Skip to main content
Microbial Cell Factories logoLink to Microbial Cell Factories
. 2022 Sep 7;21:181. doi: 10.1186/s12934-022-01903-4

Modification of avian pathogenic Escherichia coli χ7122 lipopolysaccharide increases accessibility to glycoconjugate antigens

Alexander A Smith 1, Ricardo Corona-Torres 2, Rachel E Hewitt 1, Mark P Stevens 2, Andrew J Grant 1,✉; the Glycoengineering of Veterinary Vaccines Consortium
PMCID: PMC9449299  PMID: 36071433

Abstract

Background

Worldwide, an estimated 70.7 billion broilers were produced in 2020. With the reduction in use of prophylactic antibiotics as a result of consumer pressure and regulatory oversight alternative approaches, such as vaccination, are required to control bacterial infections. A potential way to produce a multivalent vaccine is via the generation of a glycoconjugate vaccine which consists of an antigenic protein covalently linked to an immunogenic carbohydrate. Protein-glycan coupling technology (PGCT) is an approach to generate glycoconjugates using enzymes that can couple proteins and glycan when produced in bacterial cells. Previous studies have used PGCT to generate a live-attenuated avian pathogenic Escherichia coli (APEC) strain capable of N-glycosylation of target proteins using a chromosomally integrated Campylobacter jejuni pgl locus. However, this proved ineffective against C. jejuni challenge.

Results

In this study we demonstrate the lack of surface exposure of glycosylated protein in APEC strain χ7122 carrying the pgl locus. Furthermore, we hypothesise that this may be due to the complex cell-surface architecture of E. coli. To this end, we removed the lipopolysaccharide O-antigen of APEC χ7122 pgl+ via deletion of the wecA gene and demonstrate increased surface exposure of glycosylated antigens (NetB and FlpA) in this strain. We hypothesise that increasing the surface expression of the glycosylated protein would increase the chance of host immune cells being exposed to the glycoconjugate, and therefore the generation of an efficacious immune response would be more likely.

Conclusions

Our results demonstrate an increase in cell surface exposure and therefore accessibility of glycosylated antigens upon removal of lipopolysaccharide antigen from the APEC cell surface.

Keywords: Protein glycan coupling technology, Vaccine, Poultry, Glycoconjugate lipopolysaccharide

Introduction

The scale of global poultry production is vast, with an estimated 70.7Bn broilers and 1.6Tn eggs produced in 2020 according to the Food & Agriculture Organisation [1]. Infectious diseases pose a significant risk to poultry welfare and productivity. Antibiotics have been used in poultry production, both at sub-therapeutic levels as growth promoters in some countries and for prevention or treatment of bacterial diseases [2]. However, the effectiveness of antibiotics is waning with the evolution of transmissible antibiotic resistance [3, 4]. The most common bacterial pathogens that infect or colonise poultry include avian pathogenic Escherichia coli (APEC), Salmonella enterica, Clostridium perfringens and Campylobacter jejuni [5–8]. These pathogens are known to either cause severe disease in poultry, thereby impacting animal welfare and productivity, or are zoonotic pathogens that enter the food chain and cause disease in humans. An alternative approach to prevent infection is vaccination. The development of efficacious vaccines could not only prevent avian and zoonotic diseases but also help to combat antibiotic resistance [9]. Multivalent vaccine development is especially appealing due to the potential for immunization against multiple organisms in a single dose, thus reducing labour and cost.

Glycoconjugate vaccines are produced by covalently linking a bacterial polysaccharide (usually capsule or O-antigen) to an immunogenic carrier protein. Glycoconjugate vaccines against bacteria are one of the success stories of modern medicine and have led to a significant reduction in the global occurrence of bacterial meningitis and pneumonia in humans but have not been used for animals. Protein Glycan Coupling Technology (PGCT) is a method that exploits the C. jejuni N-linked glycosylation system, encoded by genes within the C. jejuni pgl locus, to produce glycoconjugates in vivo and promises a low-cost alternative to traditionally made chemically conjugated vaccines [10]. The pgl locus contains the genes required to synthesise the C. jejuni heptasaccharide glycan and transfer the glycan to an acceptor protein [11, 12]. The oligosaccharide transferase PglB is the enzyme responsible for transferring the glycan from the lipid anchor on which it is synthesised, to an acceptor protein. PglB transfers the glycan to proteins containing the consensus sequence D/E-X1-N-X2-S/T (where X is not proline) [13]. The integration of the pgl locus into the APEC χ7122 genome resulted in exogenous proteins incorporating the D/E-X1-N-X2-S/T motif being successfully glycosylated, demonstrating the potential of a multivalent live vaccine to be developed using this technology [14]. However, although vaccination of chickens with this strain was able to reduce APEC colonization of the lungs upon experimental challenge, no reduction in C. jejuni colonization of the caeca was detected after challenge, indicating that further optimisation of the vaccine strain was required. Importantly, surface display of the antigen was limited in the study, particularly at the body temperature of chickens [14, 15].

An important feature of the E. coli cell surface architecture is the lipopolysaccharide (LPS) [16]. We hypothesised that truncation of the LPS by removal of the O-antigen would not only impair virulence and colonisation, but also potentially increase immune cell exposure to the glycosylated heterologous protein [17]. Removal of the immunodominant O-antigen in Salmonella by mutation of rfaH has been reported to enhance responses to underlying antigens and increase cross-serovar protection [18]. The wecA gene (previously termed rfe) encodes the O-antigen transferase (undecaprenyl-phosphate α-N-acetylglucosaminyl transferase), which initializes the synthesis of O-antigen polysaccharide and the enterobacterial common antigen (ECA) [19, 20]. Removal of wecA results in loss of O-antigen and ECA polysaccharide production [20, 21].

In this study we aimed to increase the surface presentation of the glycosylated antigenic protein previously described by Mauri et al. [14]. The APEC χ7122 pgl integrant vaccine strain and expression plasmids optimised for in vivo longevity, expression, and glycosylation were used. To assess whether glycosylation efficiency and/or surface presentation was target protein dependent, two different antigenic proteins were selected. The C. perfringens NetB toxin and the C. jejuni FlpA protein were used as carrier protein glycosylation targets in this study. Previous studies have demonstrated the immunogenicity of NetB and FlpA, making them ideal candidates for use in a multivalent poultry vaccine [22, 23]. The effect of temperature on glycosylation was also assessed, comparing permeabilised glycosylation levels for bacteria grown at 28 °C to those grown at 37 °C or 42 °C.

Materials and methods

Bacterial strains, media, and growth conditions

APEC strain χ7122 (O78:H9) and E. coli DH5α (New England Biolabs) (Table 1) were cultured on Luria Bertani (LB) agar plates for 16 h at 37 °C. Alternatively, strains were grown for 16 h in LB broth at 37 °C; cultures were shaken at 200 rpm in LB medium at 37 °C. Where necessary, media were supplemented with the appropriate antibiotic for selection (ampicillin 100 μg/ml, kanamycin 50 μg/ml, chloramphenicol 25 μg/ml, and gentamicin 20 μg/ml).

Table 1.

Bacterial strains and plasmids used in this study

Strain or plasmid Relevant genotype or description Source or references
Strain
APEC χ7122 Wild type strain [29]
APEC χ7122 pgl+ pgl integrant, kanr [14]
APEC χ7122 pgl+ ΔwecA::cat pgl integrant with wecA deleted and replaced with cat, kanr, cmr This study
Plasmid
pFPV25.1-G-NetB(10) Plasmid stably maintained in APEC that expresses NetB with 10 PglB target sites under the control of a constitutive rpsM promoter, ampr [14]
pFPV25.1-FlpA-10GT Plasmid stably maintained in APEC that expresses FlpA with 10 PglB target sites under the control of a constitutive rpsM promoter, ampr This study
pBADλred λRed recombineering plasmid, ampr [26]

Recombinant DNA techniques

Standard methods were used for molecular cloning. Chromosomal and plasmid DNA purifications were performed using commercial kits following the manufacturers’ instructions (New England Biolabs). DNA concentration and purity were measured using a Nanodrop ND-1000 spectrophotometer.

Construction of wecA gene deletion mutant

The APEC wecA gene deletion mutant was constructed by allelic replacement with a chloramphenicol acetyl transferase (cat) resistance cassette using a modification of the ET cloning procedure [24, 25] as previously described [26]. The addition of a chloramphenicol resistance cassette allowed for the selection of successful recombination events. A fragment containing the DNA to be integrated onto the chromosome was amplified from DNA containing the cat gene, using primers wecA:Cm_del_F (GGTCTTCGTGGTTATACTTCTGCTAATAATTTTCTCTGAGAGCGCATTACACGTCTTGAGCGATTG) and wecA:Cm_del_R (TTCGGCCGGTTTCCCAGGCATTGGTTGTGTCATCACATCCTTAGCCATGGTCCATATGAA). Nucleotides underlined are within the cat cassette, whereas nucleotides that are not underlined are present in the APEC χ7122 genome. Primers were designed with a 40 bp overhang homologous to the flanking region of wecA to allow for homologous recombination. The PCR product was further amplified using wecA_F (GGTCTTCGTGGTTATAC) and wecA_R (TTCGGCCGGTTTCCCAGGC) to generate enough DNA for recombination. Approximately 1 µg of linear PCR product was used for integration onto the chromosome using a modification of the λRed method as previously detailed [26, 27]. Expression of λRed recombinase from plasmid pBADλred [26] was induced with 0.2% l-arabinose. Electroporation was used to introduce the PCR amplicon into target cells, followed by a 3-h incubation in SOC medium. Transformants were then plated onto selective media. Loss of the pBADλred helper plasmid was performed using repeat passage and MAST ID Intralactam strips (MAST Diagnostics) to screen for the absence of beta-lactamase in bacterial colonies. The resultant gene deletion mutants were confirmed by PCR. Additionally, these PCR products were verified by Sanger sequencing (using primers wecA_1 and wecA_2). The gene deletion mutant was confirmed via whole genome sequencing (microbesNG). BAM files were generated using bowtie2 and aligned to the APEC χ7122 genome using Artemis to confirm deletion of wecA and replacement with cat (NCBI accession JANRGZ01) [28–30].

Generation of pFPV25.1 plasmids

The pFPV25.1_flpA_10GT construct is based on plasmid pFVP25.1 which is stably maintained during APEC infection of chickens [31] and includes a ribosome binding site, a PelB signal sequence, the C. jejuni flpA sequence codon optimised for E. coli, five repeats of the N-glycosylation site DQNAT at each side of flpA and a C-terminal 6xHis tag. The fusion was commercially synthesised (GeneArt, ThermoFisher, UK) and subcloned into pFPV25.1 (Valdivia, 1996) using restriction sites XbaI and HindIII. pFPV25.a-G-NetB(10) has similar composition but with the C. perfringens netB coding sequence and has been described previously [14]. APEC χ7122, APEC χ7122 pgl+ and APEC χ7122 pgl+ ΔwecA were transformed with pFPV25.1_flpA_10GT and pFPV25.1-G-NetB(10) using electroporation. Cells were made electrocompetent via repeat washing with ice cold 10% glycerol.

Immunofluorescent staining

Immunofluorescent staining was used to detect surface expression of glycosylated heterologous antigenic proteins, both qualitatively and quantitatively, using flow cytometry and confocal microscopy. Preparation of bacterial cultures for staining was completed following a previously described protocol with some modifications [32]. Briefly, bacterial cultures were grown overnight in LB with appropriate antibiotics and fixed with 4% paraformaldehyde. Samples requiring permeabilization were treated with 70% ethanol, lysozyme (25 µg/ml) and DNAase (50 U/ml). Permeabilization allows for the assessment of total protein production, as not all recombinant protein was transported to the cell surface. Between each step, the samples were washed three times with PBS. Following fixation and enzyme treatment (if required), samples were blocked with 0.1% BSA and stained with the lectin soybean agglutinin (SBA) from Glycine max conjugated to Alexa Fluor™ 647, 6x-His Tag Monoclonal Antibody (HIS.H8) Alexa Fluor 488 and Hoechst nuclear stain.

Confocal microscopy

Samples prepared for confocal microscopy were fixed on silane-coated slides to aid bacterial cell adhesion. Data was acquired on an Axio Examiner Z1 microscope equipped with a Zeiss LSM780 scanhead, using an 63 × oil immersion lens. 405 nm, 488 nm and 633 nm lasers were used to excite the Hoechst nuclear stain, Alexa Fluor 488 and Alexa Fluor 647 conjugates, respectively. Data were collected and the images analysed using Zeiss Zen software.

Flow cytometry

To reduce clumping prior to analysis, bacterial cells were passed through a 35 µm-mesh strain filter. Data for 500,000 events was collected when there were enough bacterial cells present. Single stained compensation tubes for each fluorophore and an unstained sample were also acquired in order to set laser volatges and compensate for any spectral overlap. Four biological repeats were performed, unless specified otherwise. One data point was collected for APEC χ7122 (negative control). Data were acquired on a CyAn™ ADP Cytometer equipped with 405 nm, 488 nm and 635 nm lasers in standard configuration, and analysed on FlowJo software.

Statistical analyses

Two-tailed, unpaired Student’s T-tests were performed to calculate statistical significance. For flow cytometry data, all samples within a group (permeablised or non-permeablised) were compared. Corresponding samples between groups at the same temperature (for example, APEC χ7122 pgl+  + pFPV25.1-flpA-10GT non-permeabilised vs APEC χ7122 pgl+  + pFPV25.1-flpA-10GT permeabilised) were also compared. When comparing data sets with one data point against those with multiple data points, a one-sample T-test was performed. A p-value ≤ 0.05 was considered to be statistically significant.

Results and discussion

Our previous studies investigating the use of glycoengineered vaccines to prevent both APEC and C. jejuni colonisation of chickens have had limited success [14, 33, 34]. It has previously been demonstrated that APEC χ7122 pgl+ is capable of glycosylating heterologous proteins when the D/E-X1-N-X2-S/T glycosylation motif has been incorporated into the amino acid sequence of the protein [14]. However, host (chicken) recognition of the C. jejuni heptasccharide glycan has been shown to be variable [14, 35]. In vivo chicken studies have shown little immunological recognition of glycosylated antigenic proteins delivered via live bacterial vaccines in poultry [14]. This study aimed to elucidate mechanisms which may be inhibiting the development of a robust immune response in these animals and therefore limiting the efficacy of glycoconjugate vaccines.

A key step in the development of a glycoconjugate vaccine-specific immune response is host exposure to the glycosylated antigenic protein. To this end, transportation of antigenic protein to the periplasm and surface expression was assessed qualitatively using antibody staining and confocal microscopy (Fig. 1). An APEC χ7122 strain containing the C. jejuni pgl locus, termed APEC χ7122 pgl+, was transformed with pFPV25.1_flpA_10GT, a plasmid containing the gene sequence of flpA, encoding the C. jejuni fibronectin-binding adhesin FlpA. pFPV25.1 has been shown to be stable during infection with APEC O1 and O2 [31]. Five sequential glycosylation motifs were incorporated before and after the FlpA amino acid sequence. The presence of the glycosylation motif ensures the protein is a target for N-linked glycosylation via the chromosomally integrated pgl locus. A PelB leader sequence is incorporated into the protein sequence to enable transportation of the protein to the periplasm where glycosylation occurs. Lectins are glycoproteins that strongly bind to specific glycans, and fluor-tagged lectins can be used to identify proteins that have successfully been glycosylated. A 6xHis-tag was also incorporated into the flpA sequence to enable protein quantity and location to be assessed. Antibodies specific for FlpA were not available, therefore the 6xHis tag present on each protein was used as a proxy for staining.

Fig. 1.

Fig. 1

Confocal microscopy images of APEC χ7122 pgl+ expressing glycosylatable FlpA. Bacteria were stained with lectin SBA from Glycine max (soybean) Alexa Fluor™ 647 conjugate (magenta), 6xHis-tag monoclonal antibody (HIS.H8) Alexa Fluor 488 (yellow) and Hoechst nuclear stain (cyan). A APEC χ7122 pgl+  + pFPV25.1-flpA-10GT, B APEC χ7122 pgl+  + pFPV25.1-flpA-10GT with permeabilization, C APEC χ7122 pgl+ ΔwecA::cat + pFPV25.1-flpA-10GT, D APEC χ7122 pgl+ ΔwecA::cat + pFPV25.1-flpA-10GT with permeabilization, E APEC χ7122 pgl+, F APEC χ7122 with permeabilization. Images B, D and F lack Hoechst nuclear stain due to permeabilization requiring DNase treatment. Scale bar = 10 µm

APEC χ7122 pgl+  + pFPV25.1_flpA_10GT (Fig. 1A) showed low amounts of surface presentation of the antigen, demonstrated by minimal staining for both the glycan and 6xHis-tag. Upon permeabilization, stained protein was observed, demonstrating the successful expression and glycosylation of FlpA within the bacterium (Fig. 1B). This data suggests that either the target protein is not being transported to the cell surface, and/or antibody accessibility of the target protein is hindered. To address these hypotheses, the O-antigen of APEC χ7122 pgl+ was removed. The wecA gene, encoding the O-antigen transferase, was deleted from APEC χ7122 pgl+ via homologous recombination. The resulting strain, APEC χ7122 pgl+ ΔwecA::cat, demonstrated increased levels of staining with fluorescently-labelled SBA (Fig. 1C) compared to APEC χ7122 pgl+ (Fig. 1A), suggesting the presence of complete O-antigen has an inhibitory effect on antibody binding to the glycoconjugate. Conversely, anti-histidine staining was not increased. The lack of 6xHis-tag staining may be due to the 6xHis-tag being embedded in the cell membrane. The increase in SBA lectin staining in the absence of O-antigen supports the hypothesis that host immune cell access to the antigenic protein is hindered due to the surface LPS. In both APEC χ7122 pgl+ and APEC χ7122 pgl+ ΔwecA::cat containing pFPV25.1_flpA_10GT, the higher quantity of glycosylated protein upon permeabilization of the cell wall remains consistent (Fig. 1B and D). Low levels of background staining were observed in APEC χ7122 pgl+ (Fig. 1E), which could suggest glycosylation of native proteins at low levels. This background fluorescence might be explained by the presence of the D/E-X1-N-X2-S/T glycan acceptor motif naturally occurring throughout the APEC χ7122 genome. Indeed, this motif can be found within 268 proteins of APEC χ7122, and it is possible that these proteins are targets of glycosylation. Further analysis would be required to validate this hypothesis.

Following qualitative analysis via confocal microscopy, quantitative analysis was performed using flow cytometry (Figs. 2 and 3). Here, two target antigens were compared: FlpA and NetB. The use of alternative antigens from different organisms (i.e., FlpA from C. jejuni, and NetB from C. perfringens) allows for the development of a multivalent vaccine. The effect of temperature was also assessed, with each culture being grown at 28ºC, 37ºC and 42ºC. The temperatures represent the optimal glycosylation temperature, optimal E. coli growth temperature and avian body temperature, respectively [15]. Bacterial cells were examined for the presence of the 6xHis-tag, glycan and both 6xHis-tag and glycan.

Fig. 2.

Fig. 2

Graphs showing FlpA glycoconjugate staining at various temperatures and permeability states. Percentage of total bacterial cells positive for anti-6xHis-tag staining (yellow), lectin staining (purple) and anti-6xHis-tag + lectin staining (black), empty bars = non-permeabilized, hatched bars = permeabilized, at (a) 28 °C, (b) 37 °C and (c) 42 °C. A APEC χ7122 pgl+  + pFPV25.1-flpA-10GT, B APEC χ7122 pgl+ ΔwecA::cat + pFPV25.1-flpA-10GT, (C) APEC χ7122 pgl+, D APEC χ7122, E APEC χ7122 pgl+  + pFPV25.1-flpA-10GT with permeabilization, F APEC χ7122 pgl+ ΔwecA::cat + pFPV25.1-flpA-10GT with permeabilization, G APEC χ7122 pgl+ with permeabilization, H APEC χ7122 with permeabilization. Statistically significant differences between samples (within unpermeabilized and permeabilized groups) are annotated with letters indicating the group(s) for which significance is observed, statistically significant differences between groups are annotated with lines. Two-tailed, unpaired T-test. P < 0.05. Expression for each sample within each group is compared. Expression between groups for only the equivalent sample is compared. N = 4 biological repeats

Fig. 3.

Fig. 3

Graphs showing NetB glycoconjugate staining at various temperatures and permeability states. Percentage of total bacterial cells positive for anti-6xHis-tag staining (yellow), lectin staining (purple) and anti-6xHis-tag + lectin staining (black), empty bars = non-permeabilized, hatched bars = permeabilized, at (a) 28 °C, (b) 37 °C and (c) 42 °C. A APEC χ7122 pgl+  + pFPV25.1-G-NetB(10), B APEC χ7122 pgl+ ΔwecA::cat + pFPV25.1-G-NetB(10), C APEC χ7122 pgl+, D APEC χ7122, E APEC χ7122 pgl+  + pFPV25.1-G-NetB(10) with permeabilization, F APEC χ7122 pgl+ ΔwecA::cat + pFPV25.1-G-NetB(10) with permeabilization, G APEC χ7122 pgl+ with permeabilization, H APEC χ7122 with permeabilization. Statistically significant differences between samples (within unpermeabilized and permeabilized groups) are annotated with letters indicating the group(s) for which significance is observed, statistically significant differences between groups are annotated with lines. Two tailed, unpaired T-test. P < 0.05. Expression for each sample within each group is compared. Expression between groups for only the equivalent sample is compared. N = 4 biological repeats

Analysis of single cells using flow cytometry mirrored the qualitative results observed with confocal microscopy. In all non-permeabilized conditions, the proportion of glycan-positive cells was greater in the APEC χ7122 pgl+ ΔwecA::cat + plasmid (pFPV25.1-flpA-10GT or pFPV25.1-G-NetB(10)) vs the APEC χ7122 pgl+  + plasmid (pFPV25.1-flpA-10GT or pFPV25.1-G-NetB(10)) further supporting the hypothesis that the O-antigen hinders antigen accessibility. Interestingly, higher numbers of glycan-positive cells were seen in the APEC χ7122 pgl+ compared to the wild type APEC χ7122, further suggesting that native APEC χ7122 proteins could be undergoing glycosylation (i.e., the protein products of genes on the APEC genome that by chance contain the glycan acceptor domain). The absence of significant reactivity of the antibody against 6xHis until the cells are permeabilised may be a consequence of the C-terminal location of the tag and topology of the proteins in the membrane.

As demonstrated in previous studies, we observed that glycosylation of NetB was temperature dependent (P < 0.05) [15]. However, a temperature-dependent effect was not observed with FlpA glycosylation. The efficiency of NetB glycosylation was higher at 28ºC compared to both 37ºC and 42ºC. The effect of temperature-dependent glycosylation may have an impact on glycoconjugate vaccine design. The carbohydrate portion of a glycoconjugate vaccine has a major role in the development of an efficacious immune response [36]. If glycosylation efficiency is lower at higher temperatures, resulting in the presentation of protein without carbohydrate, then ensuring enough target antigens are glycosylated at the temperatures experienced in vivo is crucial. An alternative approach to ensure that optimal glycosylation is achieved is to grow the bacteria in vitro, at the optimal glycosylation temperature, and then repeatedly administer the bacteria. This may be necessary to generate a robust, prolonged immune response.

An alternative explanation to the phenomenon observed in this study, is that heptasaccharide glycan is binding to the truncated LPS core as well as D/E-X1-N-X2-S/T tagged proteins [37]. This strategy has previously been used to fuse heptasaccharide glycan to the LPS core using an O-antigen ligase dependant pathway. However, this was performed in an E. coli K-12 O-antigen polymerase mutant, compared to the O-antigen transferase mutant described in this study [37].

Conclusion

In this study we have described the generation and in vitro assessment of an APEC χ7122 pgl+ ΔwecA::cat strain with increased expression/presentation of surface expressed glycoconjugates compared to APEC χ7122 pgl+. Initially, confocal microscopy was used to qualitatively assess and confirm disparities in surface presentation of glycosylated proteins. This observation was further validated using a quantitative flow cytometry approach. Permeabilization revealed that APEC χ7122 pgl+ and APEC χ7122 pgl+ ΔwecA::cat were capable of producing intracellular glycosylated FlpA and NetB, however APEC χ7122 pgl+ ΔwecA::cat demonstrated significantly more surface-exposed glycan. This data suggests that, in previous studies using an in vivo chicken model of infection, APEC χ7122 pgl+ may not be sufficient in provoking a carbohydrate-stimulated immune response, potentially due to the blocking of surface expressed glycoconjugate due to the O-antigen [14]. Therefore, strains lacking O-antigen and/or other cell surface architecture may be more suited to glycoconjugate vaccine development and warrant further in vitro and in vivo investigation for this purpose.

Acknowledgements

We thank Prof. Brendan Wren and Dr Jon Cuccui from the Glycoengineering of Veterinary Vaccines Consortium for their critical reading and comments on the manuscript prior to submission.

Author contributions

AAS and AJG conceptualised the study. AAS, REH, RC-T and AJG designed the methodology. AAS and RC-T carried out the investigation. AAS performed formal analysis. AJG supervised the study. AAS and AJG prepared and wrote the original draft. All authors read and approved the final manuscript.

Funding

The authors gratefully acknowledge funding from the Biotechnology & Biological Sciences Research Council (BBSRC; grant references BB/N001591/1 and BBS/E/D/20002174). The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Availability of data and materials

The data that support the findings of this study are available from the corresponding author [AJG], upon reasonable request.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare they have no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Andrew J. Grant, Email: ajg60@cam.ac.uk

the Glycoengineering of Veterinary Vaccines Consortium:

Brendan Wren and Jon Cuccui

References

  • 1.The Food and Agriculture Organization of the United Nations. (n.d.). FAO.QCL. License CC BY-NC-SA 3.0 IGO. Extracted from https://www.fao.org/faostat/en/#data/QCL.. License CC BY-NC-SA 3.0 IGO. . Retrieved June 6, 2022, from https://www.fao.org/faostat/en/#data/QCL. Accessed 07 June 2022.
  • 2.van Boeckel TP, Brower C, Gilbert M, Grenfell BT, Levin SA, Robinson TP, Teillant A, Laxminarayan R. Global trends in antimicrobial use in food animals. Proc Natl Acad Sci USA. 2015;112(18):5649–5654. doi: 10.1073/PNAS.1503141112/SUPPL_FILE/PNAS.201503141SI.PDF. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Mehdi Y, Létourneau-Montminy MP, Gaucher M, Chorfi Y, Suresh G, Rouissi T, Brar SK, Côté C, Ramirez AA, Godbout S. Use of antibiotics in broiler production: global impacts and alternatives. Animal Nutrition. 2018;4(2):170–178. doi: 10.1016/J.ANINU.2018.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Roth N, Käsbohrer A, Mayrhofer S, Zitz U, Hofacre C, Domig KJ. The application of antibiotics in broiler production and the resulting antibiotic resistance in Escherichia coli: a global overview. Poult Sci. 2019;98(4):1791. doi: 10.3382/PS/PEY539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Foley SL, Lynne AM, Nayak R. Salmonella challenges: prevalence in swine and poultry and potential pathogenicity of such isolates. J Animal Sci. 2008;86:E149–E162. doi: 10.2527/JAS.2007-0464. [DOI] [PubMed] [Google Scholar]
  • 6.Nolan LK, John BH, Vaillancourt JP, Abdul-Aziz T, Logue CM. Colibacillosis. Diseases of Poultry: Thirteenth Edition. 2017 doi: 10.1002/9781119421481.CH18. [DOI] [Google Scholar]
  • 7.Skarp CPA, Hänninen ML, Rautelin HIK. Campylobacteriosis: the role of poultry meat. Clin Microbiol Infect. 2016;22(2):103–109. doi: 10.1016/J.CMI.2015.11.019. [DOI] [PubMed] [Google Scholar]
  • 8.van Immerseel F, de Buck J, Pasmans F, Huyghebaert G, Haesebrouck F, Ducatelle R. Clostridium perfringens in poultry: an emerging threat for animal and public health. Avian Pathol. 2010;33(6):537–549. doi: 10.1080/03079450400013162. [DOI] [PubMed] [Google Scholar]
  • 9.Micoli F, Bagnoli F, Rappuoli R, Serruto D. The role of vaccines in combatting antimicrobial resistance. Nat Rev Microbiol. 2021;19(5):287–302. doi: 10.1038/s41579-020-00506-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Terra VS, Mills DC, Yates LE, Abouelhadid S, Cuccui J, Wren BW. Recent developments in bacterial protein glycan coupling technology and glycoconjugate vaccine design. J Med Microbiol. 2012;61(PART7):919–926. doi: 10.1099/JMM.0.039438-0/CITE/REFWORKS. [DOI] [PubMed] [Google Scholar]
  • 11.Szymanski CM, Ruijin Y, Ewing CP, Trust TJ, Guerry P. Evidence for a system of general protein glycosylation in Campylobacter jejuni. Mol Microbiol. 1999;32(5):1022–1030. doi: 10.1046/J.1365-2958.1999.01415.X. [DOI] [PubMed] [Google Scholar]
  • 12.Wacker M, Linton D, Hitchen PG, Nita-Lazar M, Haslam SM, North SJ, Panico M, Morris HR, Dell A, Wren BW, Aebi M. N-linked glycosylation in Campylobacter jejuni and its functional transfer into E. coli. Science. 2002;298(5599):1790–1793. doi: 10.1126/science.298.5599.1790. [DOI] [PubMed] [Google Scholar]
  • 13.Kowarik M, Young NM, Numao S, Schulz BL, Hug I, Callewaert N, Mills DC, Watson DC, Hernandez M, Kelly JF, Wacker M, Aebi M. Definition of the bacterial N-glycosylation site consensus sequence. EMBO J. 2006;25(9):1957–1966. doi: 10.1038/SJ.EMBOJ.7601087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Mauri M, Sannasiddappa TH, Vohra P, Corona-Torres R, Smith AA, Chintoan-Uta C, Bremner A, Terra VS, Abouelhadid S, Stevens MP, Grant AJ, Cuccui J, Wren BW. Multivalent poultry vaccine development using protein glycan coupling technology. Microbial Cell Factories. 2021;20(1):1–26. doi: 10.1186/S12934-021-01682-4/TABLES/3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Terra VS, Mauri M, Sannasiddappa TH, Smith AA, Stevens MP, Grant AJ, Wren BW, Cuccui J. PglB function and glycosylation efficiency is temperature dependent when the pgl locus is integrated in the Escherichia coli chromosome. Microb Cell Fact. 2022;21(1):1–14. doi: 10.1186/S12934-021-01728-7/TABLES/3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Liu B, Furevi A, Perepelov A, Guo X, Cao H, Wang Q, Reeves PR, Knirel YA, Wang L, Widmalm G. Structure and genetics of Escherichia coli O antigens. FEMS Microbiol Rev. 2020;44(6):655–683. doi: 10.1093/FEMSRE/FUZ028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Duerr CU, Zenk SF, Chassin C, Pott J, Gütle D, Hensel M, Hornef MW. O-antigen delays lipopolysaccharide recognition and impairs antibacterial host defense in murine intestinal epithelial cells. PLoS Pathogens. 2009 doi: 10.1371/journal.ppat.1000567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Nagy G, Palkovics T, Otto A, Kusch H, Kocsis B, Dobrindt U, Engelmann S, Hecker M, Emody L, Pál T, Hacker J. “Gently rough”: the vaccine potential of a Salmonella enterica regulatory lipopolysaccharide mutant. J Infect Dis. 2008;198(11):1699–1706. doi: 10.1086/593069. [DOI] [PubMed] [Google Scholar]
  • 19.Rai AK, Mitchell AM. Enterobacterial common antigen: Synthesis and function of an enigmatic molecule. MBio. 2020;11(4):1–19. doi: 10.1128/mBio.01914-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Rick PD, Hubbard GL, Barr K. Role of the rfe gene in the synthesis of the O8 antigen in Escherichia coli K-12. J Bacteriol. 1994;176(10):2877–2884. doi: 10.1128/JB.176.10.2877-2884.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lehrer J, Vigeant KA, Tatar LD, Valvano MA. Functional characterization and membrane topology of Escherichia coli WecA, a sugar-phosphate transferase initiating the biosynthesis of enterobacterial common antigen and O-Antigen Lipopolysaccharide. J Bacteriol. 2007;189(7):2618–2628. doi: 10.1128/JB.01905-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Keyburn AL, Bannam TL, Moore RJ, Rood JI. NetB, a Pore-forming toxin from necrotic enteritis strains of clostridium perfringens. Toxins. 2010 doi: 10.3390/toxins2071913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Neal-McKinney JM, Samuelson DR, Eucker TP, Nissen MS, Crespo R, Konkel ME. Reducing Campylobacter jejuni colonization of poultry via vaccination. PLoS ONE. 2014 doi: 10.1371/JOURNAL.PONE.0114254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Muyrers JPP, Zhang Y, Testa G, Stewart AF. Rapid modification of bacterial artificial chromosomes by ET-recombination. Nucleic Acids Res. 1999;27(6):1555. doi: 10.1093/NAR/27.6.1555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Yu D, Ellis HM, Lee EC, Jenkins NA, Copeland NG, Court DL. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci. 2000;97(11):5978–5983. doi: 10.1073/PNAS.100127597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Mastroeni P, Morgan FJE, McKinley TJ, Shawcroft E, Clare S, Maskell DJ, Grant AJ. Enhanced virulence of Salmonella enterica serovar typhimurium after passage through mice. Infect Immun. 2011;79(2):636–643. doi: 10.1128/IAI.00954-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci. 2000;97(12):6640–6645. doi: 10.1073/PNAS.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Carver T, Harris SR, Berriman M, Parkhill J, McQuillan JA. Artemis: an integrated platform for visualization and analysis of high-throughput sequence-based experimental data. Bioinformatics (Oxford, England) 2012;28(4):464–469. doi: 10.1093/BIOINFORMATICS/BTR703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Dziva F, Hauser H, Connor TR, van Diemen PM, Prescott G, Langridge GC, Eckert S, Chaudhuri RR, Ewers C, Mellata M, Mukhopadhyay S, Curtiss R, Dougan G, Wieler LH, Thomson NR, Pickard DJ, Stevens MP. Sequencing and functional annotation of avian pathogenic escherichia coli serogroup O78 strains reveal the evolution of E coli lineages pathogenic for poultry via distinct mechanisms. Infection Immunity. 2013;81(3):838–849. doi: 10.1128/IAI.00585-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9(4):357. doi: 10.1038/NMETH.1923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Alber A, Morris KM, Bryson KJ, Sutton KM, Monson MS, Chintoan-Uta C, Borowska D, Lamont SJ, Schouler C, Kaiser P, Stevens MP, Vervelde L. Avian Pathogenic Escherichia coli (APEC) strain-dependent immunomodulation of respiratory granulocytes and mononuclear phagocytes in CSF1R-reporter transgenic chickens. Front Immunol. 2020 doi: 10.3389/FIMMU.2019.03055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Park S, Reyer MA, McLean EL, Liu W, Fei J. An improved method for bacterial immunofluorescence staining to eliminate antibody exclusion from the fixed nucleoid. Biochemistry. 2019 doi: 10.1021/ACS.BIOCHEM.9B00724. [DOI] [PubMed] [Google Scholar]
  • 33.Vohra P, Chintoan-Uta C, Bremner A, Mauri M, Terra VS, Cuccui J, Wren BW, Vervelde L, Stevens MP. Evaluation of a Campylobacter jejuni N-glycan-ExoA glycoconjugate vaccine to reduce C. jejuni colonisation in chickens. Vaccine. 2021;39(51):7413–7420. doi: 10.1016/J.VACCINE.2021.10.085. [DOI] [PubMed] [Google Scholar]
  • 34.Vohra P, Chintoan-uta C, Terra VS, Bremner A, Cuccui J, Wren BW, Vervelde L, Stevens MP. Evaluation of glycosylated FlpA and SodB as subunit vaccines against campylobacter jejuni colonisation in chickens. Vaccines. 2020;8(3):520. doi: 10.3390/VACCINES8030520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Price NL, Goyette-Desjardins G, Nothaft H, Valguarnera E, Szymanski CM, Segura M, Feldman MF. Glycoengineered outer membrane vesicles: a novel platform for bacterial vaccines. Sci Rep. 2016 doi: 10.1038/SREP24931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Avci FY, Li X, Tsuji M, Kasper DL. A mechanism for glycoconjugate vaccine activation of the adaptive immune system and its implications for vaccine design. Nat Med. 2011;17(12):1602–1609. doi: 10.1038/nm.2535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Nothaft H, Davis B, Lock YY, Perez-Munoz ME, Vinogradov E, Walter J, Coros C, Szymanski CM. Engineering the Campylobacter jejuni N-glycan to create an effective chicken vaccine. Sci Rep. 2016 doi: 10.1038/SREP26511. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author [AJG], upon reasonable request.


Articles from Microbial Cell Factories are provided here courtesy of BMC

RESOURCES