Saadia VG Elizabeth SH Beatriz RS Altuzar Aguilar Víctor M Navarrete Espinosa J , 2012. Leptospirosis prevalence in patients with initial diagnosis of dengue. J Trop Med 2012: 519701. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Noor Rafizah AA et al. 2013. A hospital-based study on seroprevalence of leptospirosis among febrile cases in northeastern Malaysia. Int J Infect Dis 17: e394–e397. [DOI] [PubMed] [Google Scholar]
- 11. Rahman MHAA et al. 2018. Seroprevalence and distribution of leptospirosis serovars among wet market workers in northeastern Malaysia: a cross sectional study. BMC Infect Dis 18: 569. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Picardeau M , 2013. Diagnosis and epidemiology of leptospirosis. Med Mal Infect 43: 1–9. [DOI] [PubMed] [Google Scholar]
- 13. Budihal SV Perwez K , 2014. Leptospirosis diagnosis: competency of various laboratory tests. J Clin Diagn Res 8: 199–202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Hernández-Rodríguez P Gomez RA Baquero M Quintero G , 2014. Identification of ompL1 and lipL32 genes to diagnosis of pathogenic Leptospira spp. isolated from cattle. OJVM 4: 102–112. [Google Scholar]
- 15. Chen HW Weissenberger G Atkins E Chao CC Suputtamongkol Y Ching WM , 2015. Highly sensitive loop-mediated isothermal amplification for the detection of Leptospira. Int J Bacteriol 2015: 147173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Sam IC et al. 2012. Genotypic and phenotypic characterization of chikungunya virus of different genotypes from Malaysia. PLoS One 7: e50476. [DOI] [PMC free article] [PubMed] [Google Scholar]