Abstract
A mouse testis-specific long noncoding RNA (lncRNA), Start, is localized in the cytosol of Leydig cells and in the nucleus of pachytene spermatocytes. We previously showed that Start regulates steroidogenesis through controlling the expression of Star and Hsd3b1 genes in Leydig cells, but its function in germ cells was not known. Here we verified that a spermatocyte-specific protease gene, Prss43/Tessp-3, was downregulated in Start-knockout testes. To investigate the transcriptional regulatory activity of Start in spermatocytes, we first performed a series of reporter gene assays using a thymidine kinase promoter in spermatocyte-derived GC-2spd(ts) cells. A 5.4-kb genome sequence encompassing Start exhibited enhancer activity for this promoter, and the activity was decreased by knockdown of Start. Deletion of the Start promoter and replacement of the Start sequence abolished the enhancer activity and, consistently, the activity was detected in further experiments only when Start was actively transcribed. We then examined whether the Prss43/Tessp-3 gene could be a target of Start. A reporter gene assay demonstrated that the 5.4-kb sequence exhibited enhancer activity for a Prss43/Tessp-3 promoter in GC-2spd(ts) cells and that the activity was significantly decreased by knockdown of Start. These results suggest that Start functions in transcriptional activation of the Prss43/Tessp-3 gene in spermatocytes. Given that Start is presumed to regulate steroidogenic genes at the posttranscriptional level in Leydig cells, the function in spermatocytes is a novel role of Start. These findings provide an insight into multifunctionality of lncRNAs in the testis.
Introduction
Long noncoding RNAs (lncRNAs) are a class of noncoding RNAs that are longer than 200 nucleotides and play important roles in various biological events [1, 2]. In mammals, the testis is known to express more lncRNAs than other tissues [3, 4], and transcriptome studies have revealed dynamic change of lncRNA expression during spermatogenesis [5–7]. These findings suggest biological significance of lncRNAs in the testis. Indeed, knockout (KO) mouse models of several testis-specific lncRNAs showed defects in the production or quality of sperm [8–10], and in vivo knockdown of lncRNAs in the testis resulted in obvious impairment of spermatogenesis [11, 12]. However, only a few lncRNAs have been functionally assessed.
Interestingly, some lncRNAs were found to have multiple roles [13–16]. For example, treRNA/ncRNA-a7 enhances gene transcription in the nucleus of some human cell lines, while it suppresses translation in the cytosol of breast cancer cells [17, 18]. H19 plays a role in genomic imprinting in the nucleus of neonatal liver cells and acts as a decoy against miRNAs in ovarian and kidney cells [19, 20]. Gas5 interacts with miRNAs in the cytosol of gastric cancer cells, while it is a component of nuclear structures in fibroblasts and antagonizes the glucocorticoid receptor in the nucleus of Hela cells [21–23]. These findings indicate that multifunctional lncRNAs play different roles according to cell types or subcellular localization. Since there are many lncRNAs expressed in multiple tissues or localized in different subcellular compartments [24–26], other lncRNAs are highly likely to be multifunctional.
We have focused on lncRNAs that are transcribed at the mouse Prss/Tessp locus, which encodes six testis-specific protease genes and three lncRNAs [27–29] (Fig 1A). Start, an lncRNA at this locus, is expressed in both Leydig cells and germ cells. In our previous study, we verified that Start regulates the production of testosterone via activation of two steroidogenic genes, Star and Hsd3b1, in Leydig cells [30]. Localization of Start in the cytosol of Leydig cells led to the presumption that the steroidogenic genes are regulated at the posttranscriptional level by Start. In contrast, in pachytene spermatocytes, Start is localized in the nucleus [30]. These results suggest that Start functions at the transcriptional level.
Fig 1. Expression of Prss/Tessp genes in Start-KO and wild-type testes.
(A) A schematic drawing of a 75-kb genomic region at mouse chromosome 9 (9: 110,625,000–110,700,000). Six white boxes specify protein-coding Prss/Tessp genes, whereas three black boxes are lncRNAs. Bent arrows indicate the transcriptional direction of each gene. An enlarged drawing at the bottom indicates positions of promoters and a BAC-derived sequence used in this study. Two grey boxes at the left-end of Prss43/Tessp-3 and Prss46 genes are regions of putative promoters, and a bold black bar is a region corresponding to a BAC-derived sequence that encompasses the full length of the Start sequence. (B) Expression of Prss/Tessp genes in the testis at 2.5 months determined by RNA-seq analysis. Total RNAs were purified from 2.5-month-old wild-type and Start-KO testes and used for RNA-seq analysis. The TPM values of Prss42/Tessp-2, Prss43/Tessp-3, Prss44/Tessp-4, Prss45/TESPL, Prss46, and Prss50/Tsp50 in Start-KO and wild-type testes were calculated. White bars represent the data from a wild-type testis, and black bars represent those from a Start-KO testis. RNA-seq was done with one set of littermates. (C) Expression of the Prss/Tessp genes in the testis at 2.5 months determined by qRT-PCR. Total RNAs were purified from 2.5-month-old wild-type and Start-KO testes and used for qRT-PCR. The Gapdh gene was used as an internal control to normalize the expression level of each gene. Data are presented as means ± S.D. from four sets of wild-type and KO littermates. Statistical significance was analyzed by Student’s t-test. **P < 0.01.
In this study, we investigated the role of Start in spermatocytes and revealed that Start transcript plays a role in transcriptional activation of a neighboring spermatocyte-specific gene, Prss43/Tessp-3. This strongly suggests that Start is a multifunctional lncRNA that regulates steroidogenesis in Leydig cells and activates the transcription of a protease gene in spermatocytes.
Materials and methods
Animals
The experimental procedures used in this study were approved by the Institutional Animal Use and Care Committee at Hokkaido University. Start-KO mice were generated as previously described [30]. The mice were maintained on 14 hr light/10 hr dark cycles at 25℃ and given food and water ad libitum. In the analysis of Start-KO mice, we used male mice at 64–83 days postpartum.
RNA-sequencing (RNA-seq) analysis
RNA-sequencing (RNA-seq) data (SRR12700726 and SRR12700727) were analyzed as previously described [30]. The expression level of each gene was calculated as gene-specific transcript per million mapped reads (TPM).
Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis
Total RNAs were extracted by ISOGEN (Nippon Gene, Tokyo, Japan) and ISOGEN II (Nippon Gene) for testes and cultured cells, respectively, according to the manufacturer’s instructions. After treatment with TurboDNase (Thermo Fisher Scientific, Waltham, MA, USA), the RNAs were reverse-transcribed into cDNAs with the oligo(dT) primer using Superscript III (Thermo Fisher Scientific), according to the manufacturer’s instructions. PCR was performed by using SYBR Green PCR Master Mix (Thermo Fisher Scientific). The 7300 real-time PCR system (Applied Biosystems, Foster City, CA, USA) was used. The relative expression levels were normalized to an endogenous Gapdh mRNA. Primer sequences are shown in Table 1.
Table 1. Oligo DNA sequences used in this study.
| Name | Forward | Reverse |
|---|---|---|
| [qRT-PCR] | ||
| Prss42/Tessp-2 | ATGCATGTCTGTGGAGGTTC | CTGAAAGTGTGACCCTGGTC |
| Prss43/Tessp-3 | GGTCTGCAAGACTCAGGACA | AGAGGACAGGGACTCCATTG |
| Prss44/Tessp-4 | CAAGGACATCATGGGGAATA | CTACCTGCACCCACGTTTTA |
| Prss45/TESPL | GGGAGGACTTGTGCTATGGA | ATGAGAATACCCCAGCCAGA |
| Prss46 | TGGTTTGCCAGATGAACAAG | TGGTGTAGACGCTTGGGAAT |
| Prss50/Tsp50 | CCACCGAACTCACAGACCAT | GTTGCTGGAATGAACCGTCT |
| Gapdh | TGCACCACCAACTGCTTAGC | GGCATGGACTGTGGTCATGAG |
| Start | CCCACTCTTAGCCTCATGGT | CCATCACCCAGCCTGTTCGTT |
| [shRNA] | ||
| shRNA-v1 | GATCCGGACAATCAGTTGTTCCTTTGCTGTGAAGCCACAGATGGGCAAAGGAACAACTGATTGTCCTTTTTTA | AGCTTAAAAAAGGACAATCTGTTGTTCCTTTGCCCATCTGTGGCTTCACAGCAAAGGAACAACTGATTGTCCG |
| shRNA-v2 | GATCCGGATGAAGATTTCTAGCAAGTCTGTGAAGCCACAGATGGGACTTGCTAGAAATCTAACATCCTTTTTTA | AGCTTAAAAAAGGATGAAGATTTCTAGCAAGTCCCATCTGTGGCTTCACAGACTTGCTADAAATGTTCATCC |
| [RT-PCR] | ||
| Start | CCCACTCTTAGCCTCATGGT | ATCGCATATCGAGGCAAGCA |
| Gapdh | CATGACCACAGTCCATGCCATC | TAGCCCAAGATGCCCTTCAGTG |
| [Cloning] | ||
| Prss43/Tessp-3 Promoter | GGTACTCATGCGCCTCGAAA | GGTCCTGAGTTAAGCCCGAA |
| Prss46 Promoter | GCTCCTATCCTCCTGTCCCT | TCCACCGCCTTCCCATTTAC |
Plasmid construction
The thymidine kinase (TK) promoter was obtained as a 750-bp fragment from a pEBMulti-Neo vector (Fujifilm Wako, Osaka, Japan) by digestion with BglII and HindIII. This 750-bp promoter sequence was inserted at the BglII/HindIII site of a pGL3-Basic vector (Promega, Madison, WI, USA). The resulting construct was denoted as “Control”.
To obtain Start and its flanking sequence, a bacterial artificial chromosome clone encompassing the Prss/Tessp gene cluster (B6Ng01‐306O15, RIKEN Bioresource Center, Tsukuba, Japan) was digested with SacII, and a 5.4-kb fragment was blunted and subcloned into the EcoRV site of a pBluescript II KS(+) vector. This “pBlue-BAC-5.4kb” plasmid was then digested with NotI and SalI, and the 5.4-kb fragment was blunted and inserted at the blunted BamHI site of “Control”. The resulting construct was denoted as “TK-BAC”.
“TK-BAC” was digested with ApaI to separate the 10.9-kb sequence into 1.6-kb and 9.3-kb fragments. The 1.6-kb fragment was further digested with EcoRV, and a longer 1.3-kb fragment was collected. Then the 9.3-kb and 1.3-kb fragments were blunted and ligated to each other, resulting in the generation of “ΔProm” that lacked an approximately 350-bp region around the transcriptional start site of Start (S1A Fig). For construction of “λEco” and “λApa”, “TK-BAC” was digested with EcoRV/SalI and ApaI/SalI, respectively, and blunted. Then, a 2.3-kb λHindIII fragment was blunted and ligated to each vector. This resulted in the completion of “λEco” and “λApa” (S1B and S1C Fig).
The full-length sequence of Start was subcloned into a pBluescript II KS(+) vector as previously described [30]. The Start sequence was digested out with EcoRI and HindIII, blunted, and inserted at the blunted BamHI site of “Control” in different directions. The resulting constructs were denoted as “Start-Forward” and “Start-Reverse”.
To generate constructs containing a half of the 5.4-kb BAC fragment, “pBlue-BAC-5.4kb” was digested with ApaI, and 1.6-kb and 4.0-kb fragments were collected and ligated to each other. The resulting plasmid was digested with NotI and SalI, blunted, and inserted at the blunted BamHI site of “Control”. The resulting construct that contained the second half of the 5.4-kb fragment was denoted as “TK-BAC-SH” (S1D Fig). On the other hand, a 2.7-kb fragment was collected after digestion of “pBlue-BAC-5.4kb” with ApaI, blunted, and inserted at the blunted BamHI site of “Control”. The resulting construct is “TK-BAC-FH”, which contained the first half of the 5.4-kb fragment (S1E Fig).
The promoter sequences of Prss43/Tessp-3 and Prss46 genes were amplified by PCR with pairs of primers listed in Table 1. Each PCR product was inserted at the SmaI site of a pGL3-Basic vector (Promega). The resulting constructs were denoted as “Pr43-Cont” and “Pr46-Cont”. A 5.4-kb BAC fragment was obtained by digestion of “pBlue-BAC-5.4kb” with NotI and SalI, blunted, and inserted at the blunted BamHI site. The resulting constructs were denoted as “Pr43-BAC” and “Pr46-BAC”. The length of each promoter (2.3 kb for Prss43/Tessp-3 and 1.0 kb for Prss46) was determined according to previous studies [31, 32].
For knockdown (KD) experiments, a pBAsi-mU6 Neo vector (Takara, Shiga, Japan) was modified to have hygromycin resistance. The SV40 promoter and the hygromycin resistance gene were obtained by PCR using a Glo Sensor-22F vector (Promega) and ligated to the blunted EcoRI site of pBAsi-mU6 Neo. Two shRNAs for Start transcript were designed by the web tool BLOCK-iT RNAi Designer (https://rnaidesigner.thermofisher.com). Sense and antisense oligo DNAs of the designed sequences (Table 1) were annealed and inserted at the BamHI/HindIII site of the modified vector (“shRNA-v1” and “shRNA-v2”).
Cell culture and transfection
GC-2spd(ts) cells (CRL-2196) were obtained from American Type Culture Collection and were cultured in DMEM (Fujifilm Wako) containing 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin, and 292 μg/ml L-glutamine (Nacalai tesque, Kyoto, Japan). For transient transfection, 2.0×104 cells were seeded in each well of a 24-well plate one day before transfection. Five hundred nanograms of DNA constructs was used for transfection with GeneJuice (Merck, Darmstadt, Germany) according to the manufacturer’s protocol. To establish GC-2spd(ts) cells that were stably transfected with luciferase constructs, a pKO-SelectPuro V810 vector (Lexicon Genetics, The Woodlands, TX, USA) was co-transfected, and the selection was done with 3 μg/ml puromycin for 2 weeks. shRNA-v1 and shRNA-v2 were transfected into the stable cells and the cells were treated with 300–500 μg/ml hygromycin for 5–10 days.
Reporter gene assay
All constructs for the reporter gene assay contained the firefly luciferase gene. For a transient assay, the pRL‐CMV vector (Promega), in which the Renilla luciferase gene was driven by the CMV promoter, was co-transfected with experimental constructs. Luciferase activity was measured 2 days after transfection with a Dual-Luciferase Reporter Assay System (Promega) using Lumat LB9507 (Berthold, Bad Wildbad, Germany). The value of firefly luciferase was normalized to that of Renilla luciferase for adjusting transfection efficiency in each trial. For stable cells, the value of firefly luciferase was normalized to the protein amount that was determined by using a BCA Protein Assay Kit (Thermo Fisher Scientific).
RT-PCR analysis
cDNAs were synthesized as described above using the oligo(dT) primer. PCR was performed using ExTaq polymerase (Takara) or KOD Fx Neo (Toyobo, Osaka, Japan), and the products were analyzed by electrophoresis on agarose gels. Primer sequences are shown in Table 1.
Statistical analysis
Results are presented as the mean value ± standard deviation (S.D.) of at least three independent experiments. The data were statistically analyzed by Student’s t-test or one-way analysis of variance (ANOVA) followed by Dunnett’s test or post-hoc Tukey HSD test. A P value less than 0.05 was considered statistically significant. All statistical calculations were done by R software (Ver. 3.5.0; https://cran.ism.ac.jp/bin/windows/).
Results
Prss43/Tessp-3 and Prss45/TESPL genes were downregulated in Start-KO testes
We previously generated Start-KO mice and performed RNA-seq analysis with whole testes of 2.5-month-old wild-type and Start-KO mice [30]. As a result of calculation of TPM values, expression of two neighboring genes of Start, Prss43/Tessp-3 and Prss45/TESPL, was decreased to 6% and 28%, respectively, in Start-KO testes (Fig 1B). For further confirmation, we performed qRT-PCR using four sets of adult Start-KO and wild-type testes and revealed that Prss43/Tessp-3 and Prss45/TESPL genes were significantly downregulated to 8% and 64%, respectively, in Start-KO testes (Fig 1C). The two genes were transcriptionally activated in primary spermatocytes [27, 33] and Start is localized in the nucleus at this meiotic stage, implying a role of Start in transcriptional activation in spermatocytes. In this study, we focused on regulation of the Prss43/Tessp-3 gene, which was more prominently affected by Start-KO.
Activation of a thymidine kinase promoter by the Start transcript
To examine whether Start possessed transcriptional regulatory activity, we performed a reporter gene assay using a 5.4-kb genome sequence and the TK promoter (Fig 2A). This 5.4-kb sequence encompassed the full length of Start (1822 bp) and its 2886-bp upstream and 702-bp downstream sequences, and the TK promoter was used as a promoter to drive the luciferase gene. As a model for this reporter gene assay, we used mouse spermatocyte-derived GC-2spd(ts) cells. Although this cell line is one of good models for the study of testicular germ cells, it is different from actual spermatocytes in terms of its phenotype and gene expression pattern [34, 35] Thus, the results should be interpreted with caution.
Fig 2. Effects of knockdown (KD) on enhancer activity of the BAC-5.4kb genome sequence encompassing Start.
(A) Reporter constructs and positions of sequences targeted by shRNAs. The BAC-5.4kb sequence shown at the top is derived from a BAC clone and carries the full length of Start (a black box). Two short lines represent sequences targeted by shRNAs for the knockdown (KD) experiment in (C). The “Control” vector contains the firefly luciferase gene (Luc) driven by the TK promoter. The “TK-BAC” construct has the BAC-5.4kb sequence downstream of Luc of the “Control” vector. (B) Enhancer activity of the BAC-5.4kb by a reporter gene assay. The “TK-BAC” and “Control” vectors were transfected into GC-2spd(ts) cells, and two days later, the cells were collected, and firefly luciferase activity was measured. Each value was normalized to that of Renilla luciferase activity, which was derived from a co-transfected construct. Data are presented as means ± S.D. from six independent experiments. Statistical significance was analyzed by Student’s t-test. **P < 0.01. (C) KD of Start decreased enhancer activity of TK-BAC-5.4kb. (Left) KD efficiency of two shRNAs (shRNA-v1 and shRNA-v2) was evaluated by qRT-PCR. The “TK-BAC” construct was stably transfected into GC-2spd(ts) cells, and two shRNA constructs and a control construct (Empty) were transiently transfected into these stable cell lines. After selection with hygromycin, total RNA was collected from each sample and used for qRT-PCR. The Gapdh gene was used as an internal control to normalize the expression level of each gene. (Right) The effect of Start-KD on enhancer activity of BAC-5.4kb was evaluated by a reporter gene assay. Firefly luciferase activity was measured and normalized to the amount of protein determined by the BCA assay. In both graphs, the value in the “Empty” group was set to 1.0. Data are presented as means ± S.D. from five independent experiments. Statistical significance was analyzed by one-way ANOVA followed by Dunnett’s test. **P < 0.01.
In GC-2spd(ts) cells, the 5.4-kb sequence significantly elevated TK promoter activity (Fig 2B), and in this assay, expression of the Start transcript was detected only in the cells with TK-BAC (S2 Fig). To examine whether the Start transcript contributed to enhancer activity of the 5.4-kb sequence, we established GC-2spd(ts) cells stably transfected with TK-BAC and performed Start KD. Two shRNAs decreased Start expression by approximately 40% and 60%, respectively, which led to a significant decrease in luciferase activity compared to the control (Fig 2C). These results supported the notion that Start contributed to the enhancer activity of the 5.4-kb sequence for the TK promoter.
To further assess the activity of Start, we performed additional reporter gene assays in GC-2spd(ts) cells. First, we deleted the Start promoter and replaced the Start sequence with λ-DNA in the 5.4-kb sequence (Fig 3A). The promoter deletion, which greatly reduced Start expression (Fig 3B), abolished the enhancer activity, and the construct with the replacement did not show enhancer activity (Fig 3C). Second, to check the enhancer activity of each part of the 5.4-kb sequence, we prepared constructs containing the Start sequence alone and the first and second halves of the 5.4-kb sequence (Fig 4A). Start expression was detected in the cells with Start-Forward, Start-Reverse, TK-BAC and TK-BAC-SH (Fig 4B), and luciferase activity was higher in these constructs than in Control (Fig 4C). These findings indicate that the 5.4-kb genome sequence shows enhancer activity for the TK promoter when Start is actively transcribed and that the Start transcript contributes to the enhancer activity.
Fig 3. Attenuated enhancer activity caused by deletion of the Start promoter in the BAC-5.4kb sequence.
(A) Reporter constructs used in (B) and (C). “Control” and “TK-BAC” were described in the legend of Fig 2A. The “ΔProm” construct lacked a 354-bp sequence around the transcriptional start site of Start in “BAC-5.4kb”. This deletion is shown in detail in an enlarged circle on the right. The “λEco” construct carries a 2.3-kb λHindIII fragment in replacement with the Start sequence in “BAC-5.4kb”. The “λApa” construct lacks a 354-bp sequence around the transcriptional start site of Start in “λEco”. (B) Expression of Start in GC-2spd(ts) cells transfected with TK-BAC and ΔProm. Total RNA was collected from each sample and used for RT-PCR. The Gapdh gene was used as a positive control. Reverse transcription was done with (+) or without reverse transcriptase (-). The cycle numbers of PCR were 30 for Start and 25 for Gapdh. (C) Loss of enhancer activity in the BAC5.4-kb sequence by a deletion of the Start promoter and a replacement of the Start sequence. Each construct in (A) was separately transfected into GC-2spd(ts) cells. Two days later, firefly luciferase activity was measured, and each value was normalized to Renilla luciferase activity. The value in “Control” was set to 1.0. Data are presented as means ± S.D. from six independent experiments. Statistical significance was analyzed by one-way ANOVA followed by Dunnett’s test. Different letters represent the statistical significance (P < 0.01) among experimental groups.
Fig 4. Enhancer activity of parts of the BAC-5.4kb sequence.
(A) Reporter constructs used in (B) and (C). “Control” and “TK-BAC” were described in the legend of Fig 2A. The “Start-Forward” and “Start-Reverse” constructs contained the Start sequence downstream of the firefly luciferase gene (Luc) driven by the TK promoter in the forward and reverse directions, respectively. The “BAC-FH” and “BAC-SH” constructs contained the TK-driven Luc connected to the first half and the second half of the BAC-5.4kb genome sequence, respectively. (B) Start transcription from each construct in a reporter gene assay. Total RNA was collected from each sample and used for RT-PCR. The Gapdh gene was used as a positive control. Reverse transcription was done with (+) or without reverse transcriptase (-). The cycle numbers of PCR were 30 for Start and 25 for Gapdh. (C) Enhancer activity in each part of the BAC-5.4kb sequence encompassing Start. The constructs shown in (A) were separately transfected into GC-2spd(ts) cells. Two days later, firefly luciferase activity was measured and normalized to Renilla luciferase activity, which was derived from a co-transfected construct. The value in “Control” was set to 1.0. Data are presented as means ± S.D. from nine independent experiments. Statistical significance was analyzed by one-way ANOVA followed by post-hoc Tukey HSD test. Different letters represent the statistical significance (P < 0.01) among experimental groups.
Activation of a Prss43/Tessp-3 promoter by the Start transcript
We then investigated the contribution of Start to the transcriptional activation of the Prss43/Tessp-3 gene. The 5.4-kb sequence was connected to the luciferase gene driven by the Prss43/Tessp-3 promoter and the Prss46 promoter as a control (Fig 5A). A reporter gene assay in GC-2spd(ts) cells showed that the 5.4-kb sequence exhibited significant enhancer activity for the Prss43/Tessp-3 promoter but not for the Prss46 promoter (Fig 5B and 5C). To examine the contribution of the Start transcript to the enhancer activity, we established GC-2spd(ts) cells stably transfected with Pr43-BAC and Pr46-BAC, and shRNA-v2 for Start was transfected. As expected, the luciferase activity of Pr43-BAC was significantly decreased by Start KD, but that of Pr46-BAC was unchanged (Fig 5D and 5E). These findings suggest that the Start transcript functions in the activation of the Prss43/Tessp-3 gene.
Fig 5. The BAC-5.4kb sequence increased promoter activity of Prss43/Tessp-3 gene.
(A) Reporter constructs used in (B)-(E). The promoter sequence of each Prss/Tessp gene was inserted at the upstream of the firefly luciferase gene which was connected to the BAC-5.4kb sequence encompassing Start. (B, C) Enhancer activity of the BAC-5.4kb sequence for Prss43/Tessp-3 and Prss46 promoters by a reporter assay. Each construct depicted in (A) was transfected into GC-2spd(ts) cells, and two days later, firefly luciferase activity was measured. Each value was normalized to that of Renilla luciferase activity, which was derived from a co-transfected construct. Data are presented as means ± S.D. from three independent experiments. Statistical significance was analyzed by Student’s t-test. **P < 0.01. (D, E) Effects of Start-KD on enhancer activity of the 5.4-kb sequence. Each construct containing BAC-5.4kb in (A) was stably transfected into GC-2spd(ts) cells. The shRNA-v2 for Start was then transfected into the established cells, and after selection with hygromycin, firefly luciferase activity was measured. Each value was normalized to the amount of protein determined by the BCA assay. Data are presented as means ± S.D. from three independent experiments. Statistical significance was analyzed by Student’s t-test. **P < 0.01.
Discussion
In this study, we assessed transcriptional regulatory activity of Start by using the 5.4-kb BAC sequence and showed evidence for its role in activation of the TK promoter by a series of reporter gene assays. First, the enhancer activity of the 5.4-kb sequence was decreased by Start KD (Fig 2). Second, deletion of the Start promoter (ΔProm) greatly impaired Start transcription and diminished the enhancer activity (Fig 3). Third, replacement of the Start sequence with λ-DNA (λEco) decreased the enhancer activity (Fig 3). Fourth, partial sequences of the 5.4-kb BAC that drove Start expression showed higher enhancer activity than that of sequences not driving Start transcription (Fig 4). These findings indicate that Start transcription plays a role in activation of the TK promoter. Considering significant decreases of the activity by Start KD, Start is presumed to function in transcriptional activation as a transcript.
Since lncRNAs are frequently associated with enhancers [36, 37], whether the 5.4-kb genome sequence itself possesses enhancer activity is an important question. To answer this, constructs that do not drive Start transcription are useful. The ΔProm construct, which contained most of the 5.4-kb sequence but did not drive Start transcription, showed no enhancer activity (Fig 3). The deleted sequence in ΔProm remained in the λEco construct, which also showed no enhancer activity. Therefore, it is assumed that the 5.4-kb genome sequence does not possess enhancer activity. However, it is also true that TK-BAC and TK-BAC-SH showed higher activity than Start-Forward and Start-Reverse (Fig 4), which suggests that some sequences surrounding Start contribute to increasing the enhancer activity. It is possible that both transcript and genomic sequence contribute to the enhancer activity, and our current findings strongly suggest that the Start transcript functions in transcriptional activation. Given that the Start transcript is localized in the nucleus of pachytene spermatocytes, Start is presumed to play a role in transcriptional activation at this stage.
As a potential target of Start, we investigated the Prss43/Tessp-3 gene because it was greatly downregulated in Start-KO testes (Fig 1). The enhancer activity of the 5.4-kb sequence for a Prss43/Tessp-3 promoter was significantly decreased by Start KD (Fig 5), suggesting that the Start transcript from the 5.4-kb sequence functioned in transcriptional activation of Prss43/Tessp-3. Moreover, Start expression is elevated at 14 days postpartum, a few days earlier than Prss43/Tessp-3 activation during testis development [27, 30]. Therefore, the Prss43/Tessp-3 gene is likely to be a target of Start. Because the expression was decreased by 92% in Start-KO testes (Fig 1C), Start is probably a critical factor for Prss43/Tessp-3 gene activation.
It is interesting that Start-KO mice showed normal spermatogenesis despite a substantial decrease in expression of the Prss43/Tessp-3 gene, which is considered to be important for the progression of meiosis [27]. This may be because the low level of expression in Start-KO testes was sufficient for meiosis or because other proteases compensated the function of Prss43/Tessp-3, as has been suggested for some testicular genes [38, 39]. Alternatively, abnormality may appear at younger or older ages than the ages of mice examined in this study. The phenotype of Start-KO mice is being investigated in more detail.
It is also remarkable that Start transcription was detected from Start-Forward and Start-Reverse constructs that included the entire Start sequence and no neighboring sequences (Fig 4). This suggests that the Start full-length sequence contained a minimum promoter. Given that the deletion of a 354-bp sequence around the transcriptional start site of Start abolished the Start transcription (Fig 3), the 209-bp region of the 5’ portion of the Start sequence might function as a minimum promoter. Elucidation of the detailed mechanism by which Start transcription is regulated will be one of our future challenges.
How could Start have different function in different cell types by targeting different genes? A clue to answering this question is the subcellular localization. An lncRNA could regulate transcription or could be a component of subnuclear structure in the nucleus [1, 2], whereas a cytosolic lncRNA could regulate gene expression by affecting the mRNA stability or controlling translation [40, 41]. Moreover, co-regulators are different between the nucleus and cytosol. While nuclear lncRNAs bind to transcription factors or epigenetic factors, cytosolic lncRNAs interact with miRNAs [42–46]. Thus, the identification of binding partners with Start in the nucleus of spermatocytes and in cytosol of Leydig cells will be required to understand more detailed mechanisms of gene regulation by Start. Such studies are ongoing.
Only a few of the many lncRNAs expressed in the testis have been functionally assessed and characterized [47–50]. Some mouse models with KO of lncRNAs in germ cells showed a defect in meiosis, smaller number of sperm, and less motile sperm, although no phenotype was reported in other KO mice [8–10, 51]. In Leydig cells, lncRNAs were predicted to regulate the miRNA-mRNA network [20, 52–55]. lncRNAs in either germ cells or Leydig cells were investigated in these studies. In this study, we found that Start, an lncRNA that regulates steroidogenesis in Leydig cells probably through a mechanism in the cytosol, is involved in transcriptional activation of a protease gene in the nucleus of germ cells. To the best of our knowledge, this is the first example of a multifunctional lncRNA in the testis. Since several lncRNAs were reported to be expressed in different cell types in the testis, with different subcellular localizations, or in different tissues including the testis [28, 29, 52, 56], more testicular lncRNAs may be multifunctional. Our findings provide an insight into a further understanding of the multifunctionality of testis lncRNAs.
Supporting information
(A) Construction of “ΔProm”. (B) Construction of “λEco”. (C) Construction of “λApa”. (D) Construction of “TK-BAC-SH”. (E) Construction of “TK-BAC-SH”.
(PDF)
Total RNA was collected from each sample and used for RT-PCR. The Gapdh gene was used as a positive control. Reverse transcription was done with (+) or without reverse transcriptase (-). The cycle numbers of PCR were 35 for Start and 25 for Gapdh, respectively.
(PDF)
(XLSX)
(PDF)
Acknowledgments
The present work was supported in part by the Ministry of Education, Culture, Sports, Science and Technology through the Program for Leading Graduate Schools (Hokkaido University “Ambitious Leader’s Program”). Computations were partially performed on the NIG supercomputer at ROIS National Institute of Genetics.
Data Availability
All relevant data are within the article and its Supporting Information files.
Funding Statement
This work was supported by KAKENHI 20H03285 (APK) and Grant-in-Aid for JSPS Research Fellow 18J21075 (KO) from the Japan Society for the Promotion of Science.
References
- 1.Quinn JJ, Chang HY. Unique features of long non-coding RNA biogenesis and function. Nat Rev Genet. 2016; 17:47–62. doi: 10.1038/nrg.2015.10 [DOI] [PubMed] [Google Scholar]
- 2.Statello L, Guo CJ, Chen LL, Huarte M. Gene regulation by long non-coding RNAs and its biological functions. Nat Rev Mol Cell Biol. 2021; 22:96–118. doi: 10.1038/s41580-020-00315-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Necsulea A, Soumillon M, Warnefors M, Liechti A, Daish T, Zeller U, et al. The evolution of lncRNA repertoires and expression patterns in tetrapods. Nature. 2014; 505:635–640. doi: 10.1038/nature12943 [DOI] [PubMed] [Google Scholar]
- 4.Washietl S, Kellis M, Garber M. Evolutionary dynamics and tissue specificity of human long noncoding RNAs in six mammals. Genome Res. 2014; 24:616–628. doi: 10.1101/gr.165035.113 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Laiho A, Kotaja N, Gyenesei A, Sironen A. Transcriptome profiling of the murine testis during the first wave of spermatogenesis. PLoS One. 2013; 8:e61558. doi: 10.1371/journal.pone.0061558 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Trovero MF, Rodríguez-Casuriaga R, Romeo C, Santiñaque FF, François M, Folle GA, et al. Revealing stage-specific expression patterns of long noncoding RNAs along mouse spermatogenesis. RNA Biol. 2020; 17:350–365. doi: 10.1080/15476286.2019.1700332 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Geisinger A, Rodríguez-Casuriaga R, Benavente R. Transcriptomics of Meiosis in the Male Mouse. Front Cell Dev Biol. 2021; 9:626020. doi: 10.3389/fcell.2021.626020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Anguera MC, Ma W, Clift D, Namekawa S, Kelleher RJ, Lee JT. Tsx produces a long noncoding RNA and has general functions in the germline, stem cells, and brain. PLoS Genet. 2011; 7:e1002248. 10.1371/journal.pgen.1002248 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Wichman L, Somasundaram S, Breindel C, Valerio DM, McCarrey JR, Hodges CA, et al. Dynamic expression of long noncoding RNAs reveals their potential roles in spermatogenesis and fertility. Biol Reprod. 2017; 97:313–323. doi: 10.1093/biolre/iox084 [DOI] [PubMed] [Google Scholar]
- 10.Chadourne M, Poumerol E, Jouneau L, Passet B, Castille J, Sellem E, et al. Structural and Functional Characterization of a Testicular Long Non-coding RNA (4930463O16Rik) Identified in the Meiotic Arrest of the Mouse Topaz1–/–Testes. Front Cell Dev Biol. 2021; 9:700290. 10.3389/fcell.2021.700290 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Li K, Xu J, Luo Y, Zou D, Han R, Zhong S, et al. Panoramic transcriptome analysis and functional screening of long noncoding RNAs in mouse spermatogenesis. Genome Res. 2021; 31:13–26. doi: 10.1101/gr.264333.120 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Liu W, Zhao Y, Liu X, Zhang X, Ding J, Li Y, et al. Novel Meiosis-Related lncRNA, Rbakdn, Contributes to Spermatogenesis by Stabilizing Ptbp2. Front Genet. 2021; 12:752495. 10.3389/fgene.2021.752495 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Tsai MC, Manor O, Wan Y, Mosammaparast N, Wang JK, Lan F, et al. Long noncoding RNA as modular scaffold of histone modification complexes. Science. 2010; 329:689–693. doi: 10.1126/science.1192002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Yang L, Lin C, Liu W, Zhang J, Ohgi KA, Grinstein JD, et al. ncRNA- and Pc2 methylation-dependent gene relocation between nuclear structures mediates gene activation programs. Cell. 2011; 147:773–788. doi: 10.1016/j.cell.2011.08.054 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Li S, Mei Z, Hu HB, Zhang X. The lncRNA MALAT1 contributes to non-small cell lung cancer development via modulating miR-124/STAT3 axis. J Cell Physiol. 2018; 233:6679–6688. doi: 10.1002/jcp.26325 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Yang Y, Jiang C, Guo L, Huang J, Liu X, Wu C, et al. Silencing of LncRNA-HOTAIR decreases drug resistance of Non-Small Cell Lung Cancer cells by inactivating autophagy via suppressing the phosphorylation of ULK1. Biochem Biophys Res Commun. 2018; 497:1003–1010. doi: 10.1016/j.bbrc.2018.02.141 [DOI] [PubMed] [Google Scholar]
- 17.Ørom UA, Derrien T, Beringer M, Gumireddy K, Gardini A, Bussotti G, et al. Long noncoding RNAs with enhancer-like function in human cells. Cell. 2010; 143:46–58. doi: 10.1016/j.cell.2010.09.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Gumireddy K, Li A, Yan J, Setoyama T, Johannes GJ, Orom UA, et al. Identification of a long non-coding RNA-associated RNP complex regulating metastasis at the translational step. EMBO J. 2013; 32:2672–2684. doi: 10.1038/emboj.2013.188 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Pfeifer K, Leighton PA, Tilghman SM. The structural H19 gene is required for transgene imprinting. Proc Natl Acad Sci USA. 1996; 93:13876–13883. 10.1073/pnas.93.24.13876 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Men Y, Fan Y, Shen Y, Lu L, Kallen AN. The Steroidogenic Acute Regulatory Protein (StAR) Is Regulated by the H19/let-7 Axis. Endocrinology. 2017; 158:402–409. doi: 10.1210/en.2016-1340 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Smith CM, Steitz JA. Classification of gas5 as a multi-small-nucleolar-RNA (snoRNA) host gene and a member of the 5’-terminal oligopyrimidine gene family reveals common features of snoRNA host genes. Mol Cell Biol. 1998; 18:6897–6909. doi: 10.1128/MCB.18.12.6897 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Kino T, Hurt DE, Ichijo T, Nader N, Chrousos GP. Noncoding RNA gas5 is a growth arrest- and starvation-associated repressor of the glucocorticoid receptor. Sci Signal. 2010; 3:ra8. doi: 10.1126/scisignal.2000568 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Li Y, Gu J, Lu H. The GAS5/miR-222 Axis Regulates Proliferation of Gastric Cancer Cells Through the PTEN/Akt/mTOR Pathway. Dig Dis Sci. 2017; 62:3426–3437. doi: 10.1007/s10620-017-4831-4 [DOI] [PubMed] [Google Scholar]
- 24.Sauvageau M, Goff LA, Lodato S, Bonev B, Groff AF, Gerhardinger C, et al. Multiple knockout mouse models reveal lincRNAs are required for life and brain development. eLife. 2013; 2:e01749. doi: 10.7554/eLife.01749 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lai KMV, Gong G, Atanasio A, Rojas J, Quispe J, Posca J, et al. Diverse Phenotypes and Specific Transcription Patterns in Twenty Mouse Lines with Ablated LincRNAs. PLoS One. 2015; 10:e0125522. doi: 10.1371/journal.pone.0125522 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Bridges MC, Daulagala AC, Kourtidis A. LNCcation: lncRNA localization and function. J Cell Biol. 2021; 220:e202009045. doi: 10.1083/jcb.202009045 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Yoneda R, Takahashi T, Matsui H, Takano N, Hasebe Y, Ogiwara K, et al. Three testis-specific paralogous serine proteases play different roles in murine spermatogenesis and are involved in germ cell survival during meiosis. Biol Reprod. 2013; 88:118. doi: 10.1095/biolreprod.112.106328 [DOI] [PubMed] [Google Scholar]
- 28.Yoneda R, Satoh Y, Yoshida I, Kawamura S, Kotani T, Kimura AP. A genomic region transcribed into a long noncoding RNA interacts with the Prss42/Tessp-2 promoter in spermatocytes during mouse spermatogenesis, and its flanking sequences can function as enhancers. Mol Reprod Dev. 2016; 83:541–557. 10.1002/mrd.22650 [DOI] [PubMed] [Google Scholar]
- 29.Satoh Y, Takei N, Kawamura S, Takahashi N, Kotani T, Kimura AP. A novel testis-specific long noncoding RNA, Tesra, activates the Prss42/Tessp-2 gene during mouse spermatogenesis. Biol Reprod. 2019; 100:833–848. 10.1093/biolre/ioy230 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Otsuka K, Matsubara S, Shiraishi A, Takei N, Satoh Y, Terao M, et al. A Testis-Specific Long Noncoding RNA, Start, Is a Regulator of Steroidogenesis in Mouse Leydig Cells. Front Endocrinol. 2021; 12:665874. 10.3389/fendo.2021.665874 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Sakatani S, Takahashi R, Okuda Y, Aizawa A, Otsuka A, Komatsu A, et al. Structure, expression, and conserved physical linkage of mouse testicular cell adhesion molecule-1 (TCAM-1) gene. Genome. 2000; 43:957–962. 10.1139/g00-071 [DOI] [PubMed] [Google Scholar]
- 32.Gautier A, Goupil AS, Le Gac F, Lareyre JJ. A promoter fragment of the sycp1 gene is sufficient to drive transgene expression in male and female meiotic germ cells in zebrafish. Biol Reprod. 2013; 89:89. 10.1095/biolreprod.113.107706 [DOI] [PubMed] [Google Scholar]
- 33.Ou CM, Lin SR, Lin HJ, Luo CW, Chen YH. Exclusive expression of a membrane-bound Spink3-interacting serine protease-like protein TESPL in mouse testis. J Cell Biochem. 2010; 110:620–629. doi: 10.1002/jcb.22571 [DOI] [PubMed] [Google Scholar]
- 34.Hofmann MC, Hess RA, Goldberg E, Millán JL. Immortalized germ cells undergo meiosis in vitro. Proc Natl Acad Sci USA. 1994; 91:5533–5537. doi: 10.1073/pnas.91.12.5533 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Wolkowicz MJ, Coonrod SA, Reddi PP, Millan JL, Hofmann MC, Herr JC. Refinement of the differentiated phenotype of the spermatogenic cell line GC-2spd(ts). Biol Reprod. 1996; 55:923–932. doi: 10.1095/biolreprod55.4.923 [DOI] [PubMed] [Google Scholar]
- 36.Rothschild G, Basu U. Lingering Questions about Enhancer RNA and Enhancer Transcription-Coupled Genomic Instability. Trends Genet. 2017; 33:143–154. doi: 10.1016/j.tig.2016.12.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Ntini E, Marsico A. Functional impacts of non-coding RNA processing on enhancer activity and target gene expression. J Mol Cell Biol. 2019; 11:868–879. doi: 10.1093/jmcb/mjz047 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Shirley CR, Hayashi S, Mounsey S, Yanagimachi R, Meistrich ML. Abnormalities and reduced reproductive potential of sperm from Tnp1- and Tnp2-null double mutant mice. Biol Reprod. 2004; 71:1220–1229. 10.1095/biolreprod.104.029363 [DOI] [PubMed] [Google Scholar]
- 39.Lasman L, Krupalnik V, Viukov S, Mor N, Aguilera-Castrejon A, Schneir D, et al. Context-dependent functional compensation between Ythdf m. Genes Dev. 2020; 34:1373–1391. 10.1101/gad.340695.120 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Gong C, Maquat LE. lncRNAs transactivate STAU1-mediated mRNA decay by duplexing with 3’ UTRs via Alu elements. Nature. 2011; 470:284–288. doi: 10.1038/nature09701 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Carrieri C, Cimatti L, Biagioli M, Beugnet A, Zucchelli S, Fedele S, et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 2012; 491:454–457. doi: 10.1038/nature11508 [DOI] [PubMed] [Google Scholar]
- 42.Wang J, Liu X, Wu H, Ni P, Gu Z, Qiao Y, et al. CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer. Nucleic Acids Res. 2010; 38:5366–5383. doi: 10.1093/nar/gkq285 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Beckedorff FC, Ayupe AC, Crocci-Souza R, Amaral MS, Nakaya HI, Soltys DT, et al. The intronic long noncoding RNA ANRASSF1 recruits PRC2 to the RASSF1A promoter, reducing the expression of RASSF1A and increasing cell proliferation. PLoS Genet. 2013; 9:e1003705. doi: 10.1371/journal.pgen.1003705 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Boque-Sastre R, Soler M, Oliveira-Mateos C, Portela A, Moutinho C, Sayols S, et al. Head-to-head antisense transcription and R-loop formation promotes transcriptional activation. Proc Natl Acad Sci USA. 2015; 112:5785–5790. doi: 10.1073/pnas.1421197112 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Grelet S, Link LA, Howley B, Obellianne C, Palanisamy V, Gangaraju VK, et al. A regulated PNUTS mRNA to lncRNA splice switch mediates EMT and tumour progression. Nat Cell Biol. 2017; 19:1105–1115. doi: 10.1038/ncb3595 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Gibbons HR, Shaginurova G, Kim LC, Chapman N, Spurlock 3rd CF, Aune TM. Divergent lncRNA GATA3-AS1 Regulates GATA3 Transcription in T-Helper 2 Cells. Front Immunol. 2018; 9:2512. doi: 10.3389/fimmu.2018.02512 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Kataruka S, Akhade VS, Kayyar B, Rao MRS. Mrhl Long Noncoding RNA Mediates Meiotic Commitment of Mouse Spermatogonial Cells by Regulating Sox8 Expression. Mol Cell Biol. 2017; 37:e00632–16. doi: 10.1128/MCB.00632-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Kurihara M, Otsuka K, Matsubara S, Shiraishi A, Satake H, Kimura AP. A Testis-Specific Long Non-Coding RNA, lncRNA-Tcam1, Regulates Immune-Related Genes in Mouse Male Germ Cells Front Endocrinol. 2017; 8:299. 10.3389/fendo.2017.00299 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Liang M, Wang H, He C, Zhang K, Hu K. LncRNA-Gm2044 is transcriptionally activated by A-MYB and regulates Sycp1 expression as a miR-335-3p sponge in mouse spermatocyte-derived GC-2spd(ts) cells. Differentiation. 2020; 114:49–57. doi: 10.1016/j.diff.2020.05.004 [DOI] [PubMed] [Google Scholar]
- 50.Hong SH, Han G, Lee SJ, Cocquet J, Cho C. Testicular germ cell–specific lncRNA, Teshl, is required for complete expression of Y chromosome genes and a normal offspring sex ratio. Sci Adv. 2021; 7:eabg5177. 10.1126/sciadv.abg5177 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Li C, Shen C, Shang X, Tang L, Xiong W, Ge H, et al. Two novel testis-specific long noncoding RNAs produced by 1700121C10Rik are dispensable for male fertility in mice. J Reprod Dev. 2020; 66:57–65. 10.1262/jrd.2019-104 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Yang H, Wang F, Li F, Ren C, Pang J, Wan Y, et al. Comprehensive analysis of long noncoding RNA and mRNA expression patterns in sheep testicular maturation. Biol Reprod. 2018; 99:650–661. doi: 10.1093/biolre/ioy088 [DOI] [PubMed] [Google Scholar]
- 53.Gao Y, Li S, Lai Z, Zhou Z, Wu F, Huang Y, et al. Analysis of Long Non-Coding RNA and mRNA Expression Profiling in Immature and Mature Bovine. Front Genet. 2019; 10:646. 10.3389/fgene.2019.00646 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.An SY, Liu ZF, MA ES, Deng MT, Gao XX, Liang YX, et al. LncRNA LOC102176306 plays important roles in goat testicular development. Reproduction. 2021; 161:523–537. doi: 10.1530/REP-20-0568 [DOI] [PubMed] [Google Scholar]
- 55.Zhou X, He J, Chen J, Cui Y, Ou Z, Zu X, et al. Silencing of MEG3 attenuated the role of lipopolysaccharides by modulating the miR-93-5p/PTEN pathway in Leydig cells. Reprod Biol Endocrinol. 2021; 19:33. doi: 10.1186/s12958-021-00712-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Chen Z, Ling L, Shi X, Li W, Zhai H, Kang Z, et al. Microinjection of antisense oligonucleotides into living mouse testis enables lncRNA function study. Cell Biosci. 2021; 11:213. doi: 10.1186/s13578-021-00717-y [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(A) Construction of “ΔProm”. (B) Construction of “λEco”. (C) Construction of “λApa”. (D) Construction of “TK-BAC-SH”. (E) Construction of “TK-BAC-SH”.
(PDF)
Total RNA was collected from each sample and used for RT-PCR. The Gapdh gene was used as a positive control. Reverse transcription was done with (+) or without reverse transcriptase (-). The cycle numbers of PCR were 35 for Start and 25 for Gapdh, respectively.
(PDF)
(XLSX)
(PDF)
Data Availability Statement
All relevant data are within the article and its Supporting Information files.





