Skip to main content
Revista da Sociedade Brasileira de Medicina Tropical logoLink to Revista da Sociedade Brasileira de Medicina Tropical
. 2022 Aug 22;55:e0427-2021. doi: 10.1590/0037-8682-0427-2021

Natural vertical cotransmission of Dengue virus and Chikungunya virus from Aedes aegypti in Brumado, Bahia, Brazil

Henry Paul Granger Neto 1, Cínthya Viana Souza Rocha 1, Thiago Macêdo Lopes Correia 1, Natalia Maria Pereira da Silva 1, Bárbara Aparecida Chaves 2,3, Nágila Francinete Costa Secundino 2,4, Paulo Filemon Paolucci Pimenta 2,3,4, Fabrício Freire de Melo 1
PMCID: PMC9413630  PMID: 36000618

ABSTRACT

Background:

Arthropod-borne viruses have recently emerged and are pathogens of various human diseases, including dengue, zika, and chikungunya viruses.

Methods:

We collectedAedes aegyptilarvae (N = 20) from Brumado, Bahia, Brazil, and treated and individually preserved the specimens. We analyzed the samples for dengue, zika, and chikungunya viruses using molecular biology methods.

Results:

We found that 25% (N = 5) and 15% (N = 3) were positive exclusively for dengue and chikungunya viruses, respectively; 15% (N = 3) were coinfected with both.

Conclusions:

This is the first report of dengue and chikungunya virus coinfection in A. aegypti larvae.

Keywords: Arboviruses, Coinfection, Infectious disease transmission, Vertical


In the past few decades, distinct arthropod-borne viruses (arboviruses) have emerged using arthropods as vectors and other animals as reservoirs. Some arboviruses are pathogens of various human diseases, including Dengue virus (DENV), Zika virus (ZIKV), and Chikungunya virus (CHIKV) 1 . Moreover, coinfection with these arboviruses in Aedes aegypti mosquitoes is possible 2 , including the ability to transmit more than one virus in a single bite 3 , highlighting their importance with regard to public health. Although horizontal transmission of arboviruses is well known, vertical transmission (VT) 4 - 6 of these three arboviruses from A. aegypti have been reported, which may play an essential role in maintaining viruses in mosquitoes during interepidemic periods 6 .

Considering the importance of monitoring these arboviruses and their vectors, we evaluated A. aegypti larvae to identify natural modes of VT, coinfections, and which viruses were present among the different regions of Brumado city, which act as a predictor of potential epidemics and may be used by the health department.

Brumado is a town in the State of Bahia in Northeastern Brazil and the climate is semiarid, with an average annual temperature of 23.5 oC and a rainy period from November to March 7 . According to the Brazilian Epidemiological Department, between November and December 40 dengue cases were reported; 28 were confirmed and 12 were discarded. Regarding zika, there were eight reported cases, six of which were confirmed and two were discarded. Regarding chikungunya, there were three reported and three discarded cases.

The city's Secretary of Health divides the area into three regions based on similar socioenvironmental and economic factors in accordance with the Brazilian Ministry of Health guideline. The larvae were individually and manually collected (stage L2 or L3) from these three regions in November and December 2019 by municipal health agents. After being washed three times in phosphate buffered saline, each larva where individually preserved in microtubes and sent to the Microbiology Laboratory of the Federal University of Bahia, Campus Anísio Teixeira. The larvae were identified using a dichotomous key 8 and stored in a freezer at -70 oC until processing.

No protected or privately owned land was accessed during larvae collection, and neither protected nor sensitive animals and plants were sampled. We obtained permits from the Brazilian Instituto Chico Mendes de Conservação da Biodiversidade and Ministry of Environment of Brazil (Registration number: 57,525) before collecting the mosquitoes.

RNA was extracted from macerated larvae using the commercial PureLink® Viral RNA/DNA Mini Kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's guidelines. Using the High-Capacity RNA-to-cDNA Kit (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA), we synthesized the complementary (c)DNA until 2 μg of total viral RNA was obtained according to the manufacturer's instructions. A quantitative polymerase chain reaction assay was performed using Power Up SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) and MicroAmp Optical 96-Well Reaction Plate (Applied Biosystems). Arbovirus-specific primer sets were designed for each arbovirus, as previously described (Table 1), and a standard curve was constructed using G-block amplification. The standard curve, samples, positive control (isolated cDNA from each arbovirus), and negative controls were allocated in duplicate to a 96-well plate. We adopted the following run parameters for all reactions: 40 cycles of fluorescence detection at 95 oC for 15 s and annealing at 60 oC for 1 min. Melting curves were generated for each run. All reactions were conducted in a StepOnePlus thermocycler (Applied Biosystems), and samples that showed specific amplification above the background threshold were considered positive. For positive samples, cycle threshold (Ct) values were compared with the respective standard curves to evaluate the number of viral cDNA replicates.

TABLE 1: Primer sets for each arbovirus.

Specificity Name Sequence (5' - 3') Reference
Dengue virus Forward AGGACYAGAGGTTAGAGGAGA 13
Reverse CGYTCTGTGCCTGGAWTGAT
Zika virus Forward CCGCTGCCCAACACAAG 14
Reverse CCACTAACGTTCTTTTGCAGACAT
Chikungunya virus Forward TCGACGCGCCCTCTTTAA 15
Reverse ATCGAATGCACCGCACACT

A total of 20 larvae (Figure 1A) were collected from the three administrative districts defined by the Health Department as follows: Region 1 (n = 10), Region 2 (n = 5), and Region 3 (n = 5). Of these, 55% (n = 11) tested positive for any of the three arboviruses, 25% (n = 5) were positive for DENV, and 15% (n = 3) were positive for CHIKV. In addition, 15% (n = 3) of the larvae were coinfected with DENV and CHIKV (Figure 1B). No samples were positive for ZIKV. Table 2 shows the Ct values and RNA copy numbers obtained from the positive samples.

FIGURE 1: Larvae locations and arbovirus detection. Map of Brumado city in the Northeast region of Brazil (A) The city was divided into three regional administrative health units according to geographical areas. The black dots show the distribution of collection sites. (B) City map shows the collection points with positive larvae.

FIGURE 1:

TABLE 2: Arboviruses detected in isolated larvae.

Larvae infection
Positive larvae Dengue virus cycle threshold Copies/μl Zika virus cycle threshold Copies/μl Chikungunya virus cycle threshold Copies/μl
1 28.340 1,530.303 ND ND ND ND
2 31.012 243.903 ND ND ND ND
4 25.327 12,137.704 ND ND ND ND
5 31.229 210.175 ND ND ND ND
6 18.267 1,553,222.355 ND ND 17.743 4,997,616.220
9 20.469 342,015.147 ND ND 17.957 4,263,238.005
10 ND ND ND ND 15.241 32,159,816.864
15 ND ND ND ND 18.262 3,398,893.001
16 33.466 45.178 ND ND 13.064 162,444,290.616
19 30.546 336.128 ND ND ND ND
20 ND ND ND ND 20.190 809,423.008

Our findings showed natural VT of these arboviruses in this vector during the rainy season in Brumado, which is consistent with previous studies on these larvae in Brazil 9 , 10 . Three coinfected samples were identified in Regions 1 and 3 with two distinct arboviruses, making this the first report of simultaneous coinfection of DENV and CHIKV in A. aegypti larvae.

Furthermore, in the coinfection cases, the number of viral copies of CHIKV was much higher than that of DENV. A study of mosquitoes in Mexico confirmed the coinfection capacity of DENV-2 (dengue virus serotype 2) and CHIKV and showed a similar disparity between the number of copies identified on the second and third day after exposure 11 . Between 5 and 15 days later, the presence of CHIKV stimulated DENV replication. Another study on A. aegypti mosquitoes in Mexico tested the possibility of coinfection among the three arboviruses. Exclusive DENV-2/CHIKV infection showed mild variation. Dissemination of DENV-2 was reduced 7 days after infection, and after only 14 days, a significant reduction (27%) in CHIKV transmission was observed 12 . A possible hypothesis based on nonstructural protein 1 has been proposed 2 , which is synthesized by the RNA of arboviruses from the genus Flavivirus, in our case DENV. This protein can reduce the immune response in mosquitoes, facilitating CHIKV replication during coinfection.

Therefore, this study is the first to report the simultaneous coinfection of DENV and CHIKV in A. aegypti larvae. This finding, which is supported by our previous study 10 in which we reported the coinfection of DENV and ZIKV in larvae from the same vector, demonstrates that the evaluation of larvae can be a crucial tool for controlling these arboviruses. Considering the high positivity rates observed in this study and detection of DENV and CHIKV, these diseases may have been underreported because the city only performs serological tests for dengue. Evaluating larvae is a quicker and more practical option than waiting for organisms, such as mosquitoes, to develop into adulthood. Recognizing which viruses are circulating among vector populations and their locations may help to predict epidemics by indicating probable emerging arboviruses, thereby directing public health actions.

ACKNOWLEDGMENTS

The Núcleo Regional de Saúde do Sudoeste (NRS Sudoeste) Secretaria da Saúde do Estado da Bahia (SESAB). The Secretary of Health of Brumado, Bahia, provided the field-agents to contribute to this study. The PPSUS program of the Bahia State Research Support Foundation (FAPESB).

Footnotes

Financial Support: This work was supported by the PPSUS program of the Bahia State Research Support Foundation (FAPESB) [grant number SUS0037/ 2018]; The funding source played no role in the study design; in the collection, analysis, and interpretation of data; in the writing of the report; and in the decision to submit the article for publication.

REFERENCES

  • 1.Huang YJS, Higgs S, Vanlandingham DL. Emergence and re-emergence of mosquito-borne arboviruses. Curr Opin Virol. 2019;34(1):104–109. doi: 10.1016/j.coviro.2019.01.001. [DOI] [PubMed] [Google Scholar]
  • 2.Rodrigues NB, Godoy RSM, Orfano AS, Chaves BA, Campolina TB, Costa B dos A, et al. Brazilian Aedes aegypti as a Competent Vector for Multiple Complex Arboviral Coinfections. J Infect Dis. 2021;224(1):101–108. doi: 10.1093/infdis/jiab0. [DOI] [PubMed] [Google Scholar]
  • 3.Göertz GP, Vogels CBF, Geertsema C, Koenraadt CJM, Pijlman GP. Mosquito co-infection with Zika and chikungunya virus allows simultaneous transmission without affecting vector competence of Aedes aegypti. PLoS Negl Trop Dis. 2017;11(6):1–22. doi: 10.1371/journal.pntd.0005654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Jain J, Kushwah RBS, Singh SS, Sharma A, Adak T, Singh OP, et al. Evidence for natural vertical transmission of chikungunya viruses in field populations of Aedes aegypti in Delhi and Haryana states in India-a preliminary report. Acta Trop. 2016;162(1):46–55. doi: 10.1016/j.actatropica.2016.06.004. [DOI] [PubMed] [Google Scholar]
  • 5.Chaves BA, Junior ABV, Silveira KRD, Paz ADC, Vaz EBDC, Araujo RGP, et al. Vertical Transmission of Zika Virus (Flaviviridae, Flavivirus) in Amazonian Aedes aegypti (Diptera: Culicidae) Delays Egg Hatching and Larval Development of Progeny. J Med Entomol. 2019;56(6):1739–1744. doi: 10.1093/jme/tjz110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Danis-Lozano R, Díaz-González EE, Malo-García IR, Rodríguez MH, Ramos-Castañeda J, Juárez-Palma L, et al. Vertical transmission of dengue virus in Aedes aegypti and its role in the epidemiological persistence of dengue in Central and Southern Mexico. Trop Med Int Heal. 2019;24(11):1311–1319. doi: 10.1111/tmi.13306. [DOI] [PubMed] [Google Scholar]
  • 7.Secretaria de Saúde do Estado da Bahia (Sesab), Superintendência de Vigilância e Proteção da Saúde do Estado da Bahia . Informe Epidemiológico das Arboviroses Urbanas, Semana Epidemiológica 49. Bahia: Sesab; 2020. 2 p [Google Scholar]
  • 8.Consoli RAGB, Oliveira RL. Principais mosquitos de importância sanitária do Brasil. 1th ed. Rio de Janeiro: Fiocruz; 1994. 228 p [Google Scholar]
  • 9.da Costa CF, da Silva AV, do Nascimento VA, de Souza VC, Monteiro DC da S, Terrazas WCM, et al. Evidence of vertical transmission of Zika virus in field-collected eggs of Aedes aegypti in the Brazilian Amazon. PLoS Negl Trop Dis. 2018;12(7):1–12. doi: 10.1371/journal.pntd.0006594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Teixeira AF, de Brito BB, Correia TML, Viana AIS, Carvalho JC, da Silva FAF, et al. Simultaneous circulation of Zika, Dengue, and Chikungunya viruses and their vertical co-transmission among Aedes aegypti. Acta Trop. 2021;215(5):1–6. doi: 10.1016/j.actatropica.2020.105819. [DOI] [PubMed] [Google Scholar]
  • 11.Le Coupanec A, Tchankouo-Nguetcheu S, Roux P, Khun H, Huerre M, Morales-Vargas R, et al. Co-infection of mosquitoes with chikungunya and dengue viruses reveals modulation of the replication of both viruses in midguts and salivary glands of Aedes aegypti mosquitoes. Int J Mol Sci. 2017;18(8):1–17. doi: 10.3390/ijms18081708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Rückert C, Weger-Lucarelli J, Garcia-Luna SM, Young MC, Byas AD, Murrieta RA, et al. Impact of simultaneous exposure to arboviruses on infection and transmission by Aedes aegypti mosquitoes. Nat Commun. 2017;8:1–9. doi: 10.1038/ncomms15412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Leparc-Goffart I, Baragatti M, Temmam S, Tuiskunen A, Moureau G, Charrel R, et al. Development and validation of real-time one-step reverse transcription-PCR for the detection and typing of dengue viruses. J Clin Virol. 2009;45(1):61–66. doi: 10.1016/j.jcv.2009.02.010. [DOI] [PubMed] [Google Scholar]
  • 14.Lanciotti RS, Kosoy OL, Laven JJ, Velez JO, Lambert AJ, Johnson AJ, et al. Genetic and serologic properties of Zika virus associated with an epidemic, Yap State, Micronesia, 2007. Emerg Infect Dis. 2008;14(8):1232–1239. doi: 10.3201/eid1408.080287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Edwards CJ, Welch SR, Chamberlain J, Hewson R, Tolley H, Cane PA, et al. Molecular diagnosis and analysis of Chikungunya virus. J Clin Virol. 2007;39(4):271–275. doi: 10.1016/j.jcv.2007.05.008. [DOI] [PubMed] [Google Scholar]

Articles from Revista da Sociedade Brasileira de Medicina Tropical are provided here courtesy of Brazilian Society of Tropical Medicine

RESOURCES