Antagonistic activity of Aspergillus versicolor against Macrophomina phaseolina

Abstract

The present study was carried out to evaluate the antagonistic efficacy of Aspergillus versicolor against the soil and seed inhibiting destructive plant pathogen Macrophomina phaseolina. The tested antagonist was confirmed by rDNA sequencing of ITS and β-tubulin genes with respective accession numbers MN719083 and MN736397. In dual culture bioassays, A. versicolor showed potent antagonist activity and reduced the pathogen’s growth by 60% over control. To understand the mechanism of antagonistic fungus, DNA of the pathogenic fungus was incubated in secondary metabolites produced by the A. versicolor for 24 and 48 h. After 48 h, metabolites of A. versicolor fully degraded the DNA of M. phaseolina. Moreover, for the identification of bioactive compounds, the chloroform and ethyl acetate fractions of A. versicolor culture filtrates were subjected to GC–MS analysis. A total of 10 compounds were identified in each of the two fractions. Among these, chondrillasterol (37.43%) followed by 1,2-benzedicarboxylic acid, diisooctyl ester (25.93%), decane (16.63%), 9,12-octadecadienoic acid (Z,Z)- (13.32%), stigmasterol (11.16%), undecane (10.93%), cis-1-chloro-9-octadecene (8.66%), benzene, 1,3,5-trimethyl (8.46%), and hexadecanoic acid, 2-hydroxy-1-(hydroxymethyl) ethyl ester (8.13%) were the major compounds. Some of the identified compounds are known to possess strong antifungal, antibacterial, nematicidal, and antioxidant properties. The present study concludes that A. versicolor is an effective antagonist against M. phaseolina.

Introduction

Macrophomina phaseolina is a devastating fungal pathogen responsible for charcoal rot, stem canker, damping off, stem rot, and seedling blight diseases in more than 500 host plants [1]. Being seed- and soil-borne in nature, it incited in the soil for up to 15 years that is among the major hindrances in the management of this pathogen. Diverse strategies like physical and cultural methods are in practice to combat this detrimental pathogen [2]. However, these measures are effective only at initial stages. If the pathogen establishes in the soil, its eradication becomes impossible due to the massive production of sclerotia in soil [3]. Chemical control is a magnificent option, which is in practice from many decades for effective control of plant pathogens. However, the excessive use of synthetic agrochemicals is toxic to humans and animals as it triggers out major health issues by polluting the environment [4]. In the recent century, the increasing demand of organic food products has encouraged the researchers and farmers to move form synthetic to biocontrol agents [5–7].

Antagonistic microorganisms have been considered a good alternate approach to minimize the use of synthetic fungicides [8]. Several antagonistic fungi such as Aspergillus, Penicillium, and Trichoderma species have been proved effective against the soil-borne fungal pathogens [9, 10]. Among them, the genus Trichoderma is comprising a large number of fungal species that are the most studied biocontrol agents [11]. On the other hand, a very few scientists worked on the antagonistic behavior of the Aspergillus species as emerging biocontrol agents [12]. However, recently species of this genus are gaining much attention worldwide as successful antagonists and potential alternate to the hazardous chemicals. The antagonistic behavior of Aspergillus spp. is based on multiple mechanisms either directly or indirectly by mycoparasitism, antibiosis, competition for space and nutrients [13].

Generally, Aspergillus spp. produce various beneficial compounds such as cyclosporine A, asperfuranone, terrrein, itaconic acid, kojic acid, citric acid, and gluconic acid [14–16]. They also have important antifungal, antibacterial, and phytotoxic activities, which play a crucial role to antagonize the devastating phytopathogens [17]. Control of several soil-borne fungal pathogens by using Aspergillus terreus, A. awamori, A. sydowii, A. sulphureus, A. candidus, A. niger, and A. flavipes have been reported by many investigators [18–21]. Yet, there is a little information available on the use of Aspergillus versicolor as biocontrol agent against M. phaseolina. Therefore, the present study was undertaken to investigate biocontrol potential of A. versicolor against M. phaseolina and identification of the possible antifungal compounds in metabolites of A. versicolor through GC–MS analysis.

Materials and methods

Molecular characterization of selected isolates

Aspergillus versicolor (FCBP-PTF 1204) was obtained from the Fungal Culture Bank of Pakistan (FCBP), and its molecular characterization was performed by using CTAB method with two sets of primer pairs viz. internal transcribed spacer (ITS) and beta-tubulin as shown in Table 1 [22]. The amplified PCR product (Fig. 1) was got sequenced from 1^st Base Sequencing Singapore Co., Ltd., and the data were subjected to BLAST and submitted to GenBank to get accession numbers.

Table 1.

List of oligonucleotide primers used for the characterization of Aspergillus versicolor at molecular level

No	Primer name	5´ to 3´ sequence	Annealing temperature
1	ITS 1 forward	TCCGTAGGTGAACCTGCGG	60 °C
2	ITS 4 reverse	TCCTCCGCTTATTGATATGC
3	β-tubulin forward	GGTAACCAAATCGGTGCTGCTTTC	62 °C
4	β-tubulin reverse	ACCCTCAGTGTAGTGACCCTTGGC

Fig. 1.

Aspergillus versicolor. (M) 1 kb DNA standard marker, (1) genomic DNA, (2) ITS1/ITS4 amplified PCR product, (3) Bt_2a/Bt_2b amplified PCR product

In vitro antagonistic activity of A. versicolor

Antagonistic activity of A. versicolor against M. phaseolina was tested in dual cultures on malt extract agar (MEA). Mycelial plug of 5 mm diameter of the tested pathogen was cut from a 7-day-old colony and placed on MEA plate in line with the A. versicolor at opposite side in the plate. Control treatment was maintained without antagonist fungus with five replicates of each and incubated at 28 °C for 5 days. After that, the diameter of M. phaseolina was measured both in control and dual culture treatments. Percentage reduction in colony diameter of M. phaseolina due to A. versicolor was calculated by using the following formula [23].

$$\mathrm{Inhibition}\left(\%\right)=\frac{\mathrm{Colony}\mathrm{diameter}\mathrm{in}\mathrm{control}-\mathrm{Colony}\mathrm{diameter}\mathrm{in}\mathrm{dual}\mathrm{culture}}{\mathrm{Colony}\mathrm{diameter}\mathrm{in}\mathrm{control}}\mathrm{x}100$$

DNA cleavage bioassay

A DNA cleavage experiment was performed following the procedure of Khan and Javaid [10] to understand the mechanism of antifungal activity of secondary metabolites produced by A. versicolor against M. phaseolina. For the preparation of metabolites of A. versicolor, mycelial plugs of the fungus were placed in autoclaved malt extract broth and incubated for 3 weeks at room temperature. Thereafter, materials were filtered through Whatman No. 1 filter papers. The concentration of the original fungal metabolites was designated as X. Higher concentrations viz. 2X, 3X, 4X, and 5X were prepared by evaporating the metabolites at 40 °C.

The ribosomal DNA of M. phaseolina (5 µl) was isolated by using CTAB method. The isolated DNA was mixed with 5 µl of each of five concentration viz. X, 2X, 3X, 4X and 5X, and incubated at 37 °C for 24 h and 48 h. Next, 1% agarose gel was prepared and DNA samples from different treatments, also including a negative control treatment, were loaded simultaneously and run for 45 min at 100 V. The extent of DNA cleavage was observed under UV illuminator.

GC–MS analysis

To determine the antifungal compounds in A. versicolor culture filtrate, the filtrates were filtered by Whatman No. 1 filter paper and concentrated by evaporating about 80% water at 40 °C. The concentrated metabolites (50 ml) were successively partitioned with 50 ml chloroform and 50 ml ethyl acetate. Both the organic solvent fractions were subjected to GC–MS analysis. GC–MS analysis was carried out on a Shimadzu GC-2010plus system coupled with an auto sampler AOC-20 s, an auto injector AOC-20i, and a gas chromatograph. Helium was used as a carrier gas. A volume of 1.0 µl of each of chloroform and ethyl acetate fractions was injected. The interface temperature was adjusted at 320 °C. After sample injection, the initial temperature of the column was adjusted at 100 °C for 60 s that was raised to 200 °C at 20 °C min⁻¹ and maintained for 2.0 min, and finally raised to 300 °C at 40 °C min⁻¹. The total run time was 11 min [24].

Results

Molecular identification of A. versicolor

Identification of the antagonistic fungus was confirmed by the amplification and subsequent sequencing of the rDNA with ITS and β-tubulin regions. The ITS and β-tubulin sequences of 547 and 469 bp were deposited to NCBI under the accession nos. MN719083 and MN736397, respectively. The ITS sequence showed 100% similarities with the already submitted sequences KU702727 and JF911763. Likewise, β-tubulin sequence showed 99.33% similarity with KU897001 and KX455751 (Fig. 2).

Fig. 2.

A ITS. B β-Tubulin gene sequences of the isolate from this study was aligned with reference sequences of A. versicolor isolates from GenBank using Clustal W

© program. The phylogenetic tree was constructed using the neighbor-joining method in MEGA x version 10.1

Interactions of A. versicolor with M. phaseolina

In the present study, A. versicolor showed pronounced antagonistic behavior against M. phaseolina. It was observed that the tested fungus arrested the pathogen growth up to 60% in dual culture over control (Fig. 3).

Fig. 3.

Interaction of Macrophomina phaseolina with Aspergillus versicolor. A Pure culture of Macrophomina phaseolina (MP). B MP co-culture with A. versicolor

DNA cleavage study

M. phaseolina DNA interaction with five different concentrations of A. versicolor secondary metabolites is illustrated in Fig. 4. It was observed that the DNA cleavage was weaker when treated with lower concentrations of antagonist after 24 h. However, after 48 h, it was noted that the DNA structure was completely degraded even at lower concentrations of A. versicolor metabolites.

Fig. 4.

DNA cleavage. A After 24 h. B After 48 h. (M) 1 kb DNA standard marker; (1) genomic DNA of M. phaseolina (5 µl); (2) negative control (Genomic DNA of M. phaseolina 5 µl + malt extract broth 5 µl); (3) genomic DNA of M. phaseolina 5 µl + A. versicolor metabolites of X concentration 5 µl); (4) genomic DNA of M. phaseolina 5 µl + A. versicolor metabolites of 2X concentration 5 µl; (5) genomic DNA of M. phaseolina 5 µl + A. versicolor metabolites of 3X concentration 5 µl; (6) genomic DNA of M. phaseolina 5 µl + A. versicolor metabolites of 4X concentration 5 µl; (7) genomic DNA of M. phaseolina 5 µl + A. versicolor metabolites of 5X concentration 5 µl. Arrows indicate the presence or absence of DNA

GC–MS analysis

GC–MS chromatograms of both chloroform and ethyl acetate fractions are shown in Fig. 5, which indicate the presence of 10 major and minor bio-active constituents in each fraction belonging to diverse classes of natural compounds. Details of chloroform fraction compounds are given in Table 2 and the structures of antimicrobial compounds are presented in Fig. 5. The major prevailing compounds were 1,2-benzedicarboxylic acid, diisooctyl ester (25.93%) followed by decane (16.63%), undecane (10.93%), cis-1-chloro-9-octadecene (8.66%), benzene, 1,3,5-trimethyl (8.46%), 9,12-octadecadienoic acid (Z,Z)- (8.36%), benzene, 1,2,3-trimethyl (7.55%), and benzene,1,4-diethyl (7.05%). The compounds present in lesser concentrations were heptane,3,3,5-trimethyl (3.74%) and octadecanoic acid, 9,10-dihydroxy-, methyl ester (2.69%).

Fig. 5.

GC–MS chromatograms of chloroform and ethyl acetate fractions of culture filtrate of Aspergillus versicolor

Table 2.

Compounds identified from chloroform fraction of culture filtrate of Aspergillus versicolor through GC–MS analysis

Sr. no	Names of compounds	Molecular formula	Molecular weight	Retention time (min)	Peak area (%)
1	Decane	C10H22	142	2.374	16.63
2	Benzene, 1,2,3-trimethyl	C9H12	120	2.424	7.55
3	Heptane,3,3,5-trimethyl	C10H22	142	2.467	3.74
4	Benzene, 1,3,5-trimethyl	C9H12	120	2.542	8.46
5	Benzene,1,4-diethyl	C10H14	134	2.666	7.05
6	Undecane	C11H24	156	2.800	10.93
7	9,12-Octadecadienoic acid (Z,Z)-	C18H32O2	280	7.787	8.36
8	cis-1-Chloro-9-octadecene	C18H35Cl	286	8.010	8.66
9	Octadecanoic acid,9,10-dihydroxy-,methyl ester	C19H38O4	330	9.415	2.69
10	1,2-Benzedicarboxylic acid, diisooctyl ester	C24H38O4	390	9.745	25.93

GC–MS analysis of ethyl acetate fraction exhibited the occurrence of major and minor compounds given in Table 3, and among these, structures of antimicrobial compound are shown in Fig. 6. The most abundant compound was chondrillasterol (37.43%) followed by 9,12-octadecadienoic acid (Z,Z)- (13.32%), stigmasterol (11.16%), 1,2-benzedicarboxylic acid, diisooctyl ester (10.82%), hexadecanoic acid,2-hydroxy-1-(hydroxymethyl) ethyl ester (8.13%) and benzene, nitro- (7.82%). Less abundant compounds included 1-( +)-ascorbic acid 2,6-dihexadecanoate (3.92%), undecane (2.59%), naphthalene (2.64%), and cis-9-hexadecenal (2.17%.).

Table 3.

Compounds identified from ethyl acetate fraction of culture filtrate of Aspergillus versicolor through GC–MS analysis

Sr. no	Names of compounds	Molecular formula	Molecular weight	Retention time (min)	Peak area (%)
1	Undecane	C11H24	156	2.799	2.59
2	Benzene, nitro-	C6H5NO2	123	2.858	7.82
3	Naphthalene	C10H8	128	3.395	2.64
4	1-( +)-Ascorbic acid 2,6-dihexadecanoate	C38H68O8	652	7.068	3.92
5	Stigmasterol	C29H48O	412	7.650	11.16
6	9,12-Octadecadienoic acid (z,z)-	C18H32O2	280	7.795	13.32
7	cis-9-Hexadecenal	C16H30O	238	8.622	2.17
8	Chondrillasterol	C29H48O	412	9.357	37.43
9	Hexadecanoic acid,2-hydroxy-1-(hydroxymethyl) ethyl ester	C19H38O4	330	9.630	8.13
10	1,2-Benzedicarboxylic acid, diisooctyl ester	C24H38O4	390	9.751	10.82

Fig. 6.

Structures of antimicrobial compounds identified in chloroform and ethyl acetate fraction of culture filtrate of Aspergillus versicolor

Discussion

Biological control refers to the search of novel products isolated from antagonistic fungi that are capable of exploiting natural compounds for the protection of plants against soil-borne fungal pathogens [25]. Aspergillus species are one of the ideal examples known to possess remarkable antifungal activity by producing extracellular enzymes such as amylases, cellulases, lipases, proteases and xylanases, which decompose the pathogenic fungal cell walls [26]. Dextrose-based formulation of Aspergillus niger at 10 g kg⁻¹ seed treatment controlled Fusarium wilt disease of brinjal up to 70.96% under field conditions [27]. In accordance with the results of present work, many earlier in vitro studies also proved that A. versicolor is a strong antagonist that can effectively reduced the growth of other pathogenic fungi by adopting antibiosis or mycoparasitism [28]. Previously, it was reported that A. versicolor is a potent antagonist showing 100% control of potato powdery scab disease caused by a fungal pathogen Spongospora subterranea under field conditions [21]. Similarly, the efficacy of other Aspergillus species namely A. niger, A. flavus, A. oryzae, A. sydowii, and A. sulphureus was evaluated against brown spot leaf pathogen Bipolaris oryzae with promising results [29]. Likewise, Sclerotium rolfsii the causal pathogen of stem rot of sunflower can be managed by Aspergillus terreus under in vivo environment [30]. Recently, the in vitro antifungal activity of Aspergillus fumigatus and A. flavus was tested against the tomato gray mold disease caused by Botrytis cinerea and found to be effective in halting the growth of pathogenic fungus [31]. Similarly, different Aspergillus spp. from soil, namely A. fumigatus, A. flavus, A. terreus, A. sydowii, A. versicolor, and A. niger, were tested against the wilt pathogen Fusarium oxysporum and all the species successfully inhibited growth of the pathogen [32]. Moreover, Sclerotinia sclerotiorum can effectively be managed by using Aspergillus flavipes isolated from a medicinal plant Stevia rebaudiana [33]. In the present study, A. versicolor showed very rapid growth as compared to the growth of M. phaseolina. It shows that in addition to any other possible mechanism of antagonism, the biocontrol agent controlled growth of the pathogenic fungus through competition for space and nutrients.

DNA of the M. phaseolina was incubated in different concentrations of metabolites of A. versicolor. Earlier Dashamiri et al. [34] performed similar study by using the extract of Euphorbia prostrata against the DNA of Escherichia coli. The results revealed that the extracts alone and in combination of nanoparticles were very effective against the DNA cleavage of selected pathogenic bacterial strain. Likewise, concentrated metabolites of Trichoderma pseudokoningii disintegrated the DNA of M. phaseolina when incubated for 48 h [35]. Similarly, in two recent studies, metabolites of Aspergillus flavipes and Penicillium italicum completely disintegrated the isolated DNA of M. phaseolina [10].

The present investigation was also aimed to identify the potential natural fungicidal compounds present in chloroform and ethyl acetate fractions of culture filtrates of A. versicolor through GC–MS analysis. Among the identified phytochemicals, 1,2-benzedicarboxylic acid, diisooctyl ester was previously isolated from a medicinal plant Gloriosa superba suggested to be a plasticizer and it may be employed as an antimicrobial agent [36]. Similarly, undecane was earlier reported from the cones of Pinus koraiensis and is known to possess strong antibacterial activities against pathogenic bacteria and many of the fungal strains such as Cryptococcus neoformans, A. niger, and Candida glabrata [37]. Likewise, 9,12-octadecadienoic acid (Z,Z)- was isolated from Mantidis ootheca which was found to be effective against Pseudomonas aeruginosa [38]. Antifungal and antibacterial efficacy of benzene, 1,2,3-trimethyl was reported against Candida albicans, Escherichia coli and Pseudomonas aeruginosa [39]. Naphthalene was isolated from ginger and inhibited the growth of bacterial pathogens namely Proteus mirabilis, P. aeroginosa, and Klebsiella pneumoniae [40]. Similarly, stigmasterol isolated from Flueggea leucopyrus exhibited strong antimicrobial activity against a wide range of pathogens [41]. Likewise, cis-9-hexadecenal isolated from Ceropegia bulbosa found to have antimicrobial activity [42]. 9,12-Octadecadienoic acid (Z,Z)- was previously identified in stem extract of Cenchrus biflorus, which showed strong antibacterial activity [43]. This compound has also been reported from Mantidis ootheca with antibacterial activity against the gentamycin resistant bacterium P. aeruginosa [38]. Similarly, the most abundant compound hexadecanoic acid,2-hydroxy-1-(hydroxymethyl) ethyl ester was previously isolated from the leaves of Coriandrum sativum, which was found to effective against fungal pathogens namely Aspergillus niger and Aspergillus flavus as shown in Table 4 [44]. The present study concludes that A. versicolor is a potential biocontrol agent against a highly destructive fungal pathogen M. phaseolina. Its biocontrol efficacy may be attributed to its ability to produce several antifungal compounds. This study very clearly shows that the metabolites of A. versicolor have the ability to degrade DNA of M. phaseolina. However, further studies are required to investigate the mechanisms involved in this DNA disintegration.

Table 4.

Potential antimicrobial constituents in chloroform and ethyl acetate fractions of Aspergillus versicolor

Compound no	Names of compounds	Property	Reference
1	Decane	Antifungal, Antibacterial	[45, 46]
2	Undecane	Antifungal, Antibacterial	[37, 47]
3	Naphthalene	Antibacterial	[40]
4	Stigmasterol	Antimicrobial	[41]
5	Cis-9-hexadecenal	Antimicrobial	[42]
6	9,12-Octadecadienoic acid (Z,Z)-	Antimicrobial, Nematicide	[38, 43]
7	Benzene, 1,2,3-trimethyl	Antifungal, Antibacterial	[39]
8	1-( +)-Ascorbic acid 2,6-dihexadecanoate	Antioxidant	[48]
9	Hexadecanoic acid,2-hydroxy-1-(hydroxymethyl) ethyl ester	Pesticidal, Antioxidant, Antifungal	[44]
10	1,2-Benzedicarboxylic acid, diisooctyl ester	Antimicrobial, Antifouling	[36]

Author contribution

IHK conducted experiments and wrote the manuscript. AJ designed research, analyzed data statistically, and helped out in paper writing. Both authors read and approved the manuscript.

Data availability

All relevant data may be made freely available to readers.

Code availability

Not applicable.

Declarations

Ethics approval

Not applicable.

Conflict of interest

The authors declare no competing interests.

Consent to participate

Not applicable.

Consent for publication

Not applicable.