Skip to main content
PMC home page
eLife logoLink to eLife
. 2022 Aug 12;11:e77825. doi: 10.7554/eLife.77825

Closely related type II-C Cas9 orthologs recognize diverse PAMs

Jingjing Wei 1, Linghui Hou 1, Jingtong Liu 1, Ziwen Wang 2, Siqi Gao 1, Tao Qi 1, Song Gao 2, Shuna Sun 3,✉, Yongming Wang 1,4,✉
Editors: Jeremy J Day5, Kevin Struhl6
PMCID: PMC9433092  PMID: 35959889

Abstract

The RNA-guided CRISPR/Cas9 system is a powerful tool for genome editing, but its targeting scope is limited by the protospacer-adjacent motif (PAM). To expand the target scope, it is crucial to develop a CRISPR toolbox capable of recognizing multiple PAMs. Here, using a GFP-activation assay, we tested the activities of 29 type II-C orthologs closely related to Nme1Cas9, 25 of which are active in human cells. These orthologs recognize diverse PAMs with variable length and nucleotide preference, including purine-rich, pyrimidine-rich, and mixed purine and pyrimidine PAMs. We characterized in depth the activity and specificity of Nsp2Cas9. We also generated a chimeric Cas9 nuclease that recognizes a simple N4C PAM, representing the most relaxed PAM preference for compact Cas9s to date. These Cas9 nucleases significantly enhance our ability to perform allele-specific genome editing.

Research organism: CRISPR/Cas9, Nme1Cas9 orthologs, PAM diversity, Nsp2Cas9

Introduction

RNA-guided CRISPR/Cas9 was originally identified as part of the microbial adaptive immune system, which contains three crucial components: a Cas9 endonuclease, a CRISPR RNA (crRNA), and a trans-activating CRISPR RNA (tracrRNA) (Koonin et al., 2017; Deltcheva et al., 2011). These three components constitute an active ribonucleoprotein complex to recognize and cleave foreign DNA (Gasiunas et al., 2012; Jinek et al., 2012). To recognize foreign DNA, the target sequence should contain (i) a complementary sequence with the crRNA and (ii) a protospacer-adjacent motif (PAM) immediately downstream of the target (Jinek et al., 2012). The PAM allows this system to differentiate between the DNA target in invading genetic material (non-self) and the same DNA sequence encoded within CRISPR arrays (self) (Mojica et al., 2009).

The competitive coevolution of CRISPR/Cas9 systems with different evolving viruses leads to acceptance of diverse PAMs across the Cas9 nucleases (Collias and Beisel, 2021; Gasiunas et al., 2020). For instance, SpCas9 recognizes an NGG PAM (Jiang et al., 2013; Qi et al., 2020; Wang et al., 2019; Xie et al., 2017); SaCas9 recognizes an NNGRRT PAM (R=A, G) (Ran et al., 2015); CjCas9 recognizes an N4RYAC (Y=C, T) PAM (Kim et al., 2017); St1Cas9 recognizes an NNRGAA PAM (Agudelo et al., 2020); BlatCas9 recognizes an N4CNAA PAM (Gao et al., 2020). A recent study screened a list of 79 Cas9 orthologs and identified multiple PAMs, including A-, C-, T-, and G-rich nucleotides, from single-nucleotide recognition to sequence strings longer than four nucleotides (Gasiunas et al., 2020).

Several studies have revealed that even phylogenetically closely related Cas9 orthologs may recognize distinct PAMs (Edraki et al., 2019; Hu et al., 2021). In this study, ‘closely related Cas9 orthologs’ means that these orthologs have >50% sequence identity and can recognize each other’s processed crRNA:tracrRNA duplexes as the guide RNA (gRNA). SpCas9 and SaCas9 are representative type II-A Cas9 nucleases (Edraki et al., 2019; Cong et al., 2013; Chatterjee et al., 2018). ScCas9 has 83.3% sequence identity with SpCas9 and recognizes an NNG PAM (Chatterjee et al., 2018). SmacCas9 has 58.4% sequence identity with SpCas9 and recognizes an NAA PAM (Chatterjee et al., 2020). We recently identified four Cas9 orthologs that are closely related to SaCas9 and recognized NNGG, NNGRR, and NNGGV PAMs (V=A, C, G), respectively (Hu et al., 2021; Hu et al., 2020). However, type II-C Cas9 nucleases account for nearly half of the total type II Cas9s (Shmakov et al., 2017), but their PAM diversity within closely related orthologs remains largely unknown.

The CRISPR/Cas9 system is a powerful tool for genome editing (Xie et al., 2017). By fusing catalytically disabled Cas9 protein to other enzymes, the CRISPR/Cas9 system has been used for base editing (Gaudelli et al., 2017; Komor et al., 2016), primer editing (Anzalone et al., 2019), and gene activation/repression (Konermann et al., 2015; Gilbert et al., 2013). These new applications need the Cas9-guide RNA (gRNA) complex to precisely target genomic sites. Engineered Cas9 variants with flexible PAMs can increase targeting scope. For example, SaCas9 was engineered to accept an NNNRRT PAM (Kleinstiver et al., 2015); SpCas9 was engineered to accept almost all PAMs (Walton et al., 2020), but this strategy is time-consuming, and often comes at a cost of the reduced on-target activity. Another strategy is to harness natural Cas9 nucleases for genome editing. We have developed several closely related Cas9 orthologs for genome editing (Ran et al., 2015; Wang et al., 2022). The advantage of developing tools from closely related Cas9 orthologs is that they can exchange the PAM-interacting (PI) domain. If an ortholog recognizes a particular PAM but does not work efficiently in human cells, we can use this ortholog PI to replace another ortholog PI to generate a chimeric Cas9.

Several type II-C Cas9s, including NmeCas9 (Hou et al., 2013), Nme2Cas9 (Edraki et al., 2019), CjCas9 (Kim et al., 2017), GeoCas9 (Harrington et al., 2017), BlatCas9 (Gao et al., 2020), and PpCas9 (Fedorova et al., 2020) have been developed for genome editing. Nme1Cas9 is a representative type II-C ortholog that was first developed for genome editing in 2013 (Hou et al., 2013; Mali et al., 2013). It is a compact and high-fidelity enzyme but recognizes a long PAM. To expand the targeting scope, Edraki et al. investigated two Nme1Cas9 orthologs (Nme2Cas9 and Nme3Cas9) and demonstrated that Nme2Cas9 recognized a simple N4CC PAM (Edraki et al., 2019). In this study, we investigated the editing capacity of 29 Nme1Cas9 orthologs, 25 of which were active in human cells. These orthologs recognized diverse PAMs with variable length and nucleotide preference. Importantly, based on these orthologs, we generated a chimeric Cas9 nuclease that recognized a simple N4C PAM for genome editing. These Cas9 nucleases significantly enhance our ability for precise targeting.

Results

Investigation of PAM diversity within Nme1Cas9 orthologs

To investigate the PAM diversity within Nme1Cas9 orthologs, we selected 29 Nme1Cas9 orthologs from the UniProt database (UniProt Consortium, T, 2018) using Nme1Cas9 as a reference (Figure 1—figure supplement 1 and Table 1). The amino-acid identities of Nme1Cas9 varied from 59.6% to 70.4%. A previous structural study had shown that residues Q981, H1024, T1027, and N1029 in the Nme1Cas9 PI domain are crucial for PAM recognition (Sun et al., 2019). Amino acid sequence alignment revealed that 28 selected orthologs differed in at least one residue corresponding to the four residues of Nme1Cas9 (Figure 1—figure supplement 2A-C), indicating that these orthologs may recognize distinct PAMs. BdeCas9 had the same four residues as Nme1Cas9. Nme1Cas9 H1024 forms hydrogen bonds with the fifth nucleotide of the N4GATT PAM (Sun et al., 2019). According to the amino acids corresponding to the Nme1Cas9 H1024, the orthologs selected here could be divided into three groups, which contained aspartate (D), histidine (H), and asparagine (N) residues, respectively (Figure 1—figure supplement 2A-C).

Table 1. Nme1Cas9 orthologs selected from the UniProt database.

UniProt ID Host strain Name Length (aa) Identity toNme1Cas9 (%)
A0A011P7F8 Mannheimia granulomatis MgrCas9 1,049 65.5
A0A0A2YBT2 Gallibacterium anatis IPDH697-78 GanCas9 1,035 59.7
A0A0J0YQ19 Neisseria arctica NarCas9 1,070 70.4
A0A1T0B6J6 [Haemophilus felis] HfeCas9 1,058 65.3
A0A1X3DFB7 Neisseria dentiae NdeCas9 1,074 66.4
A0A263HCH5 Actinobacillus seminis AseCas9 1,059 66
A0A2M8S290 Conservatibacter flavescens CflCas9 1,063 64.2
A0A2U0SK41 Pasteurella langaaensis DSM 22999 PlaCas9 1,056 63.9
A0A356E7S3 Pasteurellaceae bacterium PstCas9 1,076 63
A0A369Z1C7 Haemophilus parainfluenzae Hpa1Cas9 1,056 64.8
A0A369Z3K3 Haemophilus parainfluenzae Hpa2Cas9 1,054 65.2
A0A377J007 Haemophilus pittmaniae HpiCas9 1,053 65.2
A0A378UFN0 Bergeriella denitrificans (Neisseria denitrificans) BdeCas9 1,069 68.8
A0A379B6M0 Pasteurella mairii PmaCas9 1,061 63.1
A0A379CB86 Phocoenobacter uteri PutCas9 1,059 63
A0A380MYP0 Suttonella indologenes SinCas9 1,071 67.8
A0A3N3EE71 Neisseria animalis Nan1Cas9 1,074 66.6
A0A3S4XT82 Neisseria animaloris Nan2Cas9 1,078 65.4
A0A420XER8 Otariodibacter oris OorCas9 1,058 64.4
A0A448K7T0 Pasteurella aerogenes PaeCas9 1,056 68.2
A0A4S2QB06 Rodentibacter pneumotropicus RpnCas9 1,055 63.7
A0A4Y9GBC9 Neisseria sp. WF04 Nsp2Cas9 1,067 59.6
A6VLA7 Actinobacillus succinogenes (strain ATCC 55618/DSM 22257/130Z) AsuCas9 1,062 64.6
C5S1N0 Actinobacillus minor NM305 AmiCas9 1,056 67.7
E0F2V7 Actinobacillus pleuropneumoniae serovar 10 str. D13039 ApsCas9 1,054 65.4
F2B8K0 Neisseria bacilliformis ATCC BAA-1200 NbaCas9 1,077 66.5
J4KDT3 Haemophilus sputorum HspCas9 1,052 65.2
V9H606 Simonsiella muelleri ATCC 29453 SmuCas9 1,063 62.2
W0Q6X6 Mannheimia sp. USDA-ARS-USMARC-1261 MspCas9 1,047 65.7
Open in a new tab

Next, we investigated the conservation of the CRISPR direct repeat sequences and tracrRNA sequences among Nme1Cas9 orthologs. Both direct repeats and putative tracrRNAs were identified for 26 Cas9 orthologs. Sequence alignment revealed that direct repeats and the 5′ end of tracrRNAs were conserved among Nme1Cas9 orthologs (Figure 1—figure supplement 3A-B). We generated single guide RNA (sgRNA) scaffolds for these orthologs by fusing the 3′ end of a truncated direct repeat with the 5′ end of the corresponding tracrRNA, including the full-length tail, via a 4-nt linker. The RNAfold web server predicted that these sgRNAs contained a conserved stem loop at each end, similar to the Nme1Cas9 sgRNA (Figure 1—figure supplement 4). Twenty orthologs contained one stem loop in the middle, while six orthologs contained two stem loops in the middle.

Next, the human-codon-optimized Nme1Cas9 orthologs were synthesized and cloned into the Nme2Cas9_AAV plasmid backbone (Edraki et al., 2019). The expression of each Cas9 protein was confirmed by Western blot (Figure 1—figure supplement 5). We used a previously developed PAM-screening assay (Hu et al., 2020) to determine their PAMs. This is a GFP-activation assay where a 24-nt protospacer followed by an 8 bp random sequence is inserted between the ATG start codon and GFP-coding sequence, resulting in a frameshift mutation. The library was stably integrated into the human genome (HEK293T cells) using a lentivirus. If a Cas9 ortholog enables editing the protospacer, it will generate insertions/deletions (indels) at the protospacer and induce GFP expression in a portion of cells (Figure 1A–B). The Nme1Cas9 sgRNA scaffold was used for all Cas9 orthologs in this study. Each Cas9 expression plasmid was co-transfected with an sgRNA plasmid into the cell library. The cells without transfection were included as a negative control, and Nme2Cas9 was included as a positive control. Five days after transfection, GFP-positive cells were observed for 25 orthologs through fluorescence microscope. The percentage of GFP-positive cells varied from ~0.01% to 0.18%, as revealed by flow cytometry analysis (Figure 1C).

Figure 1. Screening of Nme1Cas9 orthologs activities through a GFP- activation assay.

(A) Schematic of the GFP-activation assay. A protospacer flanked by an 8 bp random sequence is inserted between the ATG start codon and GFP-coding sequence, resulting in a frameshift mutation. The library DNA is stably integrated into HEK293T cells via lentivirus infection. Genome editing can lead to in-frame mutation. The protospacer sequence is shown below. (B) The procedure of the GFP-activation assay. Cas9 and sgRNA expression plasmids were co-transfected into the reporter cells. GFP-positive cells could be observed if the protospacer is edited. (C) Twenty-five out of 29 Nme1Cas9 orthologs could induce GFP expression. The percentage of GFP-positive cells is shown. Reporter cells without Cas9 transfection are used as a negative control. Scale bar: 250 μm.

Figure 1—source data 1. The maps of all plasmids used in the study for Figure 1.

Figure 1.

Figure 1—figure supplement 1. Phylogenetic tree of the selected Nme1Cas9 orthologs.

Figure 1—figure supplement 1.

The amino acid sequences of 29 selected Nme1Cas9 orthologs were aligned by Vector NTI. Nme1Cas9, Nme2Cas9, and Nme3Cas9 were used as reference and shown in green.
Figure 1—figure supplement 2. Alignment of the PI domain of Nme1Cas9 orthologs.

Figure 1—figure supplement 2.

The Nme1Cas9 orthologs contained aspartate (A), histidine (B), or asparagine (C) residues corresponding to the Nme1Cas9 H1024. The PI domains were aligned by Vector NTI. Amino acids crucial for PAM recognition are shown above. Nme1Cas9, Nme2Cas9, and Nme3Cas9 were used as reference and shown in green.
Figure 1—figure supplement 3. The alignment of direct repeats and tracrRNAs of Nme1Cas9 orthologs.

Figure 1—figure supplement 3.

(A) Alignment of direct repeat sequences for Nme1Cas9 orthologs is shown. (B) Alignment of tracrRNAs for Nme1Cas9 orthologs. Sequence alignment revealed that direct repeats and the 5’ end of tracrRNAs were conserved among Nme1Cas9 orthologs. Strict identical residues are highlighted with the red background and conserved mutations are highlighted with an outline and red font.
Figure 1—figure supplement 4. Single-guide RNA (sgRNA) scaffolds of Nme1Cas9 orthologs.

Figure 1—figure supplement 4.

In silico co-folding of the crRNA direct repeat and putative tracrRNA shows stable secondary structure and complementarity between the two RNAs.
Figure 1—figure supplement 5. Protein expression levels of Nme2Cas9 orthologs were analyzed by western blot.

Figure 1—figure supplement 5.

HEK293T cells without Cas9 transfection were used as a negative control (NC).
Figure 1—figure supplement 5—source data 1. Source data for Figure 1—figure supplement 5.
Open in a new tab

Next, we analyzed the PAM for each active ortholog. The GFP-positive cells were sorted by flow cytometry, and the protospacer and the 8 bp random sequence were PCR-amplified for deep sequencing. The sequencing results revealed that indels were generated at the target site (Figure 2A). We generated the WebLogo diagram for each ortholog based on deep sequencing data. Typically, Nme1Cas9 orthologs displayed minimal or no base preference at PAM positions 1–4. For the orthologs that potentially require PAMs longer than 8 bp, we shifted the target sequence by three nucleotides in the 5′ direction to allow PAM identification to be extended from 8 to 11 bp.

Figure 2. PAM analysis for each Cas9 nuclease.

(A) Example of indel sequences measured by deep sequencing for Nsp2Cas9. The GFP coding sequences are shown in green; an 8 bp random sequence is shown in orange; black dashes indicate deleted bases; red bases indicate insertion mutations. (B) The PAM WebLogos for Nme1Cas9 orthologs containing an aspartate residue corresponding to the Nme1Cas9 H1024. PAM positions for each WebLogo are shown below. The PAM WebLogos for Nme2Cas9, Nsp2Cas9, PutCas9, SmuCas9, NarCas9, PstCas9 are generated from the first round of PAM screening and the PAM WebLogos for others are generated from the second round of PAM screening. PAM positions in the screening assay are shown on the bottom right. (C) The PAM WebLogos for Nme1Cas9 orthologs containing histidine, or asparagine residues corresponding to the Nme1Cas9 H1024. PAM positions for each WebLogo are shown below. The PAM WebLogo for Nan2Cas9 is generated from the first round of PAM screening and the PAM WebLogos for others are generated from the second round of PAM screening.

Figure 2—source data 1. The number of unique PAM sequences and the median coverage of every individual PAM variant for the Figure 2B and C.

Figure 2.

Figure 2—figure supplement 1. PAM wheels for Nme1Cas9 orthologs.

Figure 2—figure supplement 1.

(A) PAM wheels for Nme1Cas9 orthologs containing an aspartate residue corresponding to the Nme1Cas9 H1024. PAM positions in the screening assay are shown on the bottom right. (B) PAM wheels for Nme1Cas9 orthologs containing histidine, or asparagine residues corresponding to the Nme1Cas9 H1024. PAM wheels start in the middle of the wheel for the first 5’ base exhibiting sequence information.
Figure 2—figure supplement 2. The specificity between amino acids and bases in calculated structural models.

Figure 2—figure supplement 2.

(A) Calculated structural model of Bdecas9. The amino acid near the 5 position of the NTS is histidine. Histidine’s side chain forms a potential hydrogen bond with the 6-hydroxyl group of guanine, if the guanine is other bases, this hydrogen bond would be not formed because of the too close distance (cytosine or thymine) or the lack of a hydroxyl group (adenine). (B) Calculated structural model of Asucas9. The amino acid near the 5 position of NTS is aspartic, and it forms a potential hydrogen bond with the 4-amine group of the cytosine. if the cytosine is replaced by other bases, this hydrogen bond would be abolished because of increased distance (adenine or guanine) or the lack of an amine group (thymine). (C) Calculated structural model of Bdecas9. The amino acid near the 8 position of TS is glutamine, and it forms a potential hydrogen bond with the 6-amine group of the adenine on the TS. If the cytosine is replaced by other bases, this hydrogen bond would be not formed because of too close distance (cytosine or thymine) or the lack of an amine group (guanine). TS: target strand, NTS: non-target strand.
Open in a new tab

Interestingly, Nme1Cas9 orthologs recognized diverse PAMs (Figure 2B–C and Figure 2—figure supplement 1). Generally, they displayed strong nucleotide preferences for up to four base pairs. When orthologs contained an aspartate (D) residue corresponding to the Nme1Cas9 H1024, they displayed a strong C preference at PAM position 5 (Figure 2B); when orthologs contained histidine (H), or asparagine (N) residues corresponding to the Nme1Cas9 H1024, they displayed a strong R (R=A or G) preference at PAM position 5 (Figure 2C). The length of PAM recognition varied between 5 and 11 base pairs. Nme2Cas9 recognized an N4CC PAM, consistent with a previous report (Edraki et al., 2019). BdeCas9 recognized an N4GATT PAM that was the same as Nme1Cas9 (Hou et al., 2013). In addition, many orthologs displayed degenerate PAM recognition (e.g. HpiCas9, MgrCas9, and NbaCas9).

We have generated calculated structural models of these orthologs in complex with sgRNA and DNA using the crystal structure of Nme1Cas9 (PDB ID: 6JDV). Some specificity shifts can be well explained by these structural models. When the amino acid near the 5 position of the PAM is histidine, its side chain forms a potential hydrogen bond with the 6-hydroxyl group of guanine. Replacement of this guanine by cytosine or thymine would cause a major clash, whereas adenine lacks the hydroxyl group to form hydrogen bond with the histidine (Figure 2—figure supplement 2A). Likewise, an aspartate at 5 position of the PAM would favor a specific recognition of cytosine via hydrogen bonding with its 4-amine group, but not of other bases that may either result in major clash or abolish the hydrogen bond (Figure 2—figure supplement 2B). Similar explanation applies also to the apparent specificity between glutamine and adenine at the 8 position of the PAM on the target sequence (TS, Figure 2—figure supplement 2C). Since Nsp2Cas9 induced more GFP-positive cells (0.18%) than other Cas9s and recognized a simple N4CC PAM, we focused on Nsp2Cas9 in the following study.

Nsp2Cas9 enables genome editing for endogenous sites

We tested the optimized crRNA length for Nsp2Cas9. We designed a series of crRNAs varied from 18 to 26 nt to target GRIN2B gene. The results showed that 22–26 nt crRNA activities were comparable (Figure 3—figure supplement 1). The 22 nt crRNA was used in the following study. To test whether Nsp2Cas9 enables genome editing for endogenous targets in human cells, we selected a panel of 19 targets. Nme2Cas9 has the same expression backbone as Nsp2Cas9 and was used for side-by-side comparison (Figure 3A). Western blot analysis revealed that their protein expression levels were comparable (Figure 3B). Five days after transfection of Cas9 and sgRNA expression plasmids, cells were harvested, and genomic DNA was extracted for targeted deep sequencing. The results revealed that Nsp2Cas9 and Nme2Cas9 displayed comparable editing activity, although the activities varied depending on the targets (Figure 3C–D). We tested Nsp2Cas9 editing capacity in additional cell lines, including HeLa, HCT116, A375, SH-SY5Y, and mouse N2a cells, and it could also generate indels in these cells with varying efficiencies (Figure 3—figure supplement 2A-E). In summary, these results demonstrated that Nsp2Cas9 could serve as a new player for genome editing.

Figure 3. Nsp2Cas9 enables editing in HEK293T cells.

(A) Schematic of Cas9 and sgRNA expression constructs. U1A: U1A promoter; pA: polyA; NLS: nuclear localization signal; HA: HA tag. (B) Protein expression levels of Nsp2Cas9 and Nme2Cas9 were analyzed by Western blot. HEK293T cells without Cas9 transfection were used as negative control (NC). (C) Comparison of Nsp2Cas9 and Nme2Cas9 editing efficiencies at 19 endogenous loci in HEK293T cells. Data represent mean ± SD for n=3 biologically independent experiments. (D) Quantification of the indel efficiencies for Nsp2Cas9 and Nme2Cas9. Each dot represents an average efficiency for an individual locus. Data represent mean ± SD for n=3 biologically independent experiments. P values were determined using a two-sided Student’s t test. P=0.7486 (P>0.05), ns stands for not significant.

Figure 3—source data 1. Source data for Figure 3C and D.
Figure 3—source data 2. Source data for Figure 2B.

Figure 3.

Figure 3—figure supplement 1. The effect of spacer length on the efficiency of Nsp2Cas9 editing.

Figure 3—figure supplement 1.

A single G5 site on the GRIN2B gene was targeted by sgRNAs with spacer lengths varying from 18 to 26 nt.
Figure 3—figure supplement 1—source data 1. Source data for Figure 3—figure supplement 1.
Figure 3—figure supplement 2. Nsp2Cas9 enables editing in different mammalian cells.

Figure 3—figure supplement 2.

Nsp2Cas9 enables editing in HeLa (A), HCT116 (B), A375 (C), SH-SY5Y (D) and mouse N2a cells (E). Data represent mean ± SD (n=3).
Figure 3—figure supplement 2—source data 1. Source data for Figure 3—figure supplement 2A-D.
Figure 3—figure supplement 3. Rational engineering of Nsp2Cas9.

Figure 3—figure supplement 3.

(A) Schematic of the GFP-activation reporter construct for testing engineered Nsp2Cas9 activity. The protospacer sequence is shown below. (B) GFP-positive cells induced by the engineered Nsp2Cas9 variants. Data represent mean ± SD (n=3).
Figure 3—figure supplement 3—source data 1. Source data for Figure 3—figure supplement 3B.
Figure 3—figure supplement 4. NarCas9 enables genome editing in mammalian cells.

Figure 3—figure supplement 4.

(A) Schematic of Cas9 and sgRNA expression constructs. U1A: U1A promoter; pA: polyA; NLS: nuclear localization signal; HA: HA tag. (B) NarCas9 enables genome editing in HEK293T cells. Data represent mean ± SD (n=3). (C) NarCas9 enables genome editing in HeLa cells. Data represent mean ± SD (n=3).
Figure 3—figure supplement 4—source data 1. Source data for Figure 3—figure supplement 4B.
Figure 3—figure supplement 4—source data 2. Source data for Figure 3—figure supplement 4C.
Open in a new tab

It has been reported that residues S593 and W596 in Nme1Cas9 play vital roles in cleavage activity. Replacement of the single or double residues with arginine could increase the cleavage activity of Nme1Cas9 in vitro (Sun et al., 2019). To test whether these two residues could influence Nsp2Cas9 activity, we identified the corresponding residues S597 and W600 in Nsp2Cas9 by protein sequence alignment and replaced the single or double residues with arginine. To test the activities of the resulting Cas9 variants, we constructed a GFP-activation cell line that was similar to the PAM-screening construct but with a fixed PAM (Figure 3—figure supplement 3A). The editing activities could be reflected by the GFP-positive cells. However, five days after genome editing, the results showed that single or double mutation variants could not improve the editing activities (Figure 3—figure supplement 3B).

NarCas9 enables genome editing for endogenous sites

In addition to Nsp2Cas9, we also tested the editing ability of NarCas9, which recognizes a simple N4C PAM. Five days after transfection of NarCas9 and sgRNA expression plasmids, the cells were harvested, and genomic DNA was extracted for targeted deep sequencing. The results showed that NarCas9 could generate indels in both HEK293T and HeLa cells, but the efficiency was low (Figure 3—figure supplement 3A-C). SmuCas9 also recognizes a simple N4C PAM, but it exhibited minimal activity in the PAM-screening assay, and we did not study this further.

A chimeric Cas9 nuclease enables genome editing for endogenous sites

We and others have demonstrated that swapping the PI domain between closely related orthologs can generate a chimeric nuclease that recognizes distinct PAMs (Edraki et al., 2019; Chatterjee et al., 2020; Hu et al., 2020). To expand the targeting scope, we replaced the Nsp2Cas9 PI with SmuCas9 PI, resulting in a chimeric Cas9 nuclease that we named ‘Nsp2-SmuCas9’’ (Figure 4A). The PAM-screening assay revealed that Nsp2-SmuCas9 could induce GFP expression (Figure 4—figure supplement 1A). Deep sequencing analysis revealed that Nsp2-SmuCas9 recognized an N4C PAM (Figure 4B–C). We tested the activities of Nsp2-SmuCas9 in a panel of 12 endogenous targets that have been used for NarCas9. Targeted deep sequencing revealed that Nsp2-SmuCas9 could efficiently induce indels at these sites (Figure 4D). Importantly, Nsp2-SmuCas9 displayed higher activities than NarCas9 (Figure 4E).

Figure 4. Characterization of Nsp2-SmuCas9 for genome editing.

(A) Schematic diagram of chimeric Cas9 nucleases based on Nsp2Cas9. PI domain of Nsp2Cas9 was replaced with the PI domain of SmuCas9. (B) Sequence logos and (C) PAM wheel diagrams indicate that Nsp2-SmuCas9 recognizes an N4C PAM. (D) Nsp2-SmuCas9 generated indels at endogenous sites with N4C PAMs in HEK293T cells. Indel efficiencies were determined by targeted deep sequencing. NarCas9 is used as a control. Data represent mean ± SD for n=3 biologically independent experiments. (E) Quantification of the indel efficiencies for Nsp2-SmuCas9 and NarCas9. Each dot represents an average efficiency for an individual locus. Data represent mean ± SD for n=3 biologically independent experiments. p values were determined using a two-sided Student’s t test. *p=0.0148 (0.01<p < 0.05).

Figure 4—source data 1. Source data for Figure 4D and E.

Figure 4.

Figure 4—figure supplement 1. Test of 4 chimeric Cas9 activity through a GFP-activation assay.

Figure 4—figure supplement 1.

(A) Nsp2-SmuCas9 and Nme2-SmuCas9 could induce GFP expression. Reporter cells without Cas9 transfection are used as a negative control. Scale bar: 250 μm. (B) Sequence logo and (C) PAM wheel diagram indicate that Nme2-SmuCas9 recognizes an N4C PAM. (D) Nme2-SmuCas9 generated indels at endogenous sites with N4C PAMs in HEK293T cells. Indel efficiencies were determined by targeted deep sequencing. Data represent mean ± SD for n=3 biologically independent experiments.
Figure 4—figure supplement 1—source data 1. Source data for Figure 4—figure supplement 1D.
Figure 4—figure supplement 2. Structure of the fully complementary Cas9-sgRNA-dsDNA complex in a catalytic state.

Figure 4—figure supplement 2.

(A) An alignment of the protein tertiary structures of Nsp2-NarCas9 and Nme1Cas9-sgRNA-dsDNA complexes. Blue represents the Nme1Cas9 protein, and green represents the PI domain of NarCas9, PID: PAM identify domain. (B) Align of Nme1Cas9 and Nsp2-SmuCas9. Blue represents the Nme1Cas9 protein, orange represents the Nsp2Cas9 protein, and red represents the PI domain of SmuCas9. (C) Align of Nme1Cas9 and NarCas9. The green represents the NarCas9 protein. TS: target strand, NTS: non-target strand.
Figure 4—figure supplement 3. Calculated structural models of Nme2-NarCas9 and Nme2-SmuCas9 chimeras.

Figure 4—figure supplement 3.

(A) Calculated structural models of Nme2-NarCas9 and Nme2-SmuCas9 chimeras. In the inactive Nme2-NarCas9 chimera (magenta), R1052 will crash with the DNA strand, leading to a failure of binding with DNA. In the active Nme2-SmuCas9 chimera (salmon), R1052 will also crash with the DNA strand. (B) Overall calculated structures of Nme2-NarCas9 (magenta) and Nme2-SmuCas9 (salmon) chimeras with sgRNA and dsDNA. TS: target strand, NTS: non-target strand.
Open in a new tab

We also replaced the Nsp2Cas9 PI with NarCas9 PI to generate a chimeric Nsp2-NarCas9; replaced the Nme2Cas9 PI with SmuCas9 PI to generate a chimeric Nme2-SmuCas9; replaced Nme2Cas9 PI with NarCas9 PI to generate a chimeric Nme2-NarCas9. The PAM-screening assay revealed that only Nme2-SmuCas9 could induce GFP expression (Figure 4—figure supplement 1A). Deep sequencing analysis revealed that Nme2-SmuCas9 recognized an N4C PAM (Figure 4—figure supplement 1B-C). We tested the activities of Nme2-SmuCas9 in a panel of 12 endogenous targets that have been used for NarCas9. Targeted deep sequencing revealed that Nme2-SmuCas9 could induce indels at two sites (Figure 4—figure supplement 1D). These data demonstrated that Nme2-SmuCas9 activity is low.

We generated structural models of Nsp2-NarCas9, Nsp2-SmuCas9, and NarCas9 using the crystal structure of highly homologous Nme1Cas9 in complex with sgRNA and dsDNA (PDB ID: 6JDV) as the template by SWISS-MODEL. By superimposing these models, we noticed that residues G1035, K1037 and T1038 of Nsp2-NarCas9 chimera protrude towards the DNA molecule, which would prevent the binding with DNA and thereby abolishing the editing activity (Figure 4—figure supplement 2A). In comparison, Nsp2-SmuCas9 and NarCas9, which possess the Cas activity, show no protrusion at the corresponding position (Figure 4—figure supplement 2B-C). When Nme2-NarCas9 was analyzed by the same method, 1052 Arg will crash with the DNA strand, leading to a failure of binding with DNA. The predicted result revealed that the Nme2-SmuCas9 1052 Arg also crash with the DNA strand, which may lead to low editing efficiency (Figure 4—figure supplement 3A-B).

Activity comparison

Next, we compared the activity of Nsp2Cas9 and Nsp2-SmuCas9 to the extensively used Cas9 variants, including wild-type SpCas9 (SpCas9-WT) (Cong et al., 2013), SpCas9-NG (Nishimasu et al., 2018), and SpCas9-RY (Walton et al., 2020). We cloned these Cas9 variants into identical plasmid backbones (Figure 5A). Western blot analysis revealed that their protein expression levels were comparable (Figure 5B). We compared their activities with a panel of 11 targets. After 5 days of genome editing, targeted deep sequencing results revealed that SpCas9 was the most active enzyme. Nsp2Cas9, SpCas9-NG, and SpCas9-RY displayed similar activity. Nsp2-SmuCas9 displayed lower activities than other Cas9 variants (Figure 5C-D).

Figure 5. Comparison of indel efficiency between Nsp2Cas9, Nsp2-SmuCas9, and SpCas9.

Figure 5.

Open in a new tab

(A) Schematic of Cas9 and sgRNA expression constructs. U1A: U1A promoter; pA: polyA; NLS: nuclear localization signal; HA: HA tag. (B) Protein expression levels of Nsp2Cas9, Nsp2-SmuCas9, and SpCas9 were analyzed by western blot. HEK293T cells without Cas9 transfection were used as a negative control (NC). (C) The editing efficiencies of Nsp2Cas9, Nsp2-SmuCas9, and SpCas9 varied depending on the target sites. The PAM sequences (NGGNCC) were shown below. Data represent mean ± SD for n=3 biologically independent experiments. (D) Quantification of the indel efficiencies for Nsp2Cas9, Nsp2-SmuCas9, and SpCas9. Each dot represents an average efficiency for an individual locus. Data represent mean ± SD for n=3 biologically independent experiments. p values were determined using a two-sided Student’s t test. p=0.3883, p=0.7316, p=0.0741 (p>0.05), ns stands for not significant. *p=0.0247, *p=0.0144, (0.01<p < 0.05), * stands for significant. **p=0.0058 (p<0.01), ** stands for significant.

Figure 5—source data 1. Source data for Figure 5B.
Figure 5—source data 2. Source data for the Figure 5C and D.

Analysis of Nsp2Cas9 specificity

Next, we analyzed Nsp2Cas9 specificity by using the GFP-activation assay, and Nme2Cas9 was used for comparison. We generated a panel of 11 sgRNAs with dinucleotide mismatches. Five days after co-transfection of Nsp2Cas9 with individual sgRNAs, GFP-positive cells were analyzed by using a flow cytometer. The results showed that Nsp2Cas9 displayed moderate off-target effects with some sgRNAs (sgRNAs M1, M4, M8, M9, and M10) (Figure 6A). In contrast, Nme2Cas9 was a highly specific enzyme that did not tolerate dinucleotide mismatches (sgRNAs M2-M11), consistent with a previous study (Edraki et al., 2019).

Figure 6. Analysis of Nsp2Cas9 specificity.

Figure 6.

Open in a new tab

(A) Analysis of Nsp2Cas9 and Nme2Cas9 specificity with a GFP-activation assay. A panel of sgRNAs with dinucleotide mutations (red) is shown below. The editing efficiencies reflected by ratio of GFP-positive cells are shown. Data represent mean ± SD for n=3 biologically independent experiments. (B) GUIDE-seq was performed to analyze the genome-wide off-target effects of Nsp2Cas9 and Nme2Cas9. On-target (indicated by stars) and off-target sequences are shown on the left. Read numbers are shown on the right. Mismatches compared to the on-target site are shown and highlighted in color.

Figure 6—source data 1. Source data for the Figure 6A.

To further compare the specificity of Nsp2Cas9 and Nme2Cas9, we performed genome-wide unbiased identification of double-stranded breaks enabled by sequencing (GUIDE-seq) (Kleinstiver et al., 2015). Three endogenous sites targeting GRIN2B, VEGFA and AAVS1 were selected. Five days after electroporation of the Cas9 expression plasmid with GUIDE-seq oligos into HEK293T cells, libraries were prepared for deep sequencing. The sequencing analysis revealed that both Cas9 nucleases could robustly generate indels at three on-targets, as reflected by the high GUIDE-seq read counts (Figure 6B). We only detected one off-target site for Nsp2Cas9 on the GRIN2B target (Figure 6B).

Analysis of Nsp2-SmuCas9 specificity

Next, we analyzed Nsp2-SmuCas9 specificity by using the GFP-activation assay. Nsp2-SmuCas9 enzyme showed a minimal or background level of off-target effects with mismatched sgRNAs (Figure 7A). Next, GUIDE-seq was performed to test the specificity of Nsp2-SmuCas9. We selected three target sites containing N4C PAMs. The results revealed that one off-target cleavage occurred on the EMX1 target (Figure 7B). Altogether, these results demonstrated that Nsp2Cas9 and Nsp2-SmuCas9 offered new platforms for genome editing.

Figure 7. Analysis of Nsp2-SmuCas9 specificity.

Figure 7.

Open in a new tab

(A) Analysis of Nsp2-SmuCas9 specificity with a GFP-activation assay. A panel of sgRNAs with dinucleotide mutations (red) is shown below. The editing efficiencies reflected by ratio of GFP-positive cells are shown. Data represent mean ± SD for n=3 biologically independent experiments. (B) GUIDE-seq was performed to analyze the genome-wide off-target effects of Nsp2-SmuCas9. On-target (indicated by stars) and off-target sequences are shown on the left. Read numbers are shown on the right. Mismatches compared to the on-target site are shown and highlighted in color.

Figure 7—source data 1. Source data for the Figure 7A.

Discussion

Type II CRISPR/Cas9, including subtypes II-A, -B, and -C, is the most common class 2 system found in bacteria and archaea (Makarova et al., 2015). We and others previously demonstrated that closely related type II-A orthologs preferred variable but purine-rich PAMs (Hu et al., 2021; Chatterjee et al., 2018; Chatterjee et al., 2020; Hu et al., 2020; Wang et al., 2022). The PAM diversity was also observed within the closely related type V-A orthologs, where Cas12a nucleases recognized the canonical TTTV (V=A/C/G) motif but notable deviations of nucleotide preference existed (Jacobsen et al., 2020). In this study, we investigated the PAM diversity within closely related type II-C orthologs. We identified PAMs for 25 Nme1Cas9 orthologs, significantly extending the list of type II-C Cas9 PAMs. These PAMs included purine-rich (e.g. PaeCas9 and HfeCas9), pyrimidine-rich (e.g. Nsp2Cas9 and Nan1Cas9), and mixed purine and pyrimidine (e.g. HpiCas9 and NdeCas9) PAMs, which are more diverse than those identified from type II-A and type V-A orthologs. The PAM length also varied dramatically from a single nucleotide (e.g. NarCas9) to up to 11 nucleotides (e.g. CflCas9). These findings have increased knowledge of PAM diversity within type II-C Cas9s.

Our study offers new Cas9 tools for genome editing. We demonstrated that Nsp2Cas9 was an efficient enzyme for genome editing. By swapping PIs between two Cas9s, we generated a chimeric Nsp2-SmuCas9 that recognizes a simple N4C PAM. To our knowledge, the N4C PAM is the most relaxed PAM recognized by compact Cas9 orthologs identified to date. Based on PAMs identified in this study, more chimeric Cas9s can be developed to expand targeting scope. For clinical applications, it is crucial to develop a CRISPR toolbox capable of recognizing multiple PAMs. For example, allele-specific gene disruption through non-homologous end joining (NHEJ) is a potential strategy to treat autosomal dominant diseases (Gao et al., 2018; Diakatou et al., 2021), where the causative gene is haplosufficient. Autosomal dominant diseases are mainly caused by single-nucleotide missense mutations (Guo et al., 2013). If missense mutations form novel PAMs, CRISPR/Cas9 nucleases can disrupt mutant alleles by a PAM-specific approach (Diakatou et al., 2021; Courtney et al., 2016). With further development, we anticipate that CRISPR tools from type II-C Cas9 orthologs can play a vital role in therapeutic applications.

Materials and methods

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene
(Homo sapiens)		 AAVS1 GenBank HGNC:HGNC:22
Gene
(Homo sapiens)		 VEGFA GenBank HGNC:HGNC:12680
Gene
(Homo sapiens)		 EMX1 GenBank HGNC:HGNC:3340
Gene
(Homo sapiens)		 GRIN2B GenBank HGNC:HGNC:4586
Recombinant DNA reagent Instant Sticky-end Ligase Master Mix NEB Catalog #: M0370S
Recombinant DNA reagent T4 DNA ligase NEB Catalog #: M0202S
Cell line (Homo-sapiens) HEK293T
(normal, Adult)		 ATCC CRL-3216
Cell line (Homo-sapiens) HeLa ATCC CRM-CCL-2
Cell line (Homo-sapiens) SH-SY5Y ATCC CRL-2266
Cell line (Homo-sapiens) A375
(normal, Adult)		 ATCC CRL-1619
Cell line (Homo-sapiens) HCT116
(adult male)		 ATCC CCL-247
Cell line (Mus musculus) N2a cells
(mouse neuroblasts)		 ATCC CCL-131
Antibody Anti-HA (rabbit polyclonal) abcom abcam: ab137838; RRID:AB_262051 (1:1000)
Antibody Anti-GAPDH (rabbit polyclonal) Cell Signaling Cell Signaling:#3683; RRID:AB_307275 (1:1000)
Sequence-based reagent dsODN-F This paper dsODN oligo primer 5ʹ- P-G*T*TTAATTGAGTTGTCATATGTTAATAACGGT*A*T -
3ʹ
Sequence-based reagent dsODN-R This paper dsODN oligo primer 5ʹ- P-A*T*ACCGTTATTAACATATGACAACTCAATTAA*A*C
–3ʹ
Sequence-based reagent P5_index_F This paper PCR primers AATGATACGGCGACCACCGAGATCTACACTGAACCTTA
CACTCTTTCCCTACACGAC
Sequence-based reagent Nuclease_off_+_G
SP		 This paper PCR primers GGATCTCGACGCTCTCCCTATACCGTTATTAACATATGACA
Sequence-based reagent Nuclease_off_-
_GSP1		 This paper PCR primers GGATCTCGACGCTCTCCCTGTTTAATTGAGTTGTCATATGTTAATAAC
Sequence-based reagent P5_2 This paper PCR primers AATGATACGGCGACCACCGAGATCTACAC
Sequence-based reagent Nuclease_off
_+_GSP2		 This paper PCR primers CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTGACTGGAGT
TCAGACGTGTGCTCTTCCGATCTACATATGACAACTCAATTAAAC
Sequence-based reagent Nuclease_off _-
_GSP2		 This paper PCR primers CAAGCAGAAGACGGCATACGAGATCTAGTACGGTGAC
TGGAGTCCTCTCTATGGGCAGTCGGTGATTTGAGTTG
TCATATGTTAATAACGGTA
Software, algorithm FlowJo software FlowJo VX
Software, algorithm CorelDRAW 2020 software CorelDRAW 2020
Software, algorithm Vector NTI software Vector NTI
Software, algorithm GraphPad Prism software GraphPad Prism 7 (https://graphpad.com) RRID:SCR_015807 Version 7.0.0
Chemical compound, drug SYBR Gold nucleic acid stain Thermo Fisher Scientific Thermo Fisher Scientific: S11494
Open in a new tab

Plasmid construction

Cas9 expression plasmid construction

The plasmid Nme2Cas9_AAV (Addgene #119924) was amplified by the primers Nme2Cas9-F/Nme2Cas9-R to obtain the Nme2Cas9_AAV backbone. The human codon-optimized Cas9 gene (Supplementary file 1) was synthesized by HuaGene (Shanghai, China) and cloned into the Nme2Cas9_AAV backbone by the NEBuilder assembly tool (NEB) according to the manufacturer’s instructions. Sequences of each Cas9 were confirmed by Sanger sequencing (GENEWIZ, Suzhou, China). The maps of all plasmids used in the study are packaged in Figure 1—source data 1. The primer sequences for the Nme2Cas9_AAV backbone, variants of Nsp2Cas9 and chimeric Cas9 nucleases are listed in Supplementary file 1. Single-guide RNA sequences for each Cas9 are listed in Supplementary file 2.

sgRNA expression plasmid construction

The sgRNA expression plasmids were constructed by ligating sgRNA into the Bsa1-digested U6-Nme2_scaffold plasmid，which is the same as Nme1-scaffold. The primer sequences and target sequences are listed in Supplementary file 3 and Supplementary file 4, respectively.

Cell culture and transfection

The cell culture reagents were purchased from Gibco unless otherwise indicated. HEK293T, HeLa, SH-SY5Y, A375 and N2a cell lines were maintained in Dulbecco’s modified Eagle’s medium (DMEM). HCT116 cells were cultured in McCoy’s 5 A medium (Gibco). All cell cultures were supplemented with 10% fetal bovine serum (FBS) (Gibco) that was inactivated at 56 °C for 30 min and 1% penicillin-streptomycin (Gibco). All cell were cultured in a humidified incubator at 37 °C and 5% CO2. All cell lines identities were validated by STR profiling (ATCC) and repeatedly tested for mycoplasma by PCR.

HEK293T, HeLa, and N2a cells were transfected with Lipofectamine 2000 (Life Technologies) according to the manufacturer’s instructions. SH-SY5Y, A375, and HCT116 cells were transfected with Lipofectamine 3000 (Life Technologies) according to the manufacturer’s instructions. For transient transfection, a total of 300 ng Cas9-expressing plasmid and 200 ng sgRNA plasmid were co-transfected into a 48-well plate. For Cas9 PAM sequence screening, 1.2×107 HEK293T cells were transfected with 10 μg of Cas9 plasmid and 5 μg of sgRNA plasmid in 10 cm dishes.

Flow cytometry analysis

Transfected library cells with a certain percentage of GFP-positive cells were collected by centrifugation at 1000 rpm for 5 min and resuspended in PBS. Then, GFP-positive cells were collected by flow cytometry and cultured in six-well plates. Five days after culture, we extracted the genome and built deep sequencing libraries.

PAM sequence analysis

Twenty-base-pair sequences (AAGCCTTGTTTGCCACCATG/GTGAGCAAGG GCGAGGAGCT) flanking the target sequence (GAGAGTAGAGGCGGCCACGACCTGNNNNNNNN) were used to fix the target sequences. CTG and GTGAGCAAGGGCG AGGAGCT were used to fix 8 bp random sequences. Target sequences with in-frame mutations were used for PAM analysis. The 8 bp random sequence was extracted and visualized by WebLogo (Crooks et al., 2004) and a PAM wheel chart to identify PAMs (Leenay et al., 2016). The median coverage of every individual PAM variant and the number of unique PAM sequences are listed in Figure 2—source data 1.

Genome editing and deep sequencing analysis of indels for endogenous sites

Cells were seeded into 48-well plates one day prior to transfection and transfected at 70–80% confluency using Lipofectamine 2000 (Life Technologies) following the manufacturer’s recommended protocol. For genome editing, 105 cells were transfected with a total of 300 ng of Cas9 plasmid and 200 ng of sgRNA plasmid in 48-well plates. Five days after transfection, the cells were harvested, and genomic DNA was extracted in QuickExtract DNA Extraction Solution (Epicenter). To measure indel frequencies, the target sites were amplified by two rounds of nested PCR to add the Illumina adaptor sequence. The PCR products (~400 bp in length) were gel-extracted by a QIAquick Gel Extraction Kit (QIAGEN) for deep sequencing.

Western blot analysis

HEK293T cells were seeded into 24-well plates. The next day, the Cas9-expressing plasmid (800 ng) was transfected into cells using Lipofectamine 2000 (Invitrogen). Three days after transfection, cells were collected and resuspended in cell lysis buffer for Western blotting and IP (Beyotime) supplemented with 1 mM phenylmethanesulfonyl fluoride (PMSF) (Beyotime). Cell lysates were then centrifuged at 12,000 rpm for 20 min at 4 °C, and the supernatants were collected and mixed with 5 x loading buffer followed by boiling at 95 °C for 10 min. Equal amounts of protein samples were subjected to SDS-PAGE, followed by transfer to polyvinylidene difluoride (PVDF) membranes (Merck, Darmstadt, Germany). The PVDF membranes were blocked with 5% BSA in TBST for 1 hr at room temperature and then incubated with the anti-HA antibody (1:1000; Abcam) and anti-GAPDH antibody (1:1000; Cell Signaling) at 4 °C overnight.

The membrane was washed three times in TBS-T for 5 min each time. The membranes were incubated in the secondary goat anti-rabbit antibody (1:10,000; Abcam) for 1 hr at room temperature. The membranes were then washed with TBST buffer three times and imaged.

Test of Cas9 specificity

To test the specificity of Nsp2Cas9 and Nsp2-SmuCas9, we generated a GFP reporter cell line with a fixed PAM (5’-CGTTCC-3’). HEK293T cells were seeded into 48-well plates and transfected with 300 ng of Cas9 plasmids and 200 ng of sgRNA plasmids by using Lipofectamine 2000. Five days after transfection, the GFP-positive cells were digested and centrifuged at 1000 rpm for 3 min, and the cells were resuspended in phosphate-buffered saline (PBS). Finally, the cells were analyzed on a Calibur instrument (BD). The data were analyzed using the FlowJo software.

GUIDE-seq

We performed a GUIDE-seq experiment with some modifications to the original protocol, as described (Tsai et al., 2015). On the day of the experiment, 2x105 HEK293T cells per target site were harvested and washed in PBS and transfected with 500 ng of Cas9 plasmid, 500 ng of sgRNA plasmid and 100 pmol annealed GUIDE-seq oligonucleotides through the Neon Transfection System. The electroporation voltage, width, and number of pulses were 1150 V, 20ms, and 2 pulses, respectively. Genomic DNA was extracted with the DNeasy Blood and Tissue kit (QIAGEN) 6 days after electroporation according to the manufacturer’s protocol. The genome library was prepared and subjected to deep sequencing.

Statistical analysis

All data are presented as the mean ± SD. Statistical analysis was conducted using GraphPad Prism 7. Student’s t test or one-way analysis of variance (ANOVA) was used to determine statistical significance between two or more than two groups, respectively. A value of p<0.05 was considered to be statistically significant (*p<0.05, **p<0.01, ***p<0.001). Raw data from all reported summary statistics were listed in Supplementary file 5.

Acknowledgements

We thank supports from mRNA innovation and translation center, Shanghai. This work was supported by grants from the National Key Research and Development Program of China (2021YFA0910602, 2021YFC2701103); the National Natural Science Foundation of China (82070258, 81870199); Open Research Fund of State Key Laboratory of Genetic Engineering, Fudan University (No. SKLGE-2104), Science and Technology Research Program of Shanghai (19DZ2282100); the Natural Science Fund of Shanghai Science and Technology Commission (19ZR1406300).

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Shuna Sun, Email: sun_shuna@fudan.edu.cn.

Yongming Wang, Email: ymw@fudan.edu.cn.

Jeremy J Day, University of Alabama at Birmingham, United States.

Kevin Struhl, Harvard Medical School, United States.

Funding Information

This paper was supported by the following grants:

  • National Key Research and Development Program of China 2021YFA0910602 to Yongming Wang.

  • National Natural Science Foundation of China 82070258 to Yongming Wang.

  • Fudan University No. SKLGE-2104 to Yongming Wang.

  • Shanghai Association for Science and Technology 19DZ2282100 to Yongming Wang.

  • Shanghai Science and Technology Committee 19ZR1406300 to Yongming Wang.

  • National Key Research and Development Program of China 2021YFC2701103 to Yongming Wang.

  • National Natural Science Foundation of China 81870199 to Yongming Wang.

Additional information

Competing interests

No competing interests declared.

author on patent application number 202110878452X, "Cas9 protein, gene editing system containing Cas9 protein and application"; this patent relates to the technical field of gene editing, and specifically designs a CRISPR/Cas9 gene editing system and its application.

Author contributions

Data curation, Methodology, Writing - original draft.

Methodology.

Data curation.

Investigation.

Methodology.

Data curation.

Investigation.

Resources.

Resources, Formal analysis, Supervision, Project administration, Writing – review and editing.

Additional files

Supplementary file 1. The Cas9 ID and human codon–optimized Cas9 gene.

The file contains the Cas9 ID, tracrRNA, and amino acid sequences of Nme1Cas9 orthologs used in this study. The human codon-optimized Cas9 genes were synthesized. The primers used for the chimera’s construction were also listed in this file.

elife-77825-supp1.xlsx (63.3KB, xlsx)
Supplementary file 2. The single-guide RNA sequence.

The single-guide RNA sequence for Nme1Cas9 orthologs and chimeras used in this study.

elife-77825-supp2.xlsx (11.4KB, xlsx)
Supplementary file 3. Primers used in this study.

A list of oligonucleotide pairs and primers used for deep sequencing.

elife-77825-supp3.xlsx (21KB, xlsx)
Supplementary file 4. Target sites used in this study.

A list of the endogenous target sites of human and mouse and their downstream PAM. PAM, protospacer adjacent motif.

elife-77825-supp4.xlsx (135.9KB, xlsx)
Supplementary file 5. Underlying values for all reported summary statistics.

Raw data from all reported summary statistics.

elife-77825-supp5.xlsx (48.9KB, xlsx)
Transparent reporting form

Data availability

All data generated or analysed during this study are included in the manuscript and supporting file.

References

  1. Agudelo D, Carter S, Velimirovic M, Duringer A, Rivest J-F, Levesque S, Loehr J, Mouchiroud M, Cyr D, Waters PJ, Laplante M, Moineau S, Goulet A, Doyon Y. Versatile and robust genome editing with streptococcus thermophilus CRISPR1-cas9. Genome Research. 2020;30:107–117. doi: 10.1101/gr.255414.119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature. 2019;576:149–157. doi: 10.1038/s41586-019-1711-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chatterjee P., Jakimo N, Jacobson JM. Minimal PAM specificity of a highly similar spcas9 ortholog. Science Advances. 2018;4:eaau0766. doi: 10.1126/sciadv.aau0766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chatterjee P, Lee J, Nip L, Koseki SRT, Tysinger E, Sontheimer EJ, Jacobson JM, Jakimo N. A cas9 with PAM recognition for adenine dinucleotides. Nature Communications. 2020;11:2474. doi: 10.1038/s41467-020-16117-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Collias D, Beisel CL. CRISPR technologies and the search for the PAM-free nuclease. Nature Communications. 2021;12:555. doi: 10.1038/s41467-020-20633-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Multiplex genome engineering using CRISPR/cas systems. Science. 2013;339:819–823. doi: 10.1126/science.1231143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Courtney DG, Moore JE, Atkinson SD, Maurizi E, Allen EHA, Pedrioli DML, McLean WHI, Nesbit MA, Moore CBT. CRISPR/cas9 DNA cleavage at SNP-derived PAM enables both in vitro and in vivo KRT12 mutation-specific targeting. Gene Therapy. 2016;23:108–112. doi: 10.1038/gt.2015.82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Crooks GE, Hon G, Chandonia JM, Brenner SE. WebLogo: A sequence logo generator. Genome Research. 2004;14:1188–1190. doi: 10.1101/gr.849004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Deltcheva E, Chylinski K, Sharma CM, Gonzales K, Chao Y, Pirzada ZA, Eckert MR, Vogel J, Charpentier E. CRISPR RNA maturation by trans-encoded small RNA and host factor rnase III. Nature. 2011;471:602–607. doi: 10.1038/nature09886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Diakatou M, Dubois G, Erkilic N, Sanjurjo-Soriano C, Meunier I, Kalatzis V. Allele-specific knockout by CRISPR/cas to treat autosomal dominant retinitis pigmentosa caused by the G56R mutation in NR2E3. International Journal of Molecular Sciences. 2021;22:2607. doi: 10.3390/ijms22052607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Edraki A, Mir A, Ibraheim R, Gainetdinov I, Yoon Y, Song C-Q, Cao Y, Gallant J, Xue W, Rivera-Pérez JA, Sontheimer EJ. A compact, high-accuracy cas9 with A dinucleotide PAM for in vivo genome editing. Molecular Cell. 2019;73:714–726. doi: 10.1016/j.molcel.2018.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fedorova I, Vasileva A, Selkova P, Abramova M, Arseniev A, Pobegalov G, Kazalov M, Musharova O, Goryanin I, Artamonova D, Zyubko T, Shmakov S, Artamonova T, Khodorkovskii M, Severinov K. PpCas9 from pasteurella pneumotropica - a compact type II-C cas9 ortholog active in human cells. Nucleic Acids Research. 2020;48:12297–12309. doi: 10.1093/nar/gkaa998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gao X, Tao Y, Lamas V, Huang M, Yeh W-H, Pan B, Hu Y-J, Hu JH, Thompson DB, Shu Y, Li Y, Wang H, Yang S, Xu Q, Polley DB, Liberman MC, Kong W-J, Holt JR, Chen Z-Y, Liu DR. Treatment of autosomal dominant hearing loss by in vivo delivery of genome editing agents. Nature. 2018;553:217–221. doi: 10.1038/nature25164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gao N, Zhang C, Hu Z, Li M, Wei J, Wang Y, Liu H. Characterization of brevibacillus laterosporus cas9 (blatcas9) for mammalian genome editing. Frontiers in Cell and Developmental Biology. 2020;8:583164. doi: 10.3389/fcell.2020.583164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gasiunas G, Barrangou R, Horvath P, Siksnys V. Cas9-crrna ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. PNAS. 2012;109:E2579–E2586. doi: 10.1073/pnas.1208507109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gasiunas G, Young JK, Karvelis T, Kazlauskas D, Urbaitis T, Jasnauskaite M, Grusyte MM, Paulraj S, Wang P-H, Hou Z, Dooley SK, Cigan M, Alarcon C, Chilcoat ND, Bigelyte G, Curcuru JL, Mabuchi M, Sun Z, Fuchs RT, Schildkraut E, Weigele PR, Jack WE, Robb GB, Venclovas Č, Siksnys V. A catalogue of biochemically diverse CRISPR-cas9 orthologs. Nature Communications. 2020;11:5512. doi: 10.1038/s41467-020-19344-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR. Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature. 2017;551:464–471. doi: 10.1038/nature24644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell. 2013;154:442–451. doi: 10.1016/j.cell.2013.06.044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Guo Y, Wei X, Das J, Grimson A, Lipkin SM, Clark AG, Yu H. Dissecting disease inheritance modes in a three-dimensional protein network challenges the “guilt-by-association” principle. American Journal of Human Genetics. 2013;93:78–89. doi: 10.1016/j.ajhg.2013.05.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Harrington LB, Paez-Espino D, Staahl BT, Chen JS, Ma E, Kyrpides NC, Doudna JA. A thermostable cas9 with increased lifetime in human plasma. Nature Communications. 2017;8:1424. doi: 10.1038/s41467-017-01408-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hou Z, Zhang Y, Propson NE, Howden SE, Chu LF, Sontheimer EJ, Thomson JA. Efficient genome engineering in human pluripotent stem cells using cas9 from neisseria meningitidis. PNAS. 2013;110:15644–15649. doi: 10.1073/pnas.1313587110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hu Z, Wang S, Zhang C, Gao N, Li M, Wang D, Wang D, Liu D, Liu H, Ong SG, Wang H, Wang Y. A compact cas9 ortholog from staphylococcus auricularis (sauricas9) expands the DNA targeting scope. PLOS Biology. 2020;18:e3000686. doi: 10.1371/journal.pbio.3000686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hu Z, Zhang C, Wang S, Gao S, Wei J, Li M, Hou L, Mao H, Wei Y, Qi T, Liu H, Liu D, Lan F, Lu D, Wang H, Li J, Wang Y. Discovery and engineering of small slugcas9 with broad targeting range and high specificity and activity. Nucleic Acids Research. 2021;49:4008–4019. doi: 10.1093/nar/gkab148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Jacobsen T, Ttofali F, Liao C, Manchalu S, Gray BN, Beisel CL. Characterization of cas12a nucleases reveals diverse PAM profiles between closely-related orthologs. Nucleic Acids Research. 2020;48:5624–5638. doi: 10.1093/nar/gkaa272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA. RNA-guided editing of bacterial genomes using CRISPR-cas systems. Nature Biotechnology. 2013;31:233–239. doi: 10.1038/nbt.2508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012;337:816–821. doi: 10.1126/science.1225829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kim E, Koo T, Park SW, Kim D, Kim K, Cho H-Y, Song DW, Lee KJ, Jung MH, Kim S, Kim JH, Kim JH, Kim J-S. In vivo genome editing with a small cas9 orthologue derived from campylobacter jejuni. Nature Communications. 2017;8:14500. doi: 10.1038/ncomms14500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kleinstiver BP, Prew MS, Tsai SQ, Nguyen NT, Topkar VV, Zheng Z, Joung JK. Broadening the targeting range of Staphylococcus aureus CRISPR-cas9 by modifying PAM recognition. Nature Biotechnology. 2015;33:1293–1298. doi: 10.1038/nbt.3404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature. 2016;533:420–424. doi: 10.1038/nature17946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Genome-scale transcriptional activation by an engineered CRISPR-cas9 complex. Nature. 2015;517:583–588. doi: 10.1038/nature14136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Koonin EV, Makarova KS, Wolf YI. Evolutionary genomics of defense systems in archaea and bacteria. Annual Review of Microbiology. 2017;71:233–261. doi: 10.1146/annurev-micro-090816-093830. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Leenay RT, Maksimchuk KR, Slotkowski RA, Agrawal RN, Gomaa AA, Briner AE, Barrangou R, Beisel CL. Identifying and visualizing functional PAM diversity across CRISPR-cas systems. Molecular Cell. 2016;62:137–147. doi: 10.1016/j.molcel.2016.02.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Makarova KS, Wolf YI, Alkhnbashi OS, Costa F, Shah SA, Saunders SJ, Barrangou R, Brouns SJJ, Charpentier E, Haft DH, Horvath P, Moineau S, Mojica FJM, Terns RM, Terns MP, White MF, Yakunin AF, Garrett RA, van der Oost J, Backofen R, Koonin EV. An updated evolutionary classification of CRISPR-cas systems. Nature Reviews. Microbiology. 2015;13:722–736. doi: 10.1038/nrmicro3569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S, Yang L, Church GM. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nature Biotechnology. 2013;31:833–838. doi: 10.1038/nbt.2675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Mojica FJM, Díez-Villaseñor C, García-Martínez J, Almendros C. Short motif sequences determine the targets of the prokaryotic CRISPR defence system. Microbiology. 2009;155:733–740. doi: 10.1099/mic.0.023960-0. [DOI] [PubMed] [Google Scholar]
  36. Nishimasu H, Shi X, Ishiguro S, Gao L, Hirano S, Okazaki S, Noda T, Abudayyeh OO, Gootenberg JS, Mori H, Oura S, Holmes B, Tanaka M, Seki M, Hirano H, Aburatani H, Ishitani R, Ikawa M, Yachie N, Zhang F, Nureki O. Engineered CRISPR-cas9 nuclease with expanded targeting space. Science. 2018;361:1259–1262. doi: 10.1126/science.aas9129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Qi T, Wu F, Xie Y, Gao S, Li M, Pu J, Li D, Lan F, Wang Y. Base editing mediated generation of point mutations into human pluripotent stem cells for modeling disease. Frontiers in Cell and Developmental Biology. 2020;8:590581. doi: 10.3389/fcell.2020.590581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Ran FA, Cong L, Yan WX, Scott DA, Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang F. In vivo genome editing using Staphylococcus aureus cas9. Nature. 2015;520:186–191. doi: 10.1038/nature14299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Shmakov S, Smargon A, Scott D, Cox D, Pyzocha N, Yan W, Abudayyeh OO, Gootenberg JS, Makarova KS, Wolf YI, Severinov K, Zhang F, Koonin EV. Diversity and evolution of class 2 CRISPR-cas systems. Nature Reviews. Microbiology. 2017;15:169–182. doi: 10.1038/nrmicro.2016.184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Sun W, Yang J, Cheng Z, Amrani N, Liu C, Wang K, Ibraheim R, Edraki A, Huang X, Wang M, Wang J, Liu L, Sheng G, Yang Y, Lou J, Sontheimer EJ, Wang Y. Structures of neisseria meningitidis cas9 complexes in catalytically poised and anti-CRISPR-inhibited states. Molecular Cell. 2019;76:938–952. doi: 10.1016/j.molcel.2019.09.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tsai SQ, Zheng Z, Nguyen NT, Liebers M, Topkar VV, Thapar V, Wyvekens N, Khayter C, Iafrate AJ, Le LP, Aryee MJ, Joung JK. GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-cas nucleases. Nature Biotechnology. 2015;33:187–197. doi: 10.1038/nbt.3117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. UniProt Consortium, T UniProt: the universal protein knowledgebase. Nucleic Acids Research. 2018;46:2699. doi: 10.1093/nar/gky092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Walton RT, Christie KA, Whittaker MN, Kleinstiver BP. Unconstrained genome targeting with near-pamless engineered CRISPR-cas9 variants. Science. 2020;368:290–296. doi: 10.1126/science.aba8853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Wang B, Wang Z, Wang D, Zhang B, Ong S-G, Li M, Yu W, Wang Y. KrCRISPR: an easy and efficient strategy for generating conditional knockout of essential genes in cells. Journal of Biological Engineering. 2019;13:35. doi: 10.1186/s13036-019-0150-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wang S, Mao H, Hou L, Hu Z, Wang Y, Qi T, Tao C, Yang Y, Zhang C, Li M, Liu H, Hu S, Chai R, Wang Y. Compact schcas9 recognizes the simple NNGR PAM. Advanced Science. 2022;9:e2104789. doi: 10.1002/advs.202104789. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Xie Y, Wang D, Lan F, Wei G, Ni T, Chai R, Liu D, Hu S, Li M, Li D, Wang H, Wang Y. An episomal vector-based CRISPR/cas9 system for highly efficient gene knockout in human pluripotent stem cells. Scientific Reports. 2017;7:2320. doi: 10.1038/s41598-017-02456-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

Editor's evaluation

Jeremy J Day 1

This work is relevant to all who are interested in genome editing. The versatile Cas9 nuclease has enabled creative genome editing applications, yet the targetable sequence space is limited by the PAM specificity of the Cas9 RNP. This manuscript expands the Cas9 toolbox by defining the PAM specificity and genome editing activity of a large group of smaller-sized type II-C Cas9s. The results also contribute to our understanding of the diversity of Cas enzymes and show that there is a significant potential in mining for non-trivial genome editing tools amongst highly similar Cas orthologs.

Decision letter

Editor: Jeremy J Day1
Reviewed by: Konstantin Severinov

Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "Closely related type II-C Cas9 orthologs recognize diverse PAMs" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Kevin Struhl as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Konstantin Severinov (Reviewer #3).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1) As suggested in individual reviewer critiques (provided below), please provide clarification on the editing efficiency of the II-C Cas9s described here. If possible, a comparison to a commonly used standard (e.g,. SpCas9) would be a worthwhile addition.

2) Please revise the manuscript introduction and Discussion sections as outlined by individual critiques to include additional relevant background information and provide important caveats or points of clarification.

3) Please include sequences for the various constructs used here, and address other comments specified in individual reviewer critiques.

Reviewer #1 (Recommendations for the authors):

Figure 2 and supplement: The main Figure 2 and figure supplement 1 are almost identical. There are some subtle differences in the logos, but it's not clear to me why both figures are included and why there are differences. It seems like maybe they are shifted over in some cases, and it would be helpful to decide if we really need both images and precisely clarify the difference if both remain.

Line 46: it is not a problem for analyzed orthologs to be "phylogenetically distinct".

Line 46: "The existing evidence... " has no citation. The evidence or logic behind this claim is not clear to the reader.

Line 99,132 (and throughout): Use a prime symbol, not an apostrophe.

Line 198: This title indicates that Nsp2-SmuCas9 is being assessed for specificity and instead this section is initially about Nme2Cas9. The title is confusing in light of the writing in the section.

Line 222: It is not clear why they remain to be improved. They seem like they work to a large extent. Ending with this sentence detracts from the excitement and positive outcomes in the work. Further, it probably belongs in the discussion.

Reviewer #2 (Recommendations for the authors):

I have the following points for the authors to address:

1. Overall, the editing efficiency of II-C Cas9s were in the 10-30% range. Was it due to the assay setup, or did it reflect the intrinsic property of II-C Cas9s? Have the authors made a side-by-side comparison with SpCas9 under the same assay conditions?

2. While Nsp2Cas9 chimera displayed an impressively degenerate PAM specificity, its fidelity was not as impressive as the benchmark (Nme2Cas9). Have the authors made any effort to generate Nme2Cas9-Smu? Expanding the PAM code of an existing hi-fi Cas9 is still quite significant.

Reviewer #3 (Recommendations for the authors):

1. In the Method section "PAM sequence analysis" information about median coverage of every individual PAM variant shall be provided. How many unique PAM sequences were used to build PAM logo to support the obtained results?

2. Perhaps low DNA cleavage activity of some proteins is due to low level of their production. Was the synthesis of each of the Cas9 orthologs tested by Western Blot prior to PAM screening in human cells?

3. Figure 3—figure supplement 3A shows that Cas9 proteins contained four NLS signals. It is not clear if these are different signal and why so many NLS were used. I would recommend to include maps of all plasmids used in the study through Benchling or other tools.

4. The authors use 22nt spacer segment sgRNA in their work. The choice of this length can be confusing for people who work with SpCas9. I would recommend to emphasize the importance the sgRNAs of this length with the enzymes studied.

5. I would recommend to extend the Introduction section and add information on other II-C Cas9 orthologs characterized to date.

eLife. 2022 Aug 12;11:e77825. doi: 10.7554/eLife.77825.sa2

Author response

Essential revisions:

1) As suggested in individual reviewer critiques (provided below), please provide clarification on the editing efficiency of the II-C Cas9s described here. If possible, a comparison to a commonly used standard (e.g,. SpCas9) would be a worthwhile addition.

We sincerely thank the editor for the constructive comments on our manuscript. Following editor’s suggestions, we compared the editing efficiency of Nsp2Cas9, Nsp2-SmuCas9, SpCas9, SpCas9-NG, and SpCas9-RY side-by-side. Overall, the editing efficiency was low this time probably due to low transfection efficiency. The results revealed that SpCas9 was the most active enzyme. Nsp2Cas9, SpCas9-NG, and SpCas9-RY displayed similar activity. Nsp2-SmuCas9 displayed lower activities than other Cas9 variants (Figure 5C).

2) Please revise the manuscript introduction and Discussion sections as outlined by individual critiques to include additional relevant background information and provide important caveats or points of clarification.

We have added the additional relevant background information and provide important caveats or points of clarification in the “introduction” and “discussion” sections and highlighted in yellow according the views of the reviewers.

3) Please include sequences for the various constructs used here, and address other comments specified in individual reviewer critiques.

The sequences for the various constructs used here are listed in Supplementary file 1. The maps of all plasmids used in the study are packaged in Figure 1-source data 1. We have attached a point-to-point response to each of the reviewers’ comments and hope that the revised manuscript is now suitable for publication in eLife.

Reviewer #1 (Recommendations for the authors):

Figure 2 and supplement: The main Figure 2 and figure supplement 1 are almost identical. There are some subtle differences in the logos, but it's not clear to me why both figures are included and why there are differences. It seems like maybe they are shifted over in some cases, and it would be helpful to decide if we really need both images and precisely clarify the difference if both remain.

Thank you for your suggestions. For the sake of simplicity, we deleted Figure 2—figure supplement 1 in the revised manuscript.

Line 46: it is not a problem for analyzed orthologs to be "phylogenetically distinct".

Thank you for your suggestions. In the revised manuscript, we deleted this sentence.

Line 46: "The existing evidence... " has no citation. The evidence or logic behind this claim is not clear to the reader.

Thank you for your suggestions. In the revised manuscript, we stated “Several studies have revealed that even phylogenetically closely related Cas9 orthologs may recognize distinct PAMs”. The citation has been added.

Line 99,132 (and throughout): Use a prime symbol, not an apostrophe.

The prime symbol has been used in the revised manuscript.

Line 198: This title indicates that Nsp2-SmuCas9 is being assessed for specificity and instead this section is initially about Nme2Cas9. The title is confusing in light of the writing in the section.

Thank you for your suggestions. In the revised manuscript, we stated “Analysis of Nsp2Cas9 specificity”.

Line 222: It is not clear why they remain to be improved. They seem like they work to a large extent. Ending with this sentence detracts from the excitement and positive outcomes in the work. Further, it probably belongs in the discussion.

Thank you for your suggestions. In the revised manuscript, we stated “Altogether, these results demonstrated that Nsp2Cas9 and Nsp2-SmuCas9 offered new platforms for genome editing.”.

Reviewer #2 (Recommendations for the authors):

I have the following points for the authors to address:

1. Overall, the editing efficiency of II-C Cas9s were in the 10-30% range. Was it due to the assay setup, or did it reflect the intrinsic property of II-C Cas9s? Have the authors made a side-by-side comparison with SpCas9 under the same assay conditions?

We sincerely thank the reviewer for the constructive comments on our manuscript. Following reviewer’s suggestions, we compared the editing efficiency of Nsp2Cas9, Nsp2-SmuCas9, SpCas9, SpCas9-NG, and SpCas9-RY side-by-side. Overall, the editing efficiencies were low this time probably due to low transfection efficiency. The results revealed that SpCas9 was the most active enzyme. Nsp2Cas9, SpCas9-NG, and SpCas9-RY displayed similar activity. Nsp2-SmuCas9 displayed lower activities than other Cas9 variants (Figure 5C).

Gong et al. have shown that DNA Unwinding by Cas9 is the rate-limiting step in target cleavage [5]. Ma et al. have shown that type II-C Cas9s display lower DNA unwinding activities [6]. These results indicate that II-C Cas9s generally display lower activity than II-A Cas9s. Consistently, our lab screened dozens of II-C Cas9s, but failed to identify a Cas9 with activity comparable to SpCas9. In contrast, our lab screened dozens of II-A Cas9s and identified three Cas9s, including SlugCas9 [7], with activity comparable to SpCas9.

2. While Nsp2Cas9 chimera displayed an impressively degenerate PAM specificity, its fidelity was not as impressive as the benchmark (Nme2Cas9). Have the authors made any effort to generate Nme2Cas9-Smu? Expanding the PAM code of an existing hi-fi Cas9 is still quite significant.

Thank you for your suggestions. In the revised manuscript, we generated a chimeric Nme2-SmuCas9. However, Nme2-SmuCas9 activity was very low. Of 12 targets tested, only two targets could be edited (Figure 4—figure supplement 1). We further generated chimeric Nme2-NarCas9 and Nsp2-NarCas9, but they did not work. Chimeric Cas9s generally display reduced activity. We previously generated several SaCas9-based chimeras, but only Sa-SlugCas9 displayed robust activity [7].

Reviewer #3 (Recommendations for the authors):

1. In the Method section "PAM sequence analysis" information about median coverage of every individual PAM variant shall be provided. How many unique PAM sequences were used to build PAM logo to support the obtained results?

We sincerely thank the reviewer for the constructive comments on our manuscript. Following reviewer’s suggestions, we provided the sequences used for PAM analysis in Figure 2-Source Data 1. The number of unique PAM sequences varied from 518 to 2,193.

2. Perhaps low DNA cleavage activity of some proteins is due to low level of their production. Was the synthesis of each of the Cas9 orthologs tested by Western Blot prior to PAM screening in human cells?

Thank you for your suggestions. Following reviewer’s suggestions, we performed Western Blot to measure the expression of each Cas9 protein, and results revealed that expression levels of these Cas9s were comparable (Figure 1—figure supplement 5).

3. Figure 3—figure supplement 3A shows that Cas9 proteins contained four NLS signals. It is not clear if these are different signal and why so many NLS were used. I would recommend to include maps of all plasmids used in the study through Benchling or other tools.

Thank you for your suggestions. The Nme2Cas9_AAV vector [8] generated by Sontheimer group contains four NLS signals. More NLS signals may enhance the nuclear entry of the proteins and increase the editing activity. In this study, the Nme2Cas9_AAV backbone was used for our Cas9 expression. The maps of all plasmids used in the study are packaged in Figure 1-source data 1.

4. The authors use 22nt spacer segment sgRNA in their work. The choice of this length can be confusing for people who work with SpCas9. I would recommend to emphasize the importance the sgRNAs of this length with the enzymes studied.

Many thanks for the reviewer’s comments. The length of the sgRNA can influence editing efficiencies. Amrani et al. had tested the sgRNA length for Nme1Cas9, and observed comparable activities with 21-24 nt sgRNAs. In this study, we tested the sgRNA length from 18 to 26 nt in HEK293T cells, and the results showed that 22-26 nt sgRNA activities were comparable (Figure 3—figure supplement 1). We used 22 nt in our study.

5. I would recommend to extend the Introduction section and add information on other II-C Cas9 orthologs characterized to date.

Many thanks for the reviewer’s suggestions. Other II-C Cas9s have been added in the Introduction “Several type II-C Cas9s, including NmeCas9 [9], Nme2Cas9 [8], CjCas9 [10], GeoCas9 [11], BlatCas9 [12], and PpCas9 [13] have been developed for genome editing.

References

1. Kleinstiver BP, Prew MS, Tsai SQ, Nguyen NT, Topkar VV, Zheng Z, et al. Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nature biotechnology. 2015;33(12):1293-8. doi: 10.1038/nbt.3404. PubMed PMID: 26524662; PubMed Central PMCID: PMC4689141.

2. Walton RT, Christie KA, Whittaker MN, Kleinstiver BP. Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants. Science. 2020;368(6488):290-6. Epub 2020/03/29. doi: 10.1126/science.aba8853. PubMed PMID: 32217751; PubMed Central PMCID: PMCPMC7297043.

3. Ran FA, Cong L, Yan WX, Scott DA, Gootenberg JS, Kriz AJ, et al. in vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015;520(7546):186-91. doi: 10.1038/nature14299. PubMed PMID: 25830891; PubMed Central PMCID: PMC4393360.

4. Wang S, Mao HL, Hou LH, Hu ZY, Wang Y, Qi T, et al. Compact SchCas9 Recognizes the Simple NNGR PAM. Adv Sci. 2021. doi: Artn 2104789

10.1002/Advs.202104789. PubMed PMID: WOS:000727233600001.

5. Gong S, Yu HH, Johnson KA, Taylor DW. DNA Unwinding Is the Primary Determinant of CRISPR-Cas9 Activity. Cell Rep. 2018;22(2):359-71. Epub 2018/01/11. doi: 10.1016/j.celrep.2017.12.041. PubMed PMID: 29320733.

6. Ma E, Harrington LB, O'Connell MR, Zhou K, Doudna JA. Single-Stranded DNA Cleavage by Divergent CRISPR-Cas9 Enzymes. Mol Cell. 2015;60(3):398-407. doi: 10.1016/j.molcel.2015.10.030. PubMed PMID: 26545076; PubMed Central PMCID: PMC4636735.

7. Hu Z, Zhang C, Wang S, Gao S, Wei J, Li M, et al. Discovery and engineering of small SlugCas9 with broad targeting range and high specificity and activity. Nucleic Acids Res. 2021;49(7):4008-19. doi: 10.1093/nar/gkab148. PubMed PMID: 33721016; PubMed Central PMCID: PMC8053104.

8. Edraki A, Mir A, Ibraheim R, Gainetdinov I, Yoon Y, Song CQ, et al. A Compact, High-Accuracy Cas9 with a Dinucleotide PAM for in vivo Genome Editing. Mol Cell. 2019;73(4):714-26 e4. doi: 10.1016/j.molcel.2018.12.003. PubMed PMID: 30581144; PubMed Central PMCID: PMC6386616.

9. Hou Z, Zhang Y, Propson NE, Howden SE, Chu LF, Sontheimer EJ, et al. Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proceedings of the National Academy of Sciences of the United States of America. 2013;110(39):15644-9. doi: 10.1073/pnas.1313587110. PubMed PMID: 23940360; PubMed Central PMCID: PMC3785731.

10. Kim E, Koo T, Park SW, Kim D, Kim K, Cho HY, et al. in vivo genome editing with a small Cas9 orthologue derived from Campylobacter jejuni. Nature communications. 2017;8:14500. doi: 10.1038/ncomms14500. PubMed PMID: 28220790; PubMed Central PMCID: PMC5473640.

11. Harrington LB, Paez-Espino D, Staahl BT, Chen JS, Ma E, Kyrpides NC, et al. A thermostable Cas9 with increased lifetime in human plasma. Nature communications. 2017;8(1):1424. Epub 2017/11/12. doi: 10.1038/s41467-017-01408-4. PubMed PMID: 29127284; PubMed Central PMCID: PMCPMC5681539.

12. Gao N, Zhang C, Hu Z, Li M, Wei J, Wang Y, et al. Characterization of Brevibacillus laterosporus Cas9 (BlatCas9) for Mammalian Genome Editing. Frontiers in cell and developmental biology. 2020;8:583164. doi: 10.3389/fcell.2020.583164. PubMed PMID: 33195228; PubMed Central PMCID: PMC7604293.

13. Fedorova I, Vasileva A, Selkova P, Abramova M, Arseniev A, Pobegalov G, et al. PpCas9 from Pasteurella pneumotropica – a compact Type II-C Cas9 ortholog active in human cells. Nucleic Acids Res. 2020;48(21):12297-309. Epub 2020/11/06. doi: 10.1093/nar/gkaa998. PubMed PMID: 33152077; PubMed Central PMCID: PMCPMC7708072.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—source data 1. The maps of all plasmids used in the study for Figure 1.
    elife-77825-fig1-data1.zip (86.4MB, zip)
    Figure 1—figure supplement 5—source data 1. Source data for Figure 1—figure supplement 5.
    elife-77825-fig1-figsupp5-data1.zip (9.6MB, zip)
    Figure 2—source data 1. The number of unique PAM sequences and the median coverage of every individual PAM variant for the Figure 2B and C.
    elife-77825-fig2-data1.xlsx (2.4MB, xlsx)
    Figure 3—source data 1. Source data for Figure 3C and D.
    elife-77825-fig3-data1.xlsx (12.3KB, xlsx)
    Figure 3—source data 2. Source data for Figure 2B.
    elife-77825-fig3-data2.zip (23.3MB, zip)
    Figure 3—figure supplement 1—source data 1. Source data for Figure 3—figure supplement 1.
    elife-77825-fig3-figsupp1-data1.xlsx (11.7KB, xlsx)
    Figure 3—figure supplement 2—source data 1. Source data for Figure 3—figure supplement 2A-D.
    elife-77825-fig3-figsupp2-data1.xlsx (15.1KB, xlsx)
    Figure 3—figure supplement 3—source data 1. Source data for Figure 3—figure supplement 3B.
    elife-77825-fig3-figsupp3-data1.xlsx (10.1KB, xlsx)
    Figure 3—figure supplement 4—source data 1. Source data for Figure 3—figure supplement 4B.
    elife-77825-fig3-figsupp4-data1.xlsx (10.6KB, xlsx)
    Figure 3—figure supplement 4—source data 2. Source data for Figure 3—figure supplement 4C.
    elife-77825-fig3-figsupp4-data2.xlsx (10.4KB, xlsx)
    Figure 4—source data 1. Source data for Figure 4D and E.
    elife-77825-fig4-data1.xlsx (11.5KB, xlsx)
    Figure 4—figure supplement 1—source data 1. Source data for Figure 4—figure supplement 1D.
    elife-77825-fig4-figsupp1-data1.xlsx (10.8KB, xlsx)
    Figure 5—source data 1. Source data for Figure 5B.
    elife-77825-fig5-data1.zip (2.9MB, zip)
    Figure 5—source data 2. Source data for the Figure 5C and D.
    elife-77825-fig5-data2.xlsx (14.2KB, xlsx)
    Figure 6—source data 1. Source data for the Figure 6A.
    elife-77825-fig6-data1.xlsx (11.8KB, xlsx)
    Figure 7—source data 1. Source data for the Figure 7A.
    elife-77825-fig7-data1.xlsx (10.8KB, xlsx)
    Supplementary file 1. The Cas9 ID and human codon–optimized Cas9 gene.

    The file contains the Cas9 ID, tracrRNA, and amino acid sequences of Nme1Cas9 orthologs used in this study. The human codon-optimized Cas9 genes were synthesized. The primers used for the chimera’s construction were also listed in this file.

    elife-77825-supp1.xlsx (63.3KB, xlsx)
    Supplementary file 2. The single-guide RNA sequence.

    The single-guide RNA sequence for Nme1Cas9 orthologs and chimeras used in this study.

    elife-77825-supp2.xlsx (11.4KB, xlsx)
    Supplementary file 3. Primers used in this study.

    A list of oligonucleotide pairs and primers used for deep sequencing.

    elife-77825-supp3.xlsx (21KB, xlsx)
    Supplementary file 4. Target sites used in this study.

    A list of the endogenous target sites of human and mouse and their downstream PAM. PAM, protospacer adjacent motif.

    elife-77825-supp4.xlsx (135.9KB, xlsx)
    Supplementary file 5. Underlying values for all reported summary statistics.

    Raw data from all reported summary statistics.

    elife-77825-supp5.xlsx (48.9KB, xlsx)
    Transparent reporting form
    elife-77825-transrepform1.docx (247.7KB, docx)

    Data Availability Statement

    All data generated or analysed during this study are included in the manuscript and supporting file.

    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES