Feruloyl Esterase Activity of the Clostridium thermocellum Cellulosome Can Be Attributed to Previously Unknown Domains of XynY and XynZ

Abstract

The cellulosome of Clostridium thermocellum is a multiprotein complex with endo- and exocellulase, xylanase, β-glucanase, and acetyl xylan esterase activities. XynY and XynZ, components of the cellulosome, are composed of several domains including xylanase domains and domains of unknown function (UDs). Database searches revealed that the C- and N-terminal UDs of XynY and XynZ, respectively, have sequence homology with the sequence of a feruloyl esterase of strain PC-2 of the anaerobic fungus Orpinomyces. Purified cellulosomes from C. thermocellum were found to hydrolyze FAXX (O-{5-O-[(E)-feruloyl]-α-l-arabinofuranosyl}-(1→3)-O-β-d-xylopyranosyl-(1→4)-d-xylopyranose) and FAX₃ (5-O-[(E)-feruloyl]-[O-β-d-xylopyranosyl-(1→2)]-O-α-l-arabinofuranosyl-[1→3]}-O-β-d-xylopyranosyl-(1→4)-d-xylopyranose), yielding ferulic acid as a product, indicating that they have feruloyl esterase activity. Nucleotide sequences corresponding to the UDs of XynY and XynZ were cloned into Escherichia coli, and the expressed proteins hydrolyzed FAXX and FAX₃. The recombinant feruloyl esterase domain of XynZ alone (FAE_XynZ) and with the adjacent cellulose binding domain (FAE-CBD_XynZ) were characterized. FAE-CBD_XynZ had a molecular mass of 45 kDa that corresponded to the expected product of the 1,203-bp gene. K_m and V_max values for FAX₃ were 5 mM and 12.5 U/mg, respectively, at pH 6.0 and 60°C. PAX₃, a substrate similar to FAX₃ but with a p-coumaroyl group instead of a feruloyl moiety was hydrolyzed at a rate 10 times slower. The recombinant enzyme was active between pH 3 to 10 with an optimum between pH 4 to 7 and at temperatures up to 70°C. Treatment of Coastal Bermuda grass with the enzyme released mainly ferulic acid and a lower amount of p-coumaric acid. FAE_XynZ had similar properties. Removal of the 40 C-terminal amino acids, residues 247 to 286, of FAE_XynZ resulted in protein without activity. Feruloyl esterases are believed to aid in a release of lignin from hemicellulose and may be involved in lignin solubilization. The presence of feruloyl esterase in the C. thermocellum cellulosome together with its other hydrolytic activities demonstrates a powerful enzymatic potential of this organelle in plant cell wall decomposition.

Plant cell wall material composed mainly of cellulose, hemicelluloses, and lignin is one of the largest sources of renewable energy on earth. Arabinoxylan is one of the main hemicelluloses. Its backbone structure is a chain of β(1→4)-linked xylose moieties to which are attached side chains, including arabinose, acetate, and methyl-glucuronic acid (7, 40). The arabinose has ester-linked ferulic acid and p-coumaric acid. Ferulic acid links hemicellulose to lignin (39). Since feruloyl esterases hydrolyze the bond between the arabinose and ferulic acid, they may release the covalently bound lignin from hemicelluloses and aid in the degradation of plant cell walls. Feruloyl esterases have been found in bacteria and fungi (44).

The cellulosome first discovered in Clostridium thermocellum (2, 29) is a multiprotein complex with a molecular mass of about 3,000 kDa. Cellulosomes are produced by several anaerobic bacteria (4) and anaerobic fungi (17, 32). The core of the cellulosome is an enzymatically inactive cellulosome integrating polypeptide (CipA) functioning as a scaffold. CipA of C. thermocellum contains nine copies of a cohesin domain, a type II dockerin domain, and a cellulose binding domain (CBD). At present, 18 catalytic active subunits of the cellulosome have been sequenced. They have endoglucanase, cellobiohydrolase (exoglucanase), xylanase, chitinase, or β-glucanase (lichenase) activity (2). All enzymatically active subunits have multidomain structures that include at least a catalytic domain and a dockerin domain which binds to the cohesins of CipA. Other domains present in some of the catalytic subunits include CBDs, immunoglobulin-like domains, serine- and threonine- or proline-rich linkers, and domains of unknown functions (UDs). Examples of subunits having UDs are XynY (20) and XynZ (22) (see Fig. 2). Starting with the N terminus, XynY has xylanase (glycosyl hydrolase family 10), a domain characterized as a thermostability domain, a dockerin, and a UD. Also starting with the N terminus, XynZ has a UD, a proline-rich linker, a CBD (family VI), a dockerin, and xylanase (glycosyl hydrolase family 10).

FIG. 2.

Domain organization of XynY (20), XynZ (22), and constructs. FAE-CBD_XynZ, comprising 400 amino acid residues, is a truncated form of XynZ including the FAE domain and the CBD; FAE287_XynZ, comprising 287 amino acid residues, includes the FAE domain and a linker; FAE_XynZ, comprising 266 amino acid residues, is the FAE domain without a linker; and FAE227_XynZ, with 227 amino acid residues, is a truncated FAE domain.

In the present study, we show that UDs of XynY and XynZ have homology with a feruloyl esterase (FaeA) (D. L. Blum, X.-L. Li, H. Z. Chen, and L. G. Ljungdahl, Abstr. 99th Gen. Meet. Am. Soc. Microbiol. 1999, abstr. K-153, 1999) from the anaerobic fungus Orpinomyces PC-2 (GenBank accession no. AF164351) and that these domains exhibit feruloyl esterase activity. Consequently, XynY and XynZ are bifunctional enzymes with feruloyl esterase and xylanase activities. The presence of feruloyl esterase in the cellulosome of C. thermocellum points toward an additional ability of this organelle to hydrolyze plant tissue.

(A preliminary report of this work was given at the Mie Bioforum in 1998 [5]).

MATERIALS AND METHODS

Bacterial strains, vectors, and culture media.

C. thermocellum JW20 was cultivated in prereduced liquid medium (33) at 60°C under an atmosphere of nitrogen. For isolation of cellulosomes and to obtain subfractions of C. thermocellum, 0.2% Avicel (a microcrystalline cellulose [0.2%, wt/vol], 2- to 20-μm particle size; Baker TLC) and 0.5% (wt/vol) cellobiose were used, respectively, as carbon sources. Escherichia coli strain BL21(DE3) (Stratagene, La Jolla, Calif.) and plasmid pRSET B (Invitrogen, La Jolla, Calif.) were used as the host strain and the vector for protein expression, respectively. Initial work was done with pRSET B, with which we obtained satisfactory results, but these were improved considerably using pET-21b (Novagen, Madison, Wis.). The work described uses these plasmids. Recombinant E. coli cells were selected for by growing in Luria-Bertani medium containing 100 μg of ampicillin per ml.

Amplification and cloning of sequences coding for different domains of XynY and XynZ.

Genomic DNA was isolated from C. thermocellum as previously described (24). To clone fragments of DNA corresponding to the UDs of XynY and XynZ and deletions of the UD of XynZ, PCR primers were designed (Table 1) and synthesized on an Applied Biosystems DNA synthesizer (PE Biosystems, Foster City, Calif.). To facilitate the insertion of DNA sequence into pET-21b or pRSET B, BamHI and HindIII sites were added to forward and reverse primers, respectively (Table 1). PCRs were carried out on a Perkin-Elmer 480 Thermocycler (Norwalk, Conn.) for 30 cycles, with each cycle at 95°C for 1 min, 48°C for 1 min, and 72°C for 3 min. PCR products and the plasmid were digested with BamHI and HindIII, purified with a Geneclean Spin Kit (BIO 101, Inc., Vista, Calif.), and ligated with T4 ligase. E. coli BL21(DE3) was transformed with the ligation mixture, and at least four colonies of each construct were picked for analyzing feruloyl esterase expression. The inserted sequences were sequenced to verify the lack of unwanted mutations.

TABLE 1.

Primer designs amplifying various regions of xynY and xynZ of C. thermocellum

Name	Sequencea	Gene	Direction	Positionb
XYF1	TAGGATCCCCTGTAGCAGAAAATCCTTC	xynY	Forward	795–800
XYR1	GAGGAAGCTTTTACATGGAAGAAATATGGAAG	xynY	Reverse	1071–1077
XZF1	TAGGATCCCTTGTCACAATAAGCAGTACA	xynZ	Forward	20–26
XZR1	GAGGAAGCTTTTAGTTGTTGGCAACGCAATA	xynZ	Reverse	242–247
XZR2	GAGGAAGCTTAGTTTCCATCCCTCGTCAA	xynZ	Reverse	281–286
XZR3	GAGGAAGCTTAGTCATAATCTTCCGCTTC	xynZ	Reverse	302–307
XZR4	GAGGAAGCTTAAACGCCAAAAGTGAACCAGTC	xynZ	Reverse	414–421

^aRestriction sites BamHI and HindIII are underlined and double underlined, respectively. 

^bAmino acid positions correspond to xylanase sequences in the data banks. 

Isolation and analysis of cellulosomes and subfractions of C. thermocellum.

Cellulosomes produced by C. thermocellum were isolated from 10 liters of culture fluid after complete Avicel exhaustion by the affinity digestion method (38). They were further purified by gel filtration with a fast protein liquid chromatography system with a Superose 6 column (Pharmacia, Piscataway, N.J.). The buffer used was 50 mM Tris-HCl and 100 mM NaCl at a flow rate of 0.2 ml/min. Fractions of 0.5 ml each were collected and stored at 4°C for further analysis. To prepare subfractions, C. thermocellum was grown on 0.5% cellobiose in 200 ml of culture. Cells were recovered by centrifugation, resuspended in 50 mM Tris-HCl buffer (pH 7.5), and sonicated. The cultural medium was concentrated to 5 ml with a PM10 Diaflo ultrafiltration membrane (Amicon, Inc., Beverly, Mass.). To remove cellulosomes from the medium, 0.5 mg of Avicel was added and the suspension was stirred at 4°C for 4 h. Avicel with bound cellulosomes was recovered by centrifugation, and the cellulosomes were released from the Avicel by elution with distilled water (33). All fractions were tested for avicelase, xylanase, and feruloyl esterase activity.

Enzyme assays.

Unless otherwise noted, enzyme assays were performed at 60°C in 50 mM Na-citrate buffer, pH 6.0. One unit of enzyme activity was defined as the amount of enzyme that releases 1 μmol of product min⁻¹, and specific activity was given in units per milligram of protein. Protein was determined by the method of Bradford (9). Feruloyl esterase activity was measured using a modified version of the assay described by Borneman et al. (7). The appropriately diluted protein sample (25 μl) was added to 400 μl of buffer containing 8 mM substrate. Samples were incubated at 60°C for 5 min, and the reaction was stopped by adding 25 μl of 20% formic acid. Release of ferulic acid was measured via high-performance liquid chromatography (HPLC) using a mobile phase of 10 mM Na formate (pH 3) and 30% (vol/vol) methanol. For routine assays, FAXX and FAX₃ purified from wheat bran were used as substrates (7). Ethyl ferulate and ethyl-p-coumarate esters were gifts from D. E. Akin (U.S. Department of Agriculture, Athens, Ga.). The hydrolysis of these (10 mM) were determined similarly to that of FAXX, but the HPLC analyses were performed with 50% methanol. HPLC runs were done with a Hewlett-Packard 1100 Series instrument (Wilmington, Del.) equipped with an autosampler and diode array detector with a Hypersil octyldecyl silane (125 by 4 mm) column. Ferulic acid and p-coumaric acid were used as standards. To determine the amount of feruloyl and p-coumaroyl groups released from plant cell walls, wheat bran and Coastal Bermuda grass were ground in a Thomas Wiley mill (VWR Scientific Products, Atlanta, Ga.) to pass through a 250-μm screen. Plant samples of 10 mg each were incubated for 1 h in 400 μl of 50 mM Na-citrate buffer (pH 6.0) plus 25 μl of enzyme. After the addition of 25 μl of 20% formic acid to stop the reaction, the samples were centrifuged at 16,000 × g in a microcentrifuge and then assayed for ferulic and p-coumaric acid by HPLC.

Assays with p-nitrophenol substrates were performed in microtiter plate wells. Two hundred microliters of substrate at a concentration of 100 μM was preincubated in wells heated to 40°C. Enzyme (10 μl) was added to the reaction mixture, and the absorbance was followed continuously at a wavelength of 405 nm. p-Nitrophenol was used as a standard. Xylanase and cellulase activities were measured by determining the amount of reducing sugar released with dinitrosalicylate (37).

Enzyme purification.

Cultures of 1 liter of the recombinant E. coli containing pET-21b plus insert were grown in Luria broth containing 100 μg of ampicillin per ml until an optical density at 600 nm of 0.5 was reached and then grown an additional 4 to 6 h after induction with 1 mM isopropyl-β-d-thiogalactopyranoside, depending on the construct. Cells were harvested by centrifugation at 10,000 × g. They were resuspended at a concentration of 1 g per 3 ml of 50 mM Tris-HCl (pH 7.5) and lysed with a French press cell. Cell debris was removed by centrifugation at 100,000 × g. The cell extract was heat treated at 70°C for 30 min. Denatured protein was removed by centrifugation at 100,000 × g. The supernatant was concentrated to a volume of 2 ml with a Centricon 10 concentrator (Amicon, Inc., Beverly, Mass.) and then applied to a TSK 3000SW column (TosoHaas, Montgomeryville, Pa.), which was run with 50 mM Tris-HCl (pH 7.5) and 5% glycerol as solvent. The purified enzyme was stored at 4°C in the elution buffer and was stable for at least 1 month with minimal loss.

Enzyme stability experiments.

Purified enzyme at a concentration of 13 μg/ml in 50 mM Na-citrate (pH 6.0) was placed in a water bath at the appropriate temperature and incubated at intervals of 1 h. Enzyme aliquots (25 μl) were removed, and assays were performed in triplicate with FAX₃ as a substrate as described above. FAE-CBD_XynZ was tested at temperatures of 50, 60, and 70°C, while FAE_XynZ was tested at 70, 80, and 90°C.

Other analytical procedures.

Enzyme purity was monitored with sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels which were run by the method of Laemmli (28). Proteins were stained with Coomassie blue. The isoelectric point of the protein was determined by running the enzyme on a precast Serva IEF gel (Novex, San Diego, Calif.). The gel was run at 12 W of constant power for 45 min.

RESULTS

Demonstration of feruloyl esterase activity in the cellulosome.

The initial indication of the presence of feruloyl esterase in the cellulosome of C. thermocellum was obtained from data bank search and sequence analysis using the Genetics Computer Group package (University of Wisconsin Biotechnology Center, Madison) and the VAX/VMS system of the Bioscience Computing Resource of The University of Georgia, Athens). This search showed that the catalytic domain of Orpinomyces strain PC-2 FaeA was over 30% identical to sequences coding for the UD of XynY and the UD of XynZ. (Fig. 1).

FIG. 1.

Alignment of sequence homologous to Orpinomyces PC-2 FaeA. Sequences are FaeA_Orpin (accession no. AF164351) (5); XynZ_Clotm, xylanase Z from C. thermocellum (accession no. M22624) (22); XynY_Clotm, xylanase Y from C. thermocellum (accession no. P51584) (20); Xyn1_Rumin, xylanase 1 from a Ruminococcus sp. (accession no. S58235) (1); YIEL_Ecoli, gene encoding an unknown 44-kDa protein from E. coli (accession no. P31471) (10); and DPP_Aspfu, dipeptidyl peptidase from A. fumigatus (accession no. L48074) (3).

To confirm the presence of feruloyl esterase in C. thermocellum and to localize this activity, medium and cell extracts of C. thermocellum grown on cellobiose were obtained. As shown in Table 2, feruloyl esterase, avicelase (cellulase activity measured with Avicel as a substrate), and xylanase activities are mainly extracellular. To verify if feruloyl esterase activity is attributed to the cellulosomes, the latter were removed from the culture medium by adsorption onto Avicel. After removal of the cellulosomes, only 0.82% of feruloyl esterase, 9.8% of avicelase, and 16.9% of xylanase activities remained in the culture medium. Almost all of the feruloyl esterase (98.7%), avicelase (80.5%), and xylanase (73.3%) activities were recovered in the cellulosomal fraction released from the Avicel with distilled water (Table 2). Thus, the majority of feruloyl esterase activity seemed to belong to the cellulosome. Distribution of other activities between cellulosome and cultural medium treated with Avicel is in accordance with the presence of some noncellulosomal (free) cellulases and xylanases in the C. thermocellum culture medium. Finally, cellulosomes were obtained from cultures grown on Avicel. They were purified by the affinity digestion method (38) and gel filtration chromatography with a Superose 6 column (11). The cellulosomes with a mass over 2.0 million Da contained the majority of the feruloyl esterase activity. No activity was found in fractions with protein of a molecular mass less than 200 kDa. These data strongly suggest that feruloyl esterase activity resides in the cellulosome.

TABLE 2.

Distribution of proteins and hydrolytic activity in cells and culture medium of C. thermocellum grown on 0.5% cellobiose

Fraction	Protein		Feruloyl esterase		Avicelase		Xylanase
	mg	%	U	%	U	%	U	%
Cell extracta	0.81	39.7	0.005	2.1	0.001	2.4	0.49	5.3
Culture mediuma	1.23	60.3	0.238	97.9	0.04	97.6	8.72	94.7
Culture medium after Avicel treatment	0.98	48.0	0.002	0.8	0.004	9.8	1.56	16.9
Purified cellulosome	0.176	8.6	0.24	98.7	0.033	80.5	6.75	73.3

^aThe sum of the activity in the cell extract and cultural medium was considered to be 100%. 

Expression of the UDs of XynY and XynZ in E. coli.

Nucleotides corresponding to regions of DNA encoding amino acids in XynZ (accession no. M22624) from residues 20 to 421 and in XynY (accession no. X83269) from residues 795 to 1,077 were overexpressed in E. coli using the pET and pRSET systems, respectively. The XynZ sequence referred to as FAE-CBD_XynZ incorporates the family VI CBD (Fig. 2), while the XynY protein designated FAE_XynY contains only the catalytic domain (Fig. 2). The cell extracts containing the expressed proteins each hydrolyzed FAXX with release of ferulic acid, suggesting that these proteins are feruloyl esterases. E. coli cells lacking the plasmids or containing plasmids without C. thermocellum DNA inserts did not hydrolyze FAXX. The expressed FAE_XynY and FAE-CBD_XynZ had molecular masses of 31 and 45 kDa, respectively, consistent with the sequence data. Since these proteins had similar sequences and function and the XynZ protein had higher expression levels than the XynY protein (data not shown), we focused on the XynZ protein in subsequent experiments.

Deletion analysis of FAE-CBD_XynZ.

Constructs were made which corresponded to proteins with amino acids from the original XynZ sequence of residues 20 to 307 (FAE287_XynZ), 20 to 286 (FAE_XynZ) and 20 to 247 (FAE227_XynZ) (Fig. 2). FAE287_XynZ is missing the CBD but contains the proline-rich linker which separates the CBD from the feruloyl esterase domain, while FAE_XynZ does not contain this linker. When these constructs were expressed in E. coli in the same manner as FAE-CBD_XynZ, they both exhibited feruloyl esterase activity, whereas FAE227_XynZ was expressed but inactive. The data suggest that neither the CBD nor the linker is necessary for activity, but that C-terminal amino acids in the sequence from residues 247 to 286 of the FAE domain are necessary for activity.

Purification and characterization of the FAE-CBD_XynZ and FAE_XynZ.

The FAE-CBD_XynZ polypeptide was purified from E. coli cell extract by a single step of heat treatment at 70°C for 30 min. Over 200 mg of homogeneous FAE-CBD_XnyZ (Fig. 3) was obtained from 2.5 g of crude proteins (Table 3). There was no evidence for aggregation of the esterase produced in E. coli or the presence of inclusion bodies.

FIG. 3.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of FAE-CBD_XynZ overexpressed in E. coli. Lane M, low-range protein standards (Bio-Rad Laboratories, Richmond, Calif.), including phosphorylase B (97.4 kDa), serum albumin (66.2), ovalbumin (45 kDa), and carbonic anhydrase (31 kDa); lane 1, E. coli cell extract; lane 2, heat-treated cell extract (Table 3).

TABLE 3.

Purification of the recombinant FAE-CBD_XynZ and FAE_XynZ from E. coli

Fraction and procedure	Protein (mg)	Total activity (U)	Sp act (U/mg)	Yield (%)
FAE-CBDXynZ cell extract	2,597	3,250	1.3	100
Heat treatment	220	2,830	12.9	86
FAEXynZ cell extract	533	1,520	2.9	100
Heat treatment	213	1,630	7.7	107
Gel filtration	31	823	26.6	54

The purified protein had a V_max of 12.5 μmol of ferulic acid released min⁻¹ mg⁻¹ and a K_m of 5 mM with FAX₃ as substrate. The enzyme had the highest activity towards FAXX but was almost as active toward FAX₃ (Table 4). The protein was able to release low levels of ferulic acid from ethyl ferulic acid, ground wheat bran, and Coastal Bermuda grass, and p-coumaric acid from PAX₃ and ethyl-p-coumarate. The protein lacked activity toward carboxymethyl cellulose, Avicel, p-nitrophenyl (pNP)-arabinopyranoside, pNP-glucopyranoside, pNP-xylopyranoside, and pNP-acetate. Isoelectric focusing indicated a pI of 5.8.

TABLE 4.

Substrate specificity of recombinant feruloyl esterase FAE-CBD_XynZ

Substrate	U/mga
FAXX	12.5
FAX3	11.8
PAX3	1.4
Ethyl ferulate	0.066
Ethyl-p-coumarate	0.022
Wheat bran	0.06
Coastal Bermuda grass	0.1

^aThe number of units per milligram is the amount of ferulic or p-coumaric acid formed per minute per milligram of enzyme. See Materials and Methods for details. 

The FAE_XynZ was also expressed and purified to homogeneity. The purification is shown in Table 3. The protein was expressed in a manner similar to that of FAE-CBD_XynZ. In contrast to FAE-CBD_XynZ, FAE_XynZ obtained following heat treatment was not pure. An additional step involving gel filtration with a TSK 3000SW column resulted in a pure enzyme with a V_max of 28.2 U mg⁻¹ and a K_m of 10.5 mM with FAX₃ as substrate. FAE_XynZ was inhibited by ferulic acid but not by xylose or arabinose. The FAE_XynZ was most active between 50 and 60°C and had a high level of activity between pH 4 and 7. It and FAE-CBD_XynZ were stable at 70°C for 6 h. At 80°C, FAE_XynZ lost about 50% of the activity within 3 h and all activity after 1 h at 90°C. FAE-CBD_XynZ bound weakly to acid-swollen cellulose, while the other constructs missing the CBD did not bind to acid-swollen cellulose.

DISCUSSION

The cellulosome of C. thermocellum is a remarkable extracellular organelle of about 3,000 kDa that also exists as a polycellulosome of a mass approaching 100,000 kDa (12). The first assessment of the number of different subunits in the cellulosome indicated the presence of 14 subunits (30). Later, Kohring et al. (26) studying C. thermocellum strain JW20 observed 26 subunits. At least 19 cellulosomal polypeptides have been cloned and sequenced (2). They include CipA and 18 catalytic subunits with various glycosyl hydrolase activities. It is now clear that the cellulosome is capable of hydrolyzing not only cellulose and the backbone of hemicelluloses but also substituents of xylan. Recently Hayashi et al. (23) sequenced two homologous xylanases, XynA and XynB, from C. thermocellum and demonstrated that they contain a NodB domain in addition to a family II xylanase domain. A NodB domain of a multidomain xylanase from Cellulomonas fimi deacetylates acetyl xylan (31). A Ruminococcus flavefaciens xylanase has acetyl xylan esterase activity (25). These xylanases clearly are bifunctional enzymes. Conceivably, the xylanases and the acetyl xylan esterases work together in the hydrolysis of the xylan. A synergistic effect between a separate xylanase and an acetyl xylan esterase has been demonstrated (6).

The situation may be similar regarding XynY and XynZ. As shown in this paper, both contain feruloyl esterase and xylanase domains. The xylanase domain of XynZ has been well studied and crystallized, and its three-dimensional structure has been solved (16, 42). The feruloyl esterase and xylanase may well work together in the two bifunctional enzymes. The feruloyl esterase domain and the xylanase domain may form a dumbbell-like structure, and arabino xylan may be hydrolyzed in a multicutting event involving the xylose chain as well as the ester linkage between the arabinosyl and feruloyl moieties. As with xylanase and acetyl xylan esterase, a synergistic effect has been shown between a separate xylanase and a feruloyl esterase (8). It has been proposed also that feruloyl esterases are responsible for the hydrolysis of bonds between lignin and hemicelluloses (40, 42). The anaerobic fungus Neocallimastix patriciarum solubilizes lignin (36) and a xylanolytic Butyrivibrio sp. has phenolic esterase activity (35).

Multifunctional enzymes—one gene with more than one catalytic domain—were discussed several years ago (43). Such enzymes with activities acting on the same substrate but different bonds may have the advantage that the substrate does not have to be released from the enzyme when undergoing two or more enzymatic reactions. Several bifunctional enzymes in addition to xylanase-acetyl xylan esterase and xylanase-feruloyl esterase are known. Also, trifunctional enzymes exist with separate catalytic domains in a single polypeptide. Examples include peroxidase-lipoxygenase from the sea whip coral Plexaura homomalla (27), xylanase-β-(1,3-1,4)-glucanase from R. flavefaciens (19), xylanase with two catalytic domains from N. patriciarum (21), methenyltetrahydrofolate cyclohydrolase-methylenetetrahydrofolate dehydrogenase from several clostridia (34), and the trifunctional C₁-tetrahydrofolate synthase from yeast and liver (41).

The domains of xylanase and feruloyl esterase of XynZ and XynY are well separated in the polypeptides (Fig. 2). Separate expression of the domains in E. coli yielded active enzymes. As shown with the feruloyl esterase domain of XynZ, it is also active when the CBD and the linker regions are removed. Catalytic domains that are active without adjacent domains, such as CBD or dockerins, have been observed with many of the polypeptides from the C. thermocellum cellulosome. However, when amino acids 247 to 286 were removed from the C-terminal end of the feruloyl esterase domain of XynZ, the enzyme was inactive, indicating the requirement of this sequence for activity. An alignment of the feruloyl esterase domains of XynZ, XynY, and FaeA of Orpinomyces (Fig. 1) shows that these domains have substantial homology. This homology was not apparent with feruloyl esterases of Aspergillus niger and Aspergillus tubingensis (15), CinA and CinB from Butyrivibrio fibrisolvens (13, 14), and XylD from Pseudomonas fluorescens subsp. cellulosa (18). The sequence analysis implies that feruloyl esterases may be classified in families similar to cellulases and other glycohydrolyses. The Orpinomyces FaeA and the feruloyl esterase domains of XynZ and XynY have homology to a polypeptide of unknown function in E. coli (10) and to an unknown domain of the carboxy-terminal region of a xylanase from a Ruminococcus sp. (1). Feruloyl esterase activity is present in Ruminococcus spp. (40), whereas no feruloyl esterase activity has been demonstrated in E. coli. The E. coli gene may encode a dipeptidase instead, since homology exits between a dipeptidase of Aspergillus fumigatus and feruloyl esterase (Fig. 1) (3).

Removal of amino acids 247 to 286 (FAE227_XynZ) resulted in an inactive protein. This was somewhat unexpected, since this region of the feruloyl xylan esterase has the least homology between the different enzymes (Fig. 1). It is possible that this region is important for the stability and configuration of the enzymes, but a short sequence of the Orpinomyces FaeA (PGGTHDFPVW; amino acids 437 to 446) has high homology to a C. thermocellum XynZ sequence (QGGGHDFNVW; amino acids 256 to 265). Similar sequences are also found in the other enzymes shown in Fig. 1. These sequence may be of importance for the catalytic activity of the feruloyl esterases.