Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Aug 31.
Published in final edited form as: J Endocrinol. 2021 May;249(2):95–112. doi: 10.1530/JOE-20-0267

Regulation of Rhcg, an ammonia transporter, by aldosterone in the kidney

Koji Eguchi 1, Yuichiro Izumi 1, Yukiko Yasuoka 2, Terumasa Nakagawa 1, Makoto Ono 1, Kosuke Maruyama 1, Naomi Matsuo 1, Akiko Hiramatsu 1, Hideki Inoue 1, Yushi Nakayama 1, Hiroshi Nonoguchi 3, Hyun-Wook Lee 4, I David Weiner 4,5, Yutaka Kakizoe 1, Takashige Kuwabara 1, Masashi Mukoyama 1
PMCID: PMC9428946  NIHMSID: NIHMS1831111  PMID: 33705345

Abstract

Rhesus C glycoprotein (Rhcg), an ammonia transporter, is a key molecule in urinary acid excretion and is expressed mainly in the intercalated cells (ICs) of the renal collecting duct. In the present study we investigated the role of aldosterone in the regulation of Rhcg expression. In in vivo experiments using C57BL/6J mice, Western blot analysis showed that continuous subcutaneous administration of aldosterone increased the expression of Rhcg in membrane fraction of the kidney. Supplementation of potassium inhibited the effect of aldosterone on the Rhcg. Next, mice were subjected to adrenalectomy with or without administration of aldosterone, and then ad libitum 0.14 M NH4Cl containing water was given. NH4Cl load increased the expression of Rhcg in membrane fraction. Adrenalectomy decreased NH4Cl-induced Rhcg expression, which was restored by administration of aldosterone. Immunohistochemical studies revealed that NH4Cl load induced the localization of Rhcg at the apical membrane of ICs in the outer medullary collecting duct. Adrenalectomy decreased NH4Cl-induced membrane localization of Rhcg, which was restored by administration of aldosterone. For in vitro experiments, IN-IC cells, an immortalized cell line stably expressing Flag-tagged Rhcg (Rhcg-Flag), were used. Western blot analysis showed that aldosterone increased the expression of Rhcg-Flag in membrane fraction, while the increase in extracellular potassium level inhibited the effect of aldosterone. Both spironolactone and Gö6983, a PKC inhibitor, inhibited the expression of Rhcg-Flag in the membrane fraction. These results suggest that aldosterone regulates the membrane expression of Rhcg through the mineralocorticoid receptor and PKC pathways, which is modulated by extracellular potassium level.

Keywords: adrenal hormomes, ion channels, renal, physiology

Introduction

One of the important roles of the kidney is to excrete nonvolatile acids in the urine, thus maintaining acid-base homeostasis. In advanced stages of chronic kidney disease (CKD), metabolic acidosis occurs due to the decrease in the acid excretion ability of the kidney. Metabolic acidosis is an independent risk factor for the progression of CKD (Vallet et al. 2015, Raphael et al. 2017). It also causes osteoporosis and skeletal muscle atrophy in CKD patients (Kopple et al. 2005, Kraut & Madias 2011). An animal model of CKD complicated with metabolic acidosis exhibited insufficient urinary acid excretion due to decreased expression of key molecules of acid excretion, such as Rh C glycoprotein (Rhcg), an ammonia transporter, and anion exchanger 1 (AE1) in the collecting duct (CD) (Bürki et al. 2015), while a model of CKD without metabolic acidosis maintained urinary acid excretion ability, which was accompanied by increased expression of Rhcg (Weiner et al. 2014).

In the past decade, the mechanisms of urinary acid excretion have been unveiled. Nonvolatile acid is excreted into the urine mainly via ammonia as ammonium ions in the CD (Welbourne & Francoeur 1977, Weiner & Verlander 2017). Ammonia excretion in the CD is driven by Rh B glycoprotein (Rhbg) and Rhcg which are expressed mainly in the intercalated cells (ICs) (Biver et al. 2008, Lee et al. 2009, Bishop et al. 2010). Rhbg localizes at basolateral membrane of ICs while Rhcg localizes dominantly at apical and slightly at basolateral membranes. Both Rhbg and Rhcg contribute to ammonia uptake at basolateral membrane. On the apical membrane Rhcg cooperates with H+-ATPase to excrete H+ ions (Bourgeois et al. 2018). Urinary ammonium excretion is regulated by plasma potassium (K) levels: hypokalemia induces the expression of Rhcg, while hyperkalemia inhibits the expression of Rhcg (DuBose & Good 1991, 1992, Tizianello et al. 1991, Abu Hossain et al. 2011, Han et al. 2011).

In addition, aldosterone has been considered a key hormone in the regulation of urinary acid excretion. Patients with primary aldosteronism exhibit abnormal increase in plasma aldosterone level and hypokalemia, which is accompanied by metabolic alkalosis with excessed urinary acid excretion. In metabolic acidosis, plasma aldosterone level is increased (Perez et al. 1977, Gyorke et al. 1991). Adrenalectomy (ADX) decreases and administration of aldosterone increases urinary ammonium excretion (Welbourne & Francoeur 1977, Dubrovsky et al. 1981). Direct effects of aldosterone on the expression of H+-ATPase, AE1, and pendrin in ICs have been suggested (Mohebbi 2013, Winter et al. 2011, Xu et al. 2017, Hirohama et al. 2018). The involvement of aldosterone in the regulation of Rhcg is still obscure. Accordingly, we carried out the present study to clarify how aldosterone regulates the expression of Rhcg and investigated the underlying mechanisms in vivo and in vitro. The involvements of extracellular potassium level and acid loading in the regulation of Rhcg by aldosterone was further investigated.

Materials and methods

Animal studies

All experiments were evaluated and approved by the Committee for Animal Experimentation of Kumamoto University (C29-170). Ten-week-old male C57BL/6J mice (CLEA Japan, Inc. Tokyo, Japan) were maintained on standard chow and had access to drinking (tap) water ad libitum.

To examine the effect of aldosterone on the expression of Rhcg, mice were continuously administered aldosterone (10 μg/mouse/day) or vehicle using an osmotic minipump (model 2001; Alzet, Cupertino, CA, USA) for 3 days. Aldosterone was dissolved in DMSO and diluted with 0.9% saline. Final concentration of aldosterone and DMSO were 0.425 μg/μL and 10%, respectively. The minipump was subcutaneously implanted on the back under anesthesia. Aldosterone was continuously administered with 1.0 μL/h. On days 0, 2, and 3 after the administration of aldosterone, urine was collected in tubes containing mineral oil for 24 h in a metabolic cage. Experimental design is described in Supplementary Fig. 1 (see section on supplementary materials given at the end of this article). To examine the involvement of plasma K level in aldosterone-induced Rhcg expression, water or 1% KCl containing water was given mice ad libitum soon after administration of aldosterone was started. Three days after the administration, kidneys were harvested and the membrane expression of Rhcg was examined. Under anesthesia with 0.75 mg/kg medetomidine, 4.0 mg/kg midazolam, and 5.0 mg/kg butorphanol, arterial blood was taken from aorta and the kidneys were harvested from mice. Pieces of kidney tissue were immediately stored in 4% paraformaldehyde/0.1 M phosphate buffer or designated reagents for further experiments as described below.

To examine the role of aldosterone in the regulation of Rhcg expression under conditions of acid load, mice were subjected to bilateral adrenalectomy or sham operation and given free access to tap water containing 0.9% NaCl. Experimental procedure is described in Supplementary Fig. 2. After 1 week, mice were divided into the following four groups: (1) sham operation with vehicle (sham), (2) sham operation with vehicle under conditions of NH4Cl load (sham-NH4Cl), (3) ADX with replacement of dexamethasone under conditions of NH4Cl load (ADX-Dex-NH4Cl), and (4) ADX with replacement of dexamethasone and aldosterone under conditions of NH4Cl load (ADX-Dex-Aldo-NH4Cl). Mice were continuously administered vehicle, dexamethasone (0.25 μg/mouse/day) (Crowley et al. 2005), or aldosterone (5 μg/mouse/day) via an osmotic minipump. On the following day, mice were given free access to tap water containing 0.45% NaCl or tap water containing 0.45% NaCl and 0.14 M NH4Cl for 3 days. The concentrations of NaCl and NH4Cl were determined considering to keep the sodium replacement to adrenal insufficiency and acid loading, but not to induce the effect of hyperosmotic drinking. On days 0, 2, 3, and 4 after osmotic minipump implantation, urine was collected in tubes containing mineral oil for 24 h in a metabolic cage. The kidneys were removed from mice under anesthesia.

Electrolyte analysis

Arterial blood was taken from the abdominal aorta of mice at sacrifice under anesthesia. Blood pH, PCO2, PO2, and the HCO3− level were analyzed using an i-STAT1 analyzer with EG6+ cartridge (Abbott). Serum sodium (Na), K, chloride (Cl) levels, and plasma aldosterone concentration (PAC) and urinary Na, K, Cl, and creatinine (Cr) levels were measured at SRL Incorporated (Tokyo, Japan).

Urinary ammonium and titratable acid measurements

Urine pH was measured with a HORIBA F-21 pH meter and a 9618S-10D microelectrode (Horiba, Kyoto, Japan). The ammonium concentration in the urine was measured using an Ammonia Assay Kit (Sigma-Aldrich). Titratable acid was assessed by the addition of 0.1 N NaOH to the urine. The amount of 0.1 N NaOH required to titrate the urine to pH 7.4 was recorded. The values were expressed by the ratio of ammonium concentration or titratable acid concentration to the urinary creatinine concentration. Net acid excretion was calculated as the sum of the ammonium and titratable acid levels.

In situ hybridization

Kidney pieces were fixed by immersion in ice-cold 4% paraformaldehyde/0.1 M phosphate buffer overnight and embedded in paraffin for histological analysis. In situ hybridization (ISH) was performed as described previously (Kerstens et al. 1995, Yang et al. 1999). In brief, total RNA from mouse kidneys (Takara Bio Inc.) was reverse transcribed with an RNA PCR Kit (AMV) Ver. 3.0 (Takara Bio Inc.), and the cRNA probes for Rhcg and serum and glucocorticoid-regulated kinase 1 (Sgk1) were generated with T7 promoter region-tailed PCR primers. The hybridized sections were treated with 0.1% avidin, 0.01% biotin solution, 0.5 casein/TBS, a horseradish peroxidase (HRP)-conjugated sheep anti-DIG F(ab’) fragment antibody (Roche Diagnostics GmbH), biotinylated tyramide solution and HRP-conjugated streptavidin (Dako Cytomation, Glostrup, Denmark). Sections were stained using a DAB liquid system (Bio SB) and Mayer’s hematoxylin (Muto Pure Chemicals Co., Ltd., Tokyo, Japan).

Immunohistochemistry

Kidneys were fixed with 4% paraformaldehyde/0.1 M phosphate buffer overnight at 4°C. Immunofluorescence staining was performed to visualize antigen-antibody reactions. The primary antibodies against Rhcg, aquaporin-2 (AQP2), and ubiquitin were used at dilutions of 1:1000, 1:200, and 1:200, respectively. The detection of AQP2 protein was examined to distinguish ICs from PCs. The dilutions of antibodies were determined preliminarily by examining with various dilutions of antibodies. The secondary antibodies conjugated to Alexa Fluor 555 (red) and Alexa Fluor 488 (green) fluorophores (Thermo Fisher Scientific) were used at dilutions of 1:1000–1:2000. Images were acquired using a BZ-X710 microscope (KEYENCE, Osaka, Japan).

Protein preparation

Total tissue lysate was extracted from whole kidneys using T-PER Tissue Protein Extraction Reagent (Thermo Fisher Scientific). The membrane fraction of whole kidneys was isolated using homogenization and differential centrifugation using a modified protocol as previously described (Mouri et al. 2009). In brief, kidneys were homogenized in an ice-cold isolation solution containing protease inhibitors. The samples were initially centrifuged at 1000 g for 10 min at 4°C to remove incompletely homogenized fragments and nuclei. Next, the samples were centrifuged at 5000 g for 15 min at 4°C to remove mitochondria fragment. The supernatants were collected and centrifuged at 17,000 g for 20 min at 4°C. The supernatants were then collected and pelleted by centrifugation at 200,000 g for 1 h at 4°C. The pellets were resuspended in isolation solution. The protein concentration was measured using BCA protein assay reagents (Thermo Fisher Scientific). Proteins were denatured at 95°C for 5 min or 37°C for 30 min.

Cell line experiments

IN-IC cells that we established in a previous study were used for the present study (Izumi et al. 2011). The cells were derived from outer medulla of the kidney of a tsA58 transgenic rat that ubiquitously expresses the temperature-sensitive large T-antigen of Simian Virus 40. The cells express vasopressin V1a receptor and acid-base-related transporters but lack vasopressin V2 receptor, AQP2, β-ENaC and γ-ENaC (Izumi et al. 2011). In previous studies, nuclear accumulation of mineralocorticoid receptor (MR) in response to aldosterone and low pH-induced expressions of Rhcg mRNA and ubiquitin protein in the IN-IC cells have been demonstrated (Hori et al. 2012, Izumi et al. 2017). Cells were seeded in polystyrene cell culture dishes and fed their basal medium: DMEM/F12 medium supplemented with 10% fetal bovine serum (FBS), 10 μg/mL transferrin, 1 μg/mL insulin, 10 ng/mL EGF, 0.5 μg/mL hydrocortisone, and 6.5 ng/mL triiodothyronine. All cells used in the current experiments were at passages 25–36. To investigate the regulatory mechanism of Rhcg, Myc-DDK (Flag)-tagged mouse Rhcg (NM_019799) (Rhcg-Flag) was stably transfected into IN-IC cells. The pCMV mock vector and pCMV vector containing the open reading frame of Rhcg were obtained from OriGene (OriGene Technologies, Rockville, MD, USA). Transfection of IN-IC cells with the vectors was performed using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. Cells stably expressing Rhcg-Flag and cells stably transfected with the pCMV mock vector were selected by incubation with neomycin.

To examine the effect of aldosterone on the membrane expression of Rhcg-Flag, the cells expressing Rhcg-Flag protein were seeded in 10 cm dish with 2.0 × 106 cells and were grown to be confluent for 4 days. Cells were preincubated in an experimental solution for 48 h. The experimental solution consisted of DMEM/F12 medium containing 1% FBS, which was required for cell proliferation, and no hydrocortisone. Then cells were incubated for 16 h in the absence or presence of 10−8 to 10−6 M aldosterone. To examine if aldosterone exerts its effects through the MR, cells were treated with 10−6 M aldosterone and 10−5 M spironolactone, a MR antagonist (de Seigneux et al. 2008). To further investigate the mechanism by which aldosterone regulates Rhcg expression, the effect of Gö6983, a PKC inhibitor, on Rhcg expression was examined. Cells were preincubated 10−7 or 10−6 M Gö6983 (Abcam KK) for 1 h, and then treated with 10−6 M aldosterone. To investigate the effects of aldosterone in condition of hyperkalemia, cells were preincubated either in 4.1 mM K (regular DMEM/F12 medium) or 6.0 mM K (KCl added to the medium) for 2 h, and then cells were treated with 10−6 M aldosterone. After the treatment, the whole-cell lysate and the membrane fraction were extracted. To prepare whole-cell lysate, cells were harvested with RIPA buffer (Fuji Film, Tokyo, Japan). To prepare membrane fraction, cells were scraped and collected in PBS. Cell pellets were lysed in an ice-cold isolation solution and followed by the procedure described in Protein preparation section and a previous study (Mouri et al. 2009). The expression of Rhcg-Flag was examined by Western blotting.

To examine the effect of aldosterone on the stability of Rhcg protein, cycloheximide chase assay was performed. Cells stably expressing Rhcg-Flag were pretreated with 100 μg/mL, and then treated with 10−6 M aldosterone or vehicle in the presence of cycloheximide for 1, 2, 3, and 4 h. The protein expression of Rhcg-Flag in whole-cell lysate were examined by Western blotting. To determine whether the ubiquitin-proteasome system (UPS) is involved in the expression of Rhcg-Flag, cells were treated with 0, 5, 10, 25, or 50 μM MG132 (Cell Signaling Technology), a proteasome inhibitor, for 12 h, and the whole-cell lysate was extracted.

Immunoprecipitation

Immunoprecipitation was performed according to the manufacturer’s protocol to examine the association of Rhcg with the ubiquitin protein. IN-IC cells stably expressing Rhcg-Flag were treated with MG132 (10 μM), aldosterone (10−6 M), and vehicle for 12 h. Cells were lysed in RIPA buffer, and 200 μg of proteins were immunoprecipitated with an 1 μg of anti-Flag antibody and 50 mg Dynabeads using a Dynabeads Protein G Immunoprecipitation Kit (Thermo Fisher Scientific). Protein was eluted from the beads and was loaded on sdS-PAGE. Ubiquitinated Rhcg-Flag proteins were detected by Western blotting with anti-Flag and anti-ubiquitin antibodies.

Western blotting

Ten micrograms of the membrane fraction or 20 μg of total tissue lysate from the kidney was separated on a polyacrylamide gel (Bio-Rad) and transferred to a nitrocellulose membrane (GE Healthcare Life Sciences) by electrophoresis. Precision Plus Protein Standards Kaleidoscope (Bio-Rad) was used for molecular weight markers. The membrane was blocked with 5% skim milk for 1 h and incubated with primary antibody diluted in Can Get Signal Solution (Toyobo Life Science, Osaka, Japan) overnight, followed by peroxidase-conjugated secondary antibody for 1 h. Bands were visualized with an ECL Prime Reagents (GE Healthcare Life Sciences), which provides long signal duration and high sensitivity, using an Amersham Imager 600 (GE Healthcare Life Sciences). The Image J software was used for the quantitative analysis of protein expression (https://imagej.nih.gov/ij/). The expressions of Rhcg and Sgk1 were normalized to the expression of GAPDH, and then the values were presented relative to sham or vehicle.

Real-Time PCR

Total RNA was isolated from kidney tissues using an RNeasy Mini Kit (Qiagen). RT of 1 μg of total RNA was performed using Takara PrimeScript RT Master Mix (Takara Bio Inc.). mRNA expression was measured by real-time PCR using a TaqMan gene expression assays (Thermo Fisher Scientific). Primers for mouse Rhcg mRNA (Mm00451199_m1), rat Rhcg (Rn00788284_m1), and mouse and rat GAPDH (Mm99999915_g1) were from Thermo Fisher Scientific. Primers for rat Sgk1 (NM_019232) were designed (sense: CAACCTGGGTCCATCCTCAAA; anti-sense: GTTTTGGAAAGGTTCTTCTAGCAAG; probe: CCCACGCCAAACCCTCTGACTTCCAC) and purchased from Sigma-Aldrich Japan. Real-time PCR was performed in a LightCycler 480 system (Roche Life Science). EagleTaq Universal Master Mix (Roche Life Science) was used for amplification. Ct values from Rhcg or Sgk1 were normalized by the subtraction of the Ct values of Gapdh. The ΔCt was calculated by the subtraction of Ct for mice or cells with vehicle from that for mice or cells treated, and was then applied to the 2-ΔCt equation. Fold difference was determined relative to vehicle.

Antibodies

The antibody specific for Rhcg was provided by Dr I David Weiner (Verlander et al. 2003). The antibody specific for AQP2 was purchased from Santa Cruz Biotechnology. The antibodies specific for GAPDH, ubiquitin and Sgk1 were purchased from Cell Signaling Technology. The antibody specific for Flag was purchased from OriGene Technologies (Rockville, MD, USA). The information about antibodies used in the experiments is in Supplementary Table 1. Verification of antibody against Rhcg on Western blot is shown in Supplementary Fig. 3.

Statistical analysis

Statistical analysis was performed using one-way or two-way ANOVA and multiple comparisons (Bonferroni or Dunnett’s test) or using Student’s t-test in GraphPad Prism 6 (GraphPad Software Inc.). Values are expressed as the means ± s.e.m. P < 0.05 was considered significant.

Results

Aldosterone increases urinary ammonium excretion and the expression of Rhcg in mice

Administration of aldosterone increased urinary pH and ammonium excretion and decreased titratable acid excretion at day 2 and day 3 (Fig. 1A, B, C and Table 1). As a result, the net acid excretion in aldosterone-administered mice was not significantly different from that in vehicle-treated mice (Fig. 1D). Administration of aldosterone significantly increased serum Na levels and decreased serum K levels (Table 1).

Figure 1.

Figure 1

Open in a new tab

Effects of aldosterone on urinary acid excretion in mice and Rhcg expression in the kidney. Changes in urine parameters and Rhcg expression after administration of vehicle or aldosterone are shown. (A) Changes in urine pH. Aldosterone significantly increased urine pH. (B) Urinary ammonium excretion. Aldosterone significantly increased ammonium excretion. (C) Urinary titratable acid excretion. Aldosterone significantly decreased titratable acid excretion. (D) Net acid excretion. Aldosterone did not result in a significant change in net acid excretion. n = 3 for the vehicle-treated and aldosterone-administered mice in A, B, C, and D. The values are the means ± s.e.m. *P < 0.05 vs vehicle-treated mice. (E) Protein expression of Rhcg in the membrane fraction isolated from whole kidneys. Aldosterone significantly increased Rhcg expression. Representative Western blots are shown at the top. Quantitative analysis is shown at the bottom. The values for individual mice are shown together with a line and error bars representing the mean ± s.e.m. n = 6 for the vehicle-treated and aldosterone-administered mice. (F) Effect of potassium supplementation on aldosterone-induced expression of Rhcg in membrane fraction. Drinking of 1% KCl containing water inhibited aldosterone-induced Rhcg expression. Representative Western blots are shown. Representative Western blots are shown at the top. Quantitative analysis is shown at the bottom. The values for individual mice are shown together with a line and error bars representing the mean ± s.e.m. n = 3, 4, and 5 for the vehicle-treated, aldosterone-administered, and aldosterone-administered and KCl loaded mice. *P < 0.05. Veh, vehicle; Aldo, aldosterone.

Table 1.

Blood and urine parameters in mice 3 days after administration of aldosterone or vehicle. Means ± s.e.m. n = 3.
Vehicle (n =3) Aldosterone (n = 3)
Weight (g)
 Day 0 (Before administration)   20.9 ± 0.55   20.9 ± 0.71
 Day 3 (After administration)   22.1 ± 0.59   21.6 ± 0.91
Blood
 Na (mEq/L) 150.0 ± 1.2 153.3 ± 0.4*
 K (mEq/L)    5.03 ± 0.47    3.63 ± 0.29*
 Cl (mEq/L) 107.3 ± 2.3 111.3 ± 0.4  
Urine
 PH   6.26 ± 0.06  6.83 ± 0.071*
 Titratable acid (μEq/μg Cr)   0.19 ± 0.03    0.07 ± 0.01*
 Ammonium (μEq/μg Cr)   0.11 ± 0.01    0.19 ± 0.00*
 Net acid excretion (μEq/μg Cr)   0.30 ± 0.03  0.26 ± 0.01
Open in a new tab
*

P < 0.05 vs vehicle-treated mice.

Administration of aldosterone slightly but significantly increased the expression of Rhcg mRNA from 1.00 ± 0.08 to 1.26 ± 0.07 (mean ± s.e.m.) and Rhcg protein in whole kidney tissue from 1.00 ± 0.03 to 1.19 ± 0.04 (Supplementary Fig. 4A and B). Aldosterone administration also significantly increased the expression of Rhcg protein in the membrane fraction isolated from whole kidneys from 1.00 ± 0.03 to 1.37 ± 0.07 (Fig. 1E). Note that urine and blood exam and real-time PCR were performed with n of 3 mice. For Western blotting analysis, n of 6 mice were examined. All the data obtained were included for the statistical analysis. As shown in Fig. 1F, supplementation of potassium by drinking 1% KCl containing water restored the decrease in serum K level and inhibited Rhcg expression that were induced by aldosterone administration.

ISH was performed to examine the mRNA expression of Rhcg along the nephron. Administration of aldosterone did not result in detectable changes in Rhcg mRNA expression, while it increased Sgk1 mRNA expression in the cortical collecting duct (CCD) and OMCD (Fig. 2).

Figure 2.

Figure 2

Open in a new tab

Effects of aldosterone on the mRNA expression levels of Rhcg and Sgk1 in the mouse kidney. The mRNA expression levels of Rhcg and Sgk1 were evaluated by ISH. (A) Rhcg mRNA expression in vehicle-treated and aldosterone-administered mice. (A) Rhcg mRNA was detected in CCDs, OMCDs, and IMCDs. Rhcg mRNA expression was not markedly changed by aldosterone. (B) Sgk1 mRNA expression in vehicle-treated and aldosterone-administered mice. Sgk1 mRNA expression was increased by aldosterone in CCDs and OMCDs. No obvious change was seen in IMCDs. Kidney slices from four vehicle-treated and four aldosterone-treated mice were examined. Representative results are shown. OSOM, outer stripe outer medulla; ISOM, inner stripe outer medulla; IM, inner medulla; Aldo, aldosterone.

To further examine Rhcg protein expression in the kidney, immunofluorescence analysis was carried out with antibodies against Rhcg and AQP2. In the low-power micrographs, administration of aldosterone did not show detectable changes in the intensity of Rhcg expression in the cortex, outer medulla, or inner medulla (Supplementary Fig. 4C). The high-power micrographs showed that administration of aldosterone increased the localization of Rhcg at the apical and basolateral membranes of both principal cells (PCs) and ICs in the CCD (Fig. 3A). In the OMCD, Rhcg was dominantly expressed in ICs and slightly expressed in PCs. Rhcg was localized in the subcellular region and at the apical membrane of ICs and at the basolateral membrane of PCs in vehicle-treated mice. Administration of aldosterone increased the localization of Rhcg at the apical membrane of ICs (Fig. 3B). There was no obvious effect of aldosterone on the expression of Rhcg in the inner medullary collecting duct (IMCD) (data not shown). In contrast, the protein expression of AQP2 along the CD was decreased by aldosterone (Fig. 3A and B).

Figure 3.

Figure 3

Open in a new tab

Effects of aldosterone on the localization of the Rhcg protein in collecting duct cells. The localization of the Rhcg protein (red) was evaluated by immunohistochemistry. The AQP2 protein (green) was examined to distinguish ICs from PCs. (A) Rhcg protein in the CCD in a high-power micrograph. The Rhcg protein was expressed in both PCs and ICs in the CCD, in which aldosterone increased the localization of Rhcg at the apical and basolateral membranes (B) Rhcg protein in the OMCD. Rhcg was dominantly expressed in ICs (arrowheads) and slightly expressed in PCs. Rhcg was localized in the subcellular region and at the apical membrane of ICs and at the basolateral membrane of PCs in vehicle-treated mice. Administration of aldosterone increased the localization of Rhcg at the apical membrane of ICs. Enlarged pictures for ICs are shown on the bottom right of merged pictures. The results are representative of findings from three vehicle-treated and three aldosterone-administered mice.

Adrenalectomy decreases the urinary ammonium excretion in mice

Table 2 shows urine parameters one week after ADX, demonstrating that ADX decreased both urinary ammonium and net acid excretion at basal condition.

Table 2.

Urine parameters in mice one week after adrenalectomy or sham operation. Means ± s.e.m. n = 6.
Sham (n = 6)   ADX (n = 6)
Weight (g) (1 week after operation) 22.4 ± 0.54 22.4 ± 0.38
Urine
 PH 6.06 ± 0.03 6.00 ± 0.09
 Titratable acid (μEq/μgCr) 0.27 ± 0.01 0.26 ± 0.02
 Ammonium (μEq/μgCr) 0.16 ± 0.01 0.12 ± 0.01*
 Net acid excretion (μEq/μgCr) 0.42 ± 0.01 0.38 ± 0.02*
Open in a new tab
*

P < 0.05 vs sham-operated mice.

To examine the involvement of aldosterone in the urinary acid excretion ability, adrenalectomized mice were subjected to NH4Cl loading. NH4Cl loading decreased urine pH and increased urinary ammonium excretion in all NH4Cl-loaded groups (Fig. 4A and B). ADX partially but significantly inhibited NH4Cl-induced urinary ammonium excretion in ADX-Dex-NH4Cl mice after 2 days NH4Cl loading (Fig. 4B). Total ammonium excretion in 3 days was significantly lower in ADX-Dex-NH4Cl mice than in Sham-NH4Cl mice, although the decrease was partial (Fig. 4E). In turn, administration of aldosterone restored ammonium excretion in ADX-Dex-Aldo-NH4Cl mice (Fig. 4B and E). Titratable acid excretion tended to be increased in all NH4Cl-loaded groups (Fig. 4C). The total amount of titratable acid excretion for 3 days was significantly higher in all NH4Cl-loaded groups than in the sham group without NH4Cl loading (Fig. 4F). Because the deficit in ammonium excretion was compensated by the increase in titratable acid excretion, net acid excretion was decreased less than ammonium excretion in ADX-Dex-NH4Cl mice (Fig. 4D and G).

Figure 4.

Figure 4

Open in a new tab

Effects of NH4Cl loading and ADX on urinary acid excretion in mice. Urine pH and urinary ammonium excretion, titratable acid excretion, and net acid excretion were examined in sham-operated mice (sham), NH4Cl-loaded sham mice (sham-NH4Cl), NH4Cl-loaded adrenalectomized mice (ADX-Dex-NH4Cl), and NH4Cl-loaded adrenalectomized mice with aldosterone replacement (ADX-Dex-Aldo-NH4Cl). The changes over days were shown in A, B, C, and D. (A) Urine pH. Urine pH was significantly decreased by NH4Cl loading in sham-NH4Cl, ADX-NH4Cl, and ADX-Aldo-NH4Cl mice compared to sham mice. (B) Urinary ammonium excretion. NH4Cl loading significantly increased urinary ammonium excretion in sham-NH4Cl, ADX-Dex-NH4Cl, and ADX-Dex-Aldo-NH4Cl mice. ADX tended to inhibit ammonium excretion during NH4Cl loading in ADX-Dex-NH4Cl mice. Replacement of aldosterone restored ammonium excretion in ADX-Dex-Aldo-NH4Cl mice. (C) Titratable acid excretion. NH4Cl loading tended to increase titratable acid excretion in sham-NH4Cl, ADX-Dex-NH4Cl, and ADX-Dex-Aldo-NH4Cl mice compared to sham mice. (D) Net acid excretion. NH4Cl loading significantly increased urinary net acid excretion in sham-NH4Cl, ADX-Dex-NH4Cl, and ADX-Dex-Aldo-NH4Cl mice. No significant changes were observed among sham-NH4Cl, ADX-Dex-NH4Cl, and ADX-Dex-Aldo-NH4Cl mice. *P < 0.05 vs sham mice and †P < 0.05 vs ADX-Dex-NH4Cl in A, B, C, and D. Two-way ANOVA and multiple comparisons were applied. Total excretions of ammonium, titratable acid, and net acid for 3 days after NH4Cl loading were shown in E, F, and G. (E) Total ammonium excretion for 3 days after NH4Cl loading. NH4Cl loading significantly increased urinary ammonium excretion in sham-NH4Cl, ADX-Dex-NH4Cl, and ADX-Dex-Aldo-NH4Cl mice compared to sham. Ammonium excretion was significantly lower in ADX-Dex-NH4Cl mice than in sham-NH4Cl and ADX-Dex-Aldo-NH4Cl mice. (F) Total titratable acid excretion for 3 days after NH4Cl loading. NH4Cl loading significantly increased titratable acid excretion in sham-NH4Cl, ADX-Dex-NH4Cl, and ADX-Dex-Aldo-NH4Cl mice compared to sham. ADX-Dex-NH4Cl tended to increase titratable acid excretion mice although it is not significant. (G) Total net acid excretion for 3 days after NH4Cl loading. Because the deficit in ammonium excretion was compensated by the increase in titratable acid excretion, net acid excretion was not significantly decreased in ADX-Dex-NH4Cl mice compared to sham-NH4Cl mice. The values are the means ± s.e.m. *P < 0.05 in E, F, and G. n = 4 for sham mice. n = 4 for sham-NH4Cl mice. n = 4 for ADX-Dex-NH4Cl mice. n = 5 for ADX-Dex-Aldo-NH4Cl mice. The values for individual mice are shown together with a line and error bars representing the mean ± s.e.m. *P < 0.05.

Table 3 summarizes blood and urine parameters 3 days after NH4Cl loading. Plasma K level was higher in ADX mice than in sham with water or NH4Cl loading. Administration of aldosterone increased urinary ammonium excretion. Consistent with the excess increases in ammonium and net acid excretion on day 4 (Fig. 4B and D), hypokalemia and an increase in blood pH were observed in ADX-Dex-Aldo-NH4Cl mice. Note that urine samples that were obviously contaminated with feces or that were diluted with drinking water were excluded for the analysis. Some of blood samples were failed to obtain. Therefore, there are discordances of sample number between conditions.

Table 3.

Blood and urine parameters in mice subjected to sham operation, ADX, or ADX with aldosterone administration 3 days after water or NH4Cl loading. Means ± s.e.m. n = 4–9. Two-way ANOVA and multiple comparisons were applied.
Water
 NH4Cl Loading
Sham (n = 4) Sham (n = 7) ADX-Dex (n = 7) ADX-Dex-Aldo (n = 9)
Blood
 PH   7.27 ± 0.06    7.30 ± 0.03    7.30 ± 0.02   7.41 ± 0.01*†
 PCO2 (mmHg)   45.3 ± 1.6   44.3 ± 1.9   42.0 ± 4.2  43.7 ± 1.3
 PO2 (mmHg)   82.0 ± 3.1    98.3 ± 3.1*  98.8 ± 9.5*   99.5 ± 7.0*
 HCO3− (mmol/L)   23.8 ± 0.9   22.4 ± 2.8  20.4 ± 1.1*   25.1 ± 1.6†
 Na (mEq/L) 152.2 ± 1.3 153.0 ± 0.6† 150.4 ± 0.5 153.7 ± 1.2†
 K (mEq/L)    3.90 ± 0.35  3.91 ± 0.14†  4.50 ± 0.16*    3.32 ± 0.13†
 Cl (mEq/L) 112.0 ± 1.4 114.3 ± 0.9 113.3 ± 0.7 112.6 ± 1.7  
 BUN (mg/dL)   25.0 ± 1.6   25.6 ± 0.7†  37.8 ± 3.2*   28.1 ± 1.1†
 Cr (mg/dL)    0.08 ± 0.01   0.10 ± 0.01    0.10 ± 0.01   0.08 ± 0.01
 PAC (pg/mL) 360.3 ± 66.8 498.5 ± 91.3†   92.2 ± 33.9* 1823 ± 162*†
Urine  (n = 4)    (n = 4)    (n = 4)    (n = 5)
 Ph   6.15 ± 0.06    5.77 ± 0.01*   5.76 ± 0.04*   5.77 ± 0.05*
 Titratable acid (μEq/μgCr)   0.25 ± 0.01  0.35 ± 0.03    0.38 ± 0.01 0.38 ± 0.03
 Ammonium (μEq/μgCr)   0.09 ± 0.08    0.81 ± 0.08*   0.72 ± 0.12*    1.07 ± 0.06*†
 Net acid excretion (μEq/μgCr)   0.43 ± 0.01    1.16 ± 0.10*   1.09 ± 0.12*    1.45 ± 0.06*†
Open in a new tab
*

P < 0.05 vs Sham with water,

†

P < 0.05 vs ADX-Dex with NH4Cl loading.

PAC, plasma aldosterone concentration.

Aldosterone regulates the expression and membrane localization of the Rhcg protein under conditions of acid load

We performed Western blot analysis to examine the protein expression of Rhcg in the kidney. ADX decreased the protein expression of Rhcg in the membrane fraction from whole kidney tissue from 1.00 ± 0.04 to 0.79 ± 0.06 at basal condition (Fig. 5A), consistent with the decreases in urinary ammonium and net acid excretion (Table 2). NH4Cl loading significantly increased the protein expression of Rhcg in the membrane fraction from 1.00 ± 0.02 to 1.28 ± 0.01 (Fig. 5B) and in total tissue lysate from 1.00 ± 0.13 to 1.53 ± 0.05 (Fig. 5C) in sham-NH4Cl mice compared to sham mice. ADX inhibited NH4Cl-induced expression of Rhcg in the membrane fraction from 1.28 ± 0.01 to 1.10 ± 0.01 (Fig. 5B) and in the total tissue lysate from 1.53 ± 0.05 to 1.21 ± 0.04 (Fig. 5C), respectively in ADX-Dex-NH4Cl mice compared to sham-NH4Cl mice. Administration of aldosterone in ADX-Dex-Aldo-NH4Cl mice significantly restored the protein expression of Rhcg in the membrane fraction from 1.10 ± 0.01 to 1.30 ± 0.06 (Fig. 5B) but not in the total tissue lysate compared to ADX-Dex-NH4Cl mice (Fig. 5C). NH4Cl load markedly decreased the protein expression of Sgk1 in all NH4Cl-loaded groups (Fig. 5C). ADX decreased and administration of aldosterone increased Sgk1 protein expression; however, the effects were much weaker than the effect of NH4Cl loading.

Figure 5.

Figure 5

Open in a new tab

Effects of acid loading and ADX on the protein expression levels of Rhcg and Sgk1 in the kidney. Western blotting was performed with the membrane fraction or the total tissue lysate extracted from whole kidneys. (A) Rhcg protein expression in the membrane fraction from sham-operated (Sham) and adrenalectomized (ADX) mice under basal conditions. Samples were extracted from the mice 10 days after sham-operation or adrenalectomy. Rhcg protein expression was lower in ADX mice than in sham mice. Representative Western blots are shown at the top. Quantitative analysis is shown at the bottom. The values for individual mice are shown together with a line and error bars representing the mean ± s.e.m. n = 4 for each condition. *P < 0.05. (B) Rhcg protein expression in the membrane fraction from sham-operated mice (sham), NH4Cl-loaded sham mice (sham-NH4Cl), NH4Cl-loaded adrenalectomized mice (ADX-Dex-NH4Cl), and NH4Cl-loaded adrenalectomized mice with aldosterone replacement (ADX-Dex-Aldo-NH4Cl). NH4Cl loading significantly increased Rhcg expression in sham-NH4Cl mice. ADX inhibited the NH4Cl-induced increase in Rhcg expression in ADX-Dex-NH4Cl mice. Administration of aldosterone totally restored the ADX-induced decrease in Rhcg expression in ADX-Dex-Aldo-NH4Cl mice. Representative Western blot is shown at the top. Quantitative analysis is shown at the bottom. The values for individual mice are shown together with a line and error bars representing the mean ± s.e.m. n = 6 for each condition. *P < 0.05. Two-way ANOVA and multiple comparisons were applied. (C) Rhcg protein and Sgk1 protein expressions in the total tissue lysate. NH4Cl loading significantly increased Rhcg expression in sham-NH4Cl mice. ADX inhibited the NH4Cl-induced increase in Rhcg expression in ADX-Dex-NH4Cl mice. Replacement of aldosterone did not significantly restore Rhcg expression in ADX-Dex-Aldo-NH4Cl mice. Regarding Sgk1 protein expression, NH4Cl loading significantly decreased Sgk1 protein expression. ADX enhanced the NH4Cl-induced decrease in Sgk1 protein expression in ADX-Dex-NH4Cl mice. Administration of aldosterone restored Sgk1 protein expression in ADX-Dex-Aldo-NH4Cl mice to levels similar to those in sham-NH4Cl mice. Representative Western blots are shown at the top. Quantitative analysis for Rhcg expression is shown at the middle and for Sgk1 expression at the bottom. The values for individual mice are shown together with a line and error bars representing the mean ± s.e.m. n = 6 for each condition. *P < 0.05. Two-way ANOVA and multiple comparisons were applied.

To further explore the localization of the Rhcg protein, we performed an immunofluorescence study. In the cortex and inner medulla, NH4Cl loading, ADX, administration of aldosterone, or their combination caused no detectable changes in the Rhcg fluorescence intensity in the low-power micrograph (Supplementary Fig. 5). Supplementary Figure 6 shows a high-power micrograph indicating the localization of Rhcg in the CCD. NH4Cl loading did not show the change in the localization of Rhcg. ADX inhibited and administration of aldosterone restored the localization of Rhcg at basolateral membrane.

In the outer medulla, however, NH4Cl loading increased the Rhcg fluorescence intensity in sham-NH4Cl mice. ADX decreased the NH4Cl-induced fluorescence intensity in ADX-Dex-NH4Cl mice. Administration of aldosterone tended to restore the fluorescence intensity in ADX-Dex-Aldo-NH4Cl mice (Supplementary Fig. 5). Figure 6 shows a high-power micrograph indicating the expression and localization of Rhcg in the OMCD. NH4Cl loading induced Rhcg expression at the apical and basolateral membranes and subapical sites of ICs and at the basolateral membrane of PCs in sham-NH4Cl mice. ADX inhibited NH4Cl-induced membrane localization of Rhcg in both ICs and PCs in ADX-Dex-NH4Cl mice. In turn, Administration of aldosterone restored the localization of Rhcg expression at the apical membrane but not the basolateral membrane of ICs in ADX-Dex-Aldo-NH4Cl mice (Fig. 6). These results suggest that the expression of Rhcg is maintained at least in part by aldosterone under conditions of acid load. Because administration of aldosterone-induced hypokalemia with alkalemia (Table 3), serum K and blood pH could independently modulate Rhcg expression and its localization.

Figure 6.

Figure 6

Open in a new tab

Effects of NH4Cl loading and ADX on the localization of the Rhcg protein in the OMCD. Rhcg protein localization in OMCDs in a high-power micrograph. The localization of Rhcg (red) was evaluated by immunohistochemistry. AQP2 protein expression (green) was examined to distinguish ICs from PCs. The Rhcg protein was dominantly expressed in ICs (arrowheads). NH4Cl loading induced the localization of Rhcg at the apical membrane in sham-NH4Cl mice. ADX inhibited and aldosterone replacement restored the localization of Rhcg at the apical membrane, respectively, in ADX-Dex-NH4Cl and ADX-Dex-Aldo-NH4Cl mice. Enlarged pictures for ICs were shown on the bottom right of merged pictures.

Next, to investigate the involvement of aldosterone in the UPS, the expression of ubiquitin was examined by immunohistochemistry. In the OMCD, ubiquitin protein expression was as high in ICs as in PCs in sham-NH4Cl mice. ADX decreased ubiquitin expression more strongly in ICs than in PCs in ADX-Dex-NH4Cl mice. Replacement of aldosterone restored ubiquitin expression in both PCs and ICs in ADX-Dex-Aldo-NH4Cl mice (Fig. 7).

Figure 7.

Figure 7

Open in a new tab

Effects of acid loading and ADX on the protein expression of ubiquitin in the OMCD. The expression of ubiquitin (red) was evaluated by immunohistochemistry. AQP2 protein expression (green) was examined to distinguish ICs from PCs. In the OMCD, the ubiquitin protein was expressed in both PCs and ICs. ADX decreased ubiquitin protein expression predominantly in ICs in ADX-Dex-NH4Cl mice. Replacement of aldosterone restored ubiquitin protein expression in both PCs and ICs in ADX-Dex-Aldo-NH4Cl mice. Enlarged picture for ICs is shown on the bottom right of merged picture.

Aldosterone increases the protein expression of Rhcg-Flag in the membrane fraction through the MR and PKC pathways, which is modulated by extracellular K level

To further investigate the mechanisms by which aldosterone regulates Rhcg, we established IN-IC cells stably expressing mouse Rhcg-Flag protein. Western blot analysis showed specific bands at approximately 60 and 120 kDa in the whole-cell lysate extracted from cells transfected with a Rhcg-Flag construct (Fig. 8A). As shown in Supplementary Fig. 7A and B, the mRNA and protein expression levels of Sgk1 were increased in the cells in response to aldosterone. Spironolactone inhibited the aldosterone-induced increase in Sgk1 expression, showing an MR-mediated effect. Notably, aldosterone increased the protein expression of Rhcg-Flag in the membrane fraction in a dose-dependent manner (Fig. 8B), whereas spironolactone abolished the effect of aldosterone (Fig. 8C). In contrast, there were no significant effects of either aldosterone or spironolactone on the mRNA expression of Rhcg in IN-IC cells transfected with pCMV mock vector (Supplementary Fig. 7C). Furthermore, Gö6983 inhibited aldosterone-induced Rhcg-Flag expression in the membrane fraction (Fig. 8D). Increase in K level in the medium inhibited aldosterone induced the expression of Rhcg-Flag in membrane fraction (Fig. 8E). These results suggest that aldosterone could stimulate the membrane localization of Rhcg through the activation of the MR and PKC pathways in ICs, which is modulated by extracellular K level.

Figure 8.

Figure 8

Open in a new tab

Regulation of Rhcg-Flag protein expression in the membrane fraction by aldosterone through the MR and PKC pathways in IN-IC cells. IN-IC cells stably expressing the Rhcg-Flag protein were established. (A) Western blot of the Rhcg-Flag protein. The expression of the Rhcg-Flag protein in IN-IC cells was confirmed with an anti-Flag antibody. Specific bands were detected at approximately 60 and 120 kDa. Left lane: whole-cell lysate extracted from IN-IC cells, which were transfected with pCMV mock vector. Right lane: whole-cell lysate extracted from IN-IC cells, which were stably transfected with Rhcg-Flag construct. Right lane: molecular weight markers. (B) Rhcg-Flag protein expression in the membrane fraction from IN-IC cells transfected with Rhcg-Flag construct. Aldosterone increased Rhcg-Flag expression in a dose dependent manner. Representative Western blot is shown at the top. Quantitative analysis is shown at the bottom. The values for individual samples are shown together with a line and error bars representing the mean ± s.e.m. n = 3. *P < 0.05. (C) Aldosterone significantly increased Rhcg-Flag expression in the membrane fraction. Spironolactone inhibited the aldosterone-induced increase in Rhcg-Flag expression. The values for individual samples are shown together with a line and error bars representing the mean ± s.e.m. n = 3. *P < 0.05. (D) Rhcg-Flag expression in the membrane fraction under treatment with a PKC inhibitor. Gö6983 inhibited the aldosterone-induced increase in Rhcg-Flag expression in the membrane fraction. The values for individual samples are shown together with a line and error bars representing the mean ± s.e.m. n = 4. *P < 0.05. (E) Aldosterone did not increase Rhcg-Flag expression in membrane fraction in high level of K (6.0 mM) in contrast to the increase in normal level of K (4.1 mM) in the medium. The values for individual samples are shown together with a line and error bars representing the mean ± s.e.m. n = 3. *P < 0.05.

Involvement of protein stability modulated by aldosterone and the UPS in the regulation of Rhcg expression

Cycloheximide chase assay demonstrated that treatment with aldosterone delayed protein degradation of Rhcg-Flag compared to vehicle (Fig. 9A). Quantitative analysis of Rhcg-Flag expression from three independent experiments is shown in Fig. 9B. Western blot analysis revealed that treatment with MG132 (5–50 μM) significantly increased the protein expression of Rhcg-Flag in the whole-cell lysate in a dose-dependent manner (Fig. 9C). Quantitative analysis of Rhcg-Flag expression from three independent experiments is shown in Fig. 9D. To demonstrate the association of Rhcg with ubiquitin, immunoprecipitation study was performed. Supplementary Figure 7D shows a successful immunoprecipitation of Rhcg-Flag protein by anti-Flag antibody. Western blots with anti-Flag and anti-ubiquitin antibodies demonstrated coimmunoprecipitation of Rhcg-Flag with ubiquitin (Fig. 9E). As shown Western blot for Rhcg-Flag in left panel, high molecular weight smeared bands were appeared after the treatment with MG132. Western blot of ubiquitin is shown in the right panel. High molecular weight smeared bands were appeared by the treatment with MG132. These results suggest that the UPS is involved, at least partly, in the regulation of Rhcg protein expression in ICs. In the presence of aldosterone, Treatment with aldosterone tended to increase ubiquitinated Rhcg in the presence of MG132 (Fig. 9F). However, the effect was not significant in the quantitative analysis (Fig. 9G). Aldosterone did not show significant change in the expression of Rhcg-Flag in whole cell lysate regardless of MG132 (Supplementary Fig. 7E).

Figure 9.

Figure 9

Open in a new tab

Involvement of protein stability modulated by aldosterone and the ubiquitin-proteasome system in the regulation of Rhcg-Flag protein in IN-IC cells. (A) Effect of aldosterone on the protein stability of Rhcg. Treatment with aldosterone stabilized Rhcg-Flag protein. Ten micrograms of sample from whole-cell lysate was loaded in each lane. (B) Quantitative analysis of Rhcg-Flag expression for (A). Means ± s.e.m. n = 5. *P < 0.05 vs vehicle. (C) Rhcg-Flag protein expression under treatment with MG132, a proteasome inhibitor. A dose-dependent increase in the protein expression of Rhcg-Flag by MG132 was observed. A representative Western blot from three independent experiments is shown. (D) Quantitative analysis of Rhcg-Flag expression for (C). The intensities from the bands around at 60 and 120 kDa were combined for the quantitation. The values for individual samples are shown together with a line and error bars representing the mean ± s.e.m. n = 3. *P < 0.05. (E) Co-immunoprecipitation of the Rhcg-Flag protein with the ubiquitin protein. After treatment with MG132, Rhcg-Flag was immunoprecipitated with an anti-Flag antibody, followed by Western blotting for Rhcg-Flag and ubiquitin, respectively. Representative Western blots for Rhcg-Flag and ubiquitin among three independent experiments are shown. Western blot for Rhcg-Flag is shown in the left panel, high molecular weight smeared bands (designated with thick line) were enhanced after the treatment with MG132. Western blot for ubiquitin is shown in the right panel. High molecular weight smeared bands (designated with thick line) were enhanced by the treatment with MG132, suggesting that Rhcg-Flag was ubiquitinated although the ubiquitination was partial. (F) Effects of aldosterone on the ubiquitination of Rhcg-Flag in the presence or the absence of MG132. Representative Western blot from three independent experiments is shown. (G) Quantitative analysis of ubiquitination of Rhcg-Flag for (F). MG132 significantly increased ubiquitination of Rhcg-Flag. 10−6 M aldosterone tended to increase the ubiquitination Rhcg-Flag in the presence of MG132, although it was not significant. The values for individual samples are shown together with a line and error bars representing the mean ± s.e.m. n = 3. *P < 0.05.

Discussion

In the present study, we investigated the mechanisms by which aldosterone regulates urinary ammonium excretion, focusing on the expression and localization of Rhcg in ICs of CD. Administration of aldosterone increased and ADX decreased urinary ammonium excretion and Rhcg protein expression in CD cells. Under condition of NH4Cl load, ADX inhibited NH4Cl-induced membrane expression of Rhcg, which was restored by administration of aldosterone (Fig. 5B). We revealed direct effects of aldosterone on the membrane localization of the Rhcg protein through the MR and PKC pathways, which was modulated by extracellular potassium. In addition, stabilization of Rhcg protein by aldosterone and involvement of the UPS in Rhcg expression were demonstrated.

Administration of aldosterone significantly increased the mRNA expression of Rhcg in whole kidney tissue; however, the effect was small (Supplementary Fig. 4A). Indeed, ISH did not show detectable changes in the expression of Rhcg mRNA mediated by aldosterone (Fig. 2A), suggesting that the expression of Rhcg could mainly be regulated by the effects of aldosterone that do not alter Rhcg transcription. Regarding Rhcg protein expression, administration of aldosterone increased Rhcg expression both in the total tissue lysate and in the membrane fraction isolated from whole kidney tissue (Fig. 1E and Supplementary Fig. 4B). The results imply that aldosterone regulates the Rhcg expression through the membrane localization and protein stability.

The immunohistochemical study revealed that aldosterone induced the localization of Rhcg at the apical and basolateral membranes in both PCs and ICs of the CCD, while it stimulated the localization of Rhcg at the apical membrane in ICs of the OMCD. Han et al. reported that rats with hypokalemia induced by a potassium-free diet exhibited increased expression and membrane localization of Rhcg in both PCs and ICs of the OMCD, although the diet did not induce detectable changes in the CCD (Han et al. 2011). Taken together, our results imply hypokalemia-independent effects of aldosterone on the membrane localization of Rhcg in CCD cells. On the other hand, the present study suggested that the effects of aldosterone are modulated by plasma K+ level, which probably reflect the regulation of Rhcg expression in OMCD. Administration of high dose aldosterone-induced hypokalemia and significantly elevated plasma pH and bicarbonate levels even in condition of NH4Cl load, indicating metabolic alkalosis (Tables 2 and 3). Such condition evokes patients with primary aldosteronism. Clamped circulating plasma K+ in vivo and exposure to high extracellular K+ level in vitro inhibited the increase in membrane expression of Rhcg induced by aldosterone (Figs 1F and 8E). These results suggest that the effects of aldosterone on the regulation of Rhcg expression are associated with extracellular K+ level.

Acid loading enhances urinary acid excretion, while the plasma aldosterone level is increased in metabolic acidosis (Perez et al. 1977, Gyorke et al. 1991). However, the effect of aldosterone on urinary acid excretion in metabolic acidosis has not been properly addressed to date. In the present study, markedly increased ammonium excretion in sham-NH4Cl mice is not paralleled by elevation of plasma aldosterone or changes in K levels, when compared to sham mice receiving water (Table 3). ADX-Dex-NH4Cl mice were still able to maintain significantly elevated ammonium excretion after NH4Cl loading. These results suggest that urinary ammonium excretion is unlikely to be mediated solely by aldosterone-regulated-Rhcg under condition of NH4Cl load. The increase in ammonia production in proximal tubules by NH4Cl loading has been shown (Good & Burg 1984). Lee et al. demonstrated the increase in phosphenolpyrruvate carboxykinase (PEPCK) and Na+/H+ exchanger (NHE-3) expressions, which are involved in ammonia production and excretion in proximal tubules, in the collecting duct specific Rhbg/Rhcg knockout mice. Those increases were further enhanced by acid loading (Lee et al. 2014). We have confirmed the increase in apical membrane localization of NHE-3 in NH4Cl loaded mice (Data not shown).

On the other hands, NH4Cl loading increased the expression of Rhcg in both the total tissue lysate and membrane fraction isolated from whole kidney tissue, while ADX inhibited the increases (Fig. 5B and C). Immunohistochemical study showed that NH4Cl-induced membrane localization of Rhcg is aldosterone-dependent (Fig. 6). These results suggest that aldosterone regulates the expression and localization of the Rhcg protein under condition of NH4Cl load. Because NH4Cl loading largely decreased the expression of Sgk1 protein (Fig. 5C), the regulation of Rhcg expression by aldosterone could be Sgk1-independent.

Because partial increases in the expression and membrane localization of Rhcg were observed in ADX-Dex-NH4Cl mice (Figs 5C and 6), NH4Cl loading alone could induce the expression of Rhcg in an aldosterone-independent manner. Also, because adrenalectomy affects not only aldosterone production but also many hormonal and regulatory pathways, possible involvement of aldosterone-independent pathways in the regulation of Rhcg may be considered, which is one of the limitations the experiments. Small effect of dexamethasone supplementation as MR agonist may be considered.

In vitro experiments revealed the direct effects of aldosterone on the membrane localization of the Rhcg protein in IN-IC cells (Fig. 8). Consistent with the results of our in vivo experiments, treatment with aldosterone resulted in marginal increases in mRNA expression of Rhcg (Supplementary Fig. 7C), while it markedly increased the mRNA and protein expression levels of Sgk1 (Supplementary Fig. 7A and B). In addition, aldosterone significantly increased the protein expression of Rhcg-Flag in the membrane fraction, suggesting aldosterone-stimulated membrane trafficking of the Rhcg protein (Fig. 8B). We further showed that the effect of aldosterone on Rhcg localization was MR- and PKC-dependent (Fig. 8C and D). A previous paper reported that aldosterone-stimulated membrane accumulation of H+-ATPase in the OMCD was PKC-dependent (Winter et al. 2011). Interestingly, a recent report suggested that Rhcg coexists in the same complex as H+-ATPase (Bourgeois et al. 2018). There have been a number of studies reporting crosstalk among aldosterone, MR, and PKC in PCs of the CD (Thomas & Harvey 2011), but there are relatively few reports investigating aldosterone-regulated signaling pathways in ICs. We previously reported that aldosterone induced the nuclear accumulation of MR and increased the protein expression of PKC δ and ζ in IN-IC cells (Hori et al. 2012). PKC δ has been shown to exist in ICs but not in PCs (Kim et al. 2006). Although further studies are undoubtedly required, it is quite likely that the membrane trafficking of Rhcg could be regulated by aldosterone in association with H+-ATPase.

A previous paper reported that acid loading decreased the protein but not the mRNA expression of Rhcg in CKD model mice (Bürki et al. 2015). Our results revealed significant effects of aldosterone on the protein expression of Rhcg under conditions of NH4Cl load (Fig. 5B and C). These findings imply that the expression of Rhcg is regulated mainly by the posttranslational modification. In the present study we showed that treatment with aldosterone increased the stability of Rhcg protein (Fig. 9A and B). We demonstrated the ubiquitination of Rhcg (Fig. 9E). Those results imply that aldosterone could regulate the expression of Rhcg through the UPS. However, because treatment with aldosterone did not change the ubiquitination and expression of Rhcg in presence of proteasome inhibitor (Fig. 9F, G and Supplementary Fig. 7E), the effect of aldosterone on the Rhcg protein stability could be independent of UPS. We previously reported that severe acid loading (0.28 M NH4Cl) increased the protein expression of ubiquitin in ICs of the OMCD (Izumi et al. 2017). Metabolic acidosis is known to activate the UPS in skeletal muscle cells, which cause muscle wasting in patients with CKD (Bailey et al. 1996, Wang & Mitch 2014). Therefore, metabolic acidosis might induce the ubiquitination and degradation of Rhcg in the kidney, while aldosterone stabilizes the Rhcg protein, contributing its protein turnover in metabolic acidosis. Nedd4-2, a ubiquitin ligase involved in the UPS, is essential to the regulation of the epithelial sodium channel ENaC in PCs (Manning & Kumar 2018); the role of the UPS in ICs, however, has not yet been clarified. The mechanism of UPS-involved regulation for Rhcg in ICs seems to be different from that for the ENaC in PCs. In PCs, aldosterone inhibits Nedd4-2 and decrease the ubiquitination of ENaC, maintaining the membrane expression of ENaC. Nedd4-2 protein expression is much lower in α-ICs than in PCs (Loffing-Cueni et al. 2006). We confirmed previously by transcription start site sequencing (TSS-Seq) that the expression of Nedd4-2 was undetectable level in IN-IC cells (Izumi et al. 2017); therefore, it is conceivable that the regulation of Rhcg expression by aldosterone could be achieved in a Nedd4-2-independent manner. In the present study, ADX decreased the expression of ubiquitin under mild acid loading (0.14 M NH4Cl), in which the decrease was larger in ICs than in PCs of OMCD, implying the involvement of aldosterone in the ubiquitin expression under condition of acid load.

Recently, Shibata et al. proposed that IC-specific phosphorylation of MR contributes to the differential effects of aldosterone on PCs and ICs (Shibata et al. 2013). In hyperkalemia, increased aldosterone stimulates Na reabsorption and K excretion in PCs, but acid excretion in ICs is inhibited due to MR phosphorylation. In volume depletion, however, increased angiotensin II levels result in dephosphorylation of MR in ICs, thus stimulating acid excretion by aldosterone. Xu et al. investigated the combined effect of aldosterone and hypokalemia on the expression of pendrin in β-ICs (Xu et al. 2017). Further investigations about the IC-specific interactions of aldosterone, K, and metabolic acidosis in the regulation of Rhcg are needed.

In conclusion, we demonstrated that aldosterone regulates the expression of Rhcg, which is associated with extracellular K level. Aldosterone regulates the membrane expression Rhcg through the MR and PKC pathways and the its protein stability. The UPS could be involved in the regulation of Rhcg expression under metabolic acidosis, although further investigation is needed.

Supplementary Material

Supplemental matierals

Acknowledgements

The authors thank Ms N Nakagawa, Ms K Saito, Ms N Hirano and Ms H Shibuta for technical assistance and Ms M Horikiri for secretarial assistance.

Funding

This work was supported in part by research grants from the Japan Society for the Promotion of Sciences (JSPS) KAKENHI 16K19493 to Y I and 17K09702 to Y N, from National Institutes of Health (NIH) R01-DK107798 and R01-DK045788 to IDW, and by the Smoking Research Foundation to M M.

Footnotes

Supplementary materials

This is linked to the online version of the paper at https://doi.org/10.1530/JOE-20-0267.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

References

  1. Abu Hossain S, Chaudhry FA, Zahedi K, Siddiqui F & Amlal H 2011. Cellular and molecular basis of increased ammoniagenesis in potassium deprivation. American Journal of Physiology: Renal Physiology 301 F969–F978. ( 10.1152/ajprenal.00010.2011) [DOI] [PubMed] [Google Scholar]
  2. Bailey JL, Wang X, England BK, Price SR, Ding X & Mitch WE 1996. The acidosis of chronic renal failure activates muscle proteolysis in rats by augmenting transcription of genes encoding proteins of the ATP-dependent ubiquitin-proteasome pathway. Journal of Clinical Investigation 97 1447–1453. ( 10.1172/JCI118566) [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bishop JM, Verlander JW, Lee HW, Nelson RD, Weiner AJ, Handrogten ME & Weiner ID 2010. Role of the Rhesus glycoprotein, Rh B glycoprotein in renal ammonia excretion. American Journal of Physiology: Renal Physiology 299 F1065–F1077. ( 10.1152/ajprenal.00277.2010) [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Biver S, Belge H, Bourgeois S, Van Vooren P, Nowik M, Scohy S, Houillier P, Szpirer J, Szpirer C, Wagner CA, et al. 2008. A role for rhesus factor Rhcg in renal ammonium excretion and male fertility. Nature 456 339–343. ( 10.1038/nature07518) [DOI] [PubMed] [Google Scholar]
  5. Bourgeois S, Bounoure L, Mouro-Chanteloup I, Colin Y, Brown D & Wagner CA 2018. The ammonia transporter RhCG regulates urinary acidification by interacting with vacuolar H+-ATPases in renal intercalated cells. Kidney International 93 390–402. ( 10.1016/j.kint.2017.07.027) [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bürki R, Mohebbi N, Bettoni C, Wnag X, Serra AL & Wagner CA 2015. Impaired expression of key molecules of ammoniagenesis underlies renal acidosis in a rat model of chronic kidney disease. Nephrology, Dialysis, Transplantation 30 770–781. ( 10.1093/ndt/gfu384) [DOI] [PubMed] [Google Scholar]
  7. Crowley SD, Gurley SB, Oliverio MI, Pazmino AK, Griffiths R, Flannery PJ, Spurney RF, Kim HS, Smithies O, Le TH, et al. 2005. Distinct roles for the kidney and systemic tissues in blood pressure regulation by the renin-angiotensin system. Journal of Clinical Investigation 115 1092–1099. ( 10.1172/JCI23378) [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. de Seigneux S, Leroy V, Ghzili H, Rousselot M, Nielsen S, Rossier BC, Martin PY & Féraille E 2008. NF-kappaB inhibits sodium transport via down-regulation of SGK1 in renal collecting duct principal cells. Journal of Biological Chemistry 283 25671–25681. ( 10.1074/jbc.M803812200) [DOI] [PubMed] [Google Scholar]
  9. DuBose TD Jr & Good DW 1991. Effects of chronic hyperkalemia on renal production and proximal tubule transport of ammonium in rats. American Journal of Physiology 260 F680–F687. ( 10.1152/ajprenal.1991.260.5.F680) [DOI] [PubMed] [Google Scholar]
  10. DuBose TD Jr & Good DW 1992. Chronic hyperkalemia impairs ammonium transport and accumulation in the inner medulla of the rat. Journal of Clinical Investigation 90 1443–1449. ( 10.1172/JCI116011) [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dubrovsky AH, Nair RC, Byers MK & Levine DZ 1981. Renal net acid excretion in the adrenalectomized rat. Kidney International 19 516–528. ( 10.1038/ki.1981.49) [DOI] [PubMed] [Google Scholar]
  12. Good DW & Burg MB 1984. Ammonia production by individual segments of the rat nephron. Journal of Clinical Investigation 73 602–610. ( 10.1172/JCI111250) [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gyorke ZS, Sulkyo E & Guignard JP 1991. Ammonium chloride metabolic acidosis and the actively or renin-angiotensin-aldosterone system in children. European Journal of Pediatrics 150 547–549. ( 10.1007/BF02072203) [DOI] [PubMed] [Google Scholar]
  14. Han KH, Lee HW, Handlogten ME, Bishop JM, Levi M, Kim J, Verlander JW & Weiner ID 2011. Effect of hypokalemia on renal expression of the ammonia transporter family members, Rh B glycoprotein and Rh C glycoprotein, in the rat kidney. American Journal of Physiology: Renal Physiology 301 F823–F832. ( 10.1152/ajprenal.00266.2011) [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hirohama D, Ayuzawa N, Ueda K, Nishimoto M, Kawarazaki W, Watanabe A, Shimosawa T, Marumo T, Shibata S & Fujita T 2018. Aldosterone is essential for angiotensin II-induced upregulation of pendrin. Journal of the American Society of Nephrology 29 57–68. ( 10.1681/ASN.2017030243) [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hori K, Nagai T, Izumi Y, Kimura M, Hasuike Y, Nakayama Y, Nanami M, Tokuyama M, Otaki Y, Kuragano T, et al. 2012. Vasopressin V1a receptor is required for nucleocytoplasmic transport of mineralocorticoid receptor. American Journal of Physiology: Renal Physiology 303 F1080–F1088. ( 10.1152/ajprenal.00052.2012) [DOI] [PubMed] [Google Scholar]
  17. Izumi Y, Hori K, Nakayama Y, Kimura M, Hasuike Y, Nanami M, Kohda Y, Otaki Y, Kuragano T, Obinata M, et al. 2011. Aldosterone requires vasopressin V1a receptors on intercalated cells to mediate acid-base homeostasis. Journal of the American Society of Nephrology 22 673–680. ( 10.1681/ASN.2010050468) [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Izumi Y, Inoue H, Nakayama Y, Eguchi K, Yasuoka Y, Matsuo N, Nonoguchi H, Kakizoe Y, Kuwabara T & Mukoyama M 2017. TSS-Seq analysis of low pH-induced gene expression in intercalated cells in the renal collecting duct. PLoS ONE 12 e0184185. ( 10.1371/journal.pone.0184185) [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kerstens HM, Poddighe PJ & Hanselaar AG 1995. A novel in situ hybridization signal amplification method based on the deposition of biotinylated tyramine. Journal of Histochemistry and Cytochemistry 43 347–352. ( 10.1177/43.4.7897179) [DOI] [PubMed] [Google Scholar]
  20. Kim WY, Jung JH, Park EY, Yang CW, Kim H, Nielsen S, Madsen KM & Kim J 2006. Expression of protein kinase C isoenzymes alpha, beta, and delta in subtypes of intercalated cells of mouse kidney. American Journal of Physiology: Renal Physiology 291 F1052–F1060. ( 10.1152/ajprenal.00016.2006) [DOI] [PubMed] [Google Scholar]
  21. Kopple JD, Kalantar-Zadeh K & Mehrotra R 2005. Risks of chronic metabolic acidosis in patients with chronic kidney disease. Kidney International: Supplement 95 S21–S27. ( 10.1111/j.1523-1755.2005.09503.x) [DOI] [PubMed] [Google Scholar]
  22. Kraut JA & Madias NE 2011. Consequences and therapy of the metabolic acidosis of chronic kidney disease. Pediatric Nephrology 26 19–28. ( 10.1007/s00467-010-1564-4) [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lee HW, Verlander JW, Bishop JM, Igarashi P, Handlogten ME & Weiner ID 2009. Collecting duct-specific Rh C glycoprotein deletion alters basal and acidosis-stimulated renal ammonia excretion. American Journal of Physiology: Renal Physiology 296 F1364–F1375. ( 10.1152/ajprenal.90667.2008) [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lee HW, Verlander JW, Handlogten ME, Han KH & Weiner ID 2014. Effect of collecting duct-specific deletioon of both Rh B glycoprotein (Rhbg) and Rh C glycoprotein (Rhcg) on renal response to metabolic acidosis. American Journal of Physiology: Renal Physiology 306 F389–F400. ( 10.1152/ajprenal.00176.2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Loffing-Cueni D, Flores SY, Sauter D, Daidié D, Siegrist N, Meneton P, Staub O & Loffing J 2006. Dietary sodium intake regulates the ubiquitin-protein ligase nedd4-2 in the renal collecting system. Journal of the American Society of Nephrology 17 1264–1274. ( 10.1681/ASN.2005060659) [DOI] [PubMed] [Google Scholar]
  26. Manning JA & Kumar S 2018. Physiological functions of Nedd4-2: lessons from knockout mouse models. Trends in Biochemical Sciences 43 635–647. ( 10.1016/j.tibs.2018.06.004) [DOI] [PubMed] [Google Scholar]
  27. Mohebbi N, Perna A, van der Wijst J, Becker HM, Capasso G & Wagner CA 2013. Regulation of two renal chloride transporters, AE1 and pendrin, by electrolytes and aldosterone. PLoS ONE 8 e55286. ( 10.1371/journal.pone.0055286) [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mouri T, Inoue T, Nonoguchi H, Nakayama Y, Miyazaki H, Matsuzaki T, Saito H, Nakanishi T, Kohda Y & Tomita K 2009. Acute and chronic metabolic acidosis interferes with aquaporin-2 translocation in the rat kidney collecting ducts. Hypertension Research 32 358–363. ( 10.1038/hr.2009.19) [DOI] [PubMed] [Google Scholar]
  29. Perez GO, Oster JR, Vaamonde CA & Katz FH 1977. Effect of NH4Cl on plasma aldosterone, cortisol and renin activity in supine man. Journal of Clinical Endocrinology and Metabolism 45 762–767. ( 10.1210/jcem-45-4-762) [DOI] [PubMed] [Google Scholar]
  30. Raphael KL, Carroll DJ, Murray J, Greene T & Beddhu S 2017. Urine ammonium predicts clinical outcomes in hypertensive kidney disease. Journal of the American Society of Nephrology 28 2483–2490. ( 10.1681/ASN.2016101151) [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Shibata S, Rinehart J, Zhang J, Moeckel G, Castañeda-Bueno M, Stiegler AL, Boggon TJ, Gamba G & Lifton RP 2013. Mineralocorticoid receptor phosphorylation regulates ligand binding and renal response to volume depletion and hyperkalemia. Cell Metabolism 18 660–671. ( 10.1016/j.cmet.2013.10.005) [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Thomas W & Harvey BJ 2011. Mechanisms underlying rapid aldosterone effects in the kidney. Annual Review of Physiology 73 335–357. ( 10.1146/annurev-physiol-012110-142222) [DOI] [PubMed] [Google Scholar]
  33. Tizianello A, Garibotto G, Robaudo C, Saffioti S, Pontremoli R, Bruzzone M & Deferrari G 1991. Renal ammoniagenesis in humans with chronic potassium depletion. Kidney International 40 772–778. ( 10.1038/ki.1991.274) [DOI] [PubMed] [Google Scholar]
  34. Vallet M, Metzger M, Hayman JP, Flamant M, Gauci C, Thervet E, Boffa JJ, Vrtovsnik F, Froissart M, Stengel B, et al. 2015. Urinary ammonia and long-term outcomes in chronic kidney disease. Kidney International 88 137–145. ( 10.1038/ki.2015.52) [DOI] [PubMed] [Google Scholar]
  35. Verlander JW, Miller RT, Frank AE, Royaux IE, Kim YH & Weiner ID 2003. Localization of the ammonium transporter proteins RhBG and RhCG in mouse kidney. American Journal of Physiology: Renal Physiology 284 F323–F337. ( 10.1152/ajprenal.00050.2002) [DOI] [PubMed] [Google Scholar]
  36. Wang XH & Mitch WE 2014. Mechanisms of muscle wasting in chronic kidney disease. Nature Reviews: Nephrology 10 504–516. ( 10.1038/nrneph.2014.112) [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Weiner ID & Verlander JW 2017. Ammonia transporters and their role in acid-base balance. Physiological Reviews 97 465–494. ( 10.1152/physrev.00011.2016) [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Weiner ID, Leader JP, Bedford JJ, Verlander JW, Ellis G, Kalita P, Vos F, de Jong S & Walker RJ 2014. Effects of chronic lithium administration on renal acid excretion in humans and rats. Physiological Reports 2 e12242. ( 10.14814/phy2.12242) [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Welbourne TC & Francoeur D 1977. Influence of aldosterone on renal ammonia production. American Journal of Physiology 233 E56–E60. ( 10.1152/ajpendo.1977.233.1.E56) [DOI] [PubMed] [Google Scholar]
  40. Winter C, Kampik NB, Vedovelli L, Rothenberger F, Paunescu TG, Stehberger PA, Brown D, John H & Wagner CA 2011. Aldosterone stimulates vacuolar H(+)-ATPase activity in renal acid-secretory intercalated cells mainly via a protein kinase C-dependent pathway. American Journal of Physiology: Cell Physiology 301 C1251–C1261. ( 10.1152/ajpcell.00076.2011) [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Xu N, Hirohama D, Ishizawa K, Chang WX, Shimosawa T, Fujita T, Uchida S & Shibata S 2017. Hypokalemia and pendrin induction by aldosterone. Hypertension 69 855–862. ( 10.1161/HYPERTENSIONAHA.116.08519) [DOI] [PubMed] [Google Scholar]
  42. Yang H, Wanner IB, Roper SD & Chaudhari N 1999. An optimized method for in situ hybridization with signal amplification that allows the detection of rare mRNAs. Journal of Histochemistry and Cytochemistry 47 431–446. ( 10.1177/002215549904700402) [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental matierals
NIHMS1831111-supplement-Supplemental_matierals.pdf (874.9KB, pdf)

RESOURCES