Developmental Regulation of the Cell Division Protein FtsZ in Anabaena sp. Strain PCC 7120, a Cyanobacterium Capable of Terminal Differentiation

Abstract

Heterocysts are terminally differentiated cells devoted to nitrogen fixation in the filamentous cyanobacterium Anabaena sp. strain PCC 7120. We show here that the cell division protein FtsZ is present in vegetative cells but undetectable in heterocysts. These results provide a first rational explanation for the inability of mature heterocysts to undergo cell division.

The relationship between cell division and cell differentiation is a complex problem in biology. The decision of a specific cell to continue proliferation or instead to arrest at a given time during a cell cycle in order to commit itself to differentiate depends on the interaction between the cell and its surrounding environment. Once a cell becomes competent and committed to differentiate, differential gene expression and protein localization must be involved in order to ensure the cell fate determination. Generally in both eukaryotes and prokaryotes, a differentiating cell, once fully committed, stops cell division (6). Forcing ectopic cell division can affect morphogenesis either by interfering with terminal differentiation or through an inappropriate increase in cell number (1, 9). Similarly in Anabaena sp. strain PCC 7120, a cell division arrest is also observed for differentiated cells (24). Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium capable of developing specialized cells, called heterocysts, devoted to nitrogen fixation. Heterocyst differentiation is induced upon the depletion of a combined-nitrogen source in the growth medium, and only 1 in every 10 to 20 cells along each filament can become heterocysts, which are arranged in a semiregular and one-dimensional pattern (4, 25, 26). Developing proheterocysts may regress under certain conditions, but mature heterocysts no longer divide (24). The growth of a filament is thus ensured only by vegetative cells which retain the ability to divide.

It is not known what makes heterocysts lose the competence for cell division, nor is it clear if cell division arrest is a necessary prelude to heterocyst differentiation. Heterocysts have a thick envelope consisting of an inner layer of glycolipids and an outer layer of polysaccharide (25). The structure of heterocyst envelope may eventually provide a physical constraint for cell division. Alternatively, the arrest of cell division accompanying heterocyst differentiation involves differential regulation of gene expression and enzymatic activities. To gain insight into these questions, we started to investigate the regulation of cell division during heterocyst development. One key element in bacterial division is the GTPase FtsZ, the earliest known element acting on bacterial cell cycle. Upon GTP hydrolysis, FtsZ polymerizes to form a ring structure attached to the membrane through ZipA at the midpoint of a dividing cell and recruits other cell division elements to form the septum (for recent reviews, see references 3, 14, 17, and 22). FtsZ is found in almost all bacteria, Chlamydia trachomatis being the only known exception. It is also present in plant chloroplasts. The FtsZ protein from Anabaena sp. strain PCC 7120 (referred to as FtsZ_Ana hereafter) has been shown to be highly similar to those found in other bacteria (5, 29). In this study, we demonstrate that FtsZ_Ana is undetectable in heterocysts, providing a rational explanation for the inability of mature heterocysts to undergo cell division.

Overexpression of FtsZI_Ana in Escherichia coli disrupts septum formation.

The ftsZ_Ana coding region was amplified by PCR with sense (CCGGAATTCCATATGACACTTGATAATAA) and antisense (GCGGGATCCTTAATTTTTGGGTGGTC) primers. The PCR product was cloned into the pET15b vector (Novagen) and transformed into the E. coli host BL21 for the overproduction of FtsZ_Ana. The expected recombinant FtsZ from this construct would have a His tag attached to its N-terminal end. After induction for 3 h with 0.4 mM isopropyl-β-d-thiogalactopyranoside (IPTG), a major protein band with an estimated molecular mass of about 50 kDa was induced (Fig. 1). The molecular mass of this protein was close to that calculated from the His-FtsZ_Ana fusion (47 kDa).

FIG. 1.

Production and purification of recombinant FtsZ_Ana from E. coli. E. coli BL21 transformed with pET15b overexpressing FtsZ_Ana was grown to an optical density of 0.5 at 600 nm (lane 1) and then induced by 0.4 mM IPTG (lane 2). Soluble proteins from induced cells were loaded onto a His tag affinity column. The flowthrough fraction is shown in lane 3. The column was washed once (lane 4), and then the retained fraction was eluted (lane 5). M, protein molecular weight standard (positions shown in kilodaltons at the right).

The E. coli host strain became filamentous in the presence of the overexpressed FtsZ_Ana after growth at 37°C for 7 h (Fig. 2). The E. coli filaments had no visible septum. The filamentation phenotype of the E. coli host depended on the concentration of IPTG. Without IPTG as an inducer, cells appeared normal. When incubated for 7 h at 37°C with 0.002 mM IPTG, cells were slightly elongated, with short filaments twice the size of normal cells. When IPTG was added at 0.008 mM or above, cells became fully filamentous. A similar phenotype has been found in E. coli when its endogenous FtsZ protein was overexpressed (23). These results indicated that the presence of FtsZ_Ana at a high concentration interfered with the cell division process in E. coli. A similar observation was made when ftsZ from Rhizobium meliloti was expressed in E. coli (15).

FIG. 2.

Filamentation phenotype of E. coli caused by overexpression of FtsZ_Ana. E. coli BL21 transformed with pET15b overexpressing FtsZ_Ana was grown for 7 h in LB medium in the absence (A) or presence (B) of 0.4 mM IPTG as an inducer.

GTPase activity of recombinant FtsZ_Ana.

For purification of the recombinant FtsZ_Ana, E. coli host cells were collected by centrifugation, disrupted by sonication, and loaded on a His tag affinity column (Pharmacia) as instructed by the supplier (Fig. 1). The eluted protein, with apparent homogeneity (Fig. 1), was further dialyzed against a buffer consisting of 50 mM HEPES (pH 7.2), 0.1 mM EDTA, and 10% glycerol. For the GTPase assay, recombinant FtsZ_Ana (0.125 mg/ml) was incubated at 37°C in a solution containing 1 mM GTP, 5 mM MgCl₂, 50 mM Tris (pH 7.2), 50 mM KCl, and 5% glycerol (16). Samples were withdrawn at different time points and analyzed by high-performance liquid chromatography (HPLC). As shown in Fig. 3, GDP appeared over time at the expense of GTP. Only a basal level of GDP was observed when GTP was incubated without FtsZ_Ana or with FtsZ_Ana inactivated at 100°C for 15 min. This is the first cyanobacterial FtsZ shown to have a GTPase activity.

FIG. 3.

GTPase activity of FtsZ_Ana detected by HPLC on an ion-exchange column (Partisil 10; Waters). Samples were eluted with 0.8 M KH₂PO₄ (pH 2.6) at a flow rate of 1 ml/min. (A) Identification of nucleotides in a mixture of authentic GMP, GDP, and GTP. (B) GTP was incubated for 2 h with FtsZ_Ana previously heated at 100°C for 15 min. (C) GTP was incubated with FtsZ_Ana for 0 min (top), 60 min (middle), or 120 min (bottom).

It has been reported that 3-methoxybenzamide (3-MBA), an inhibitor of ADP-ribosyltransferase, induces cell filamentation in Bacillus subtilis, and this phenotype could be suppressed by a mutation in the ftsZ gene (18). Since it is conceivable that 3-MBA acts directly on FtsZ, we tested the possibility of this drug as a GTPase inhibitor of FtsZ_Ana. Under our assay conditions, 3-MBA up to a concentration of 5 mM had no significant effect on the GTPase activity of FtsZ_Ana in vitro. 3-MBA at a concentration of 5 mM had an inhibitory effect on the growth ability of Anabaena sp. strain PCC 7120, but septum formation was not affected (data not shown).

Immunodetection of FtsZ_Ana during heterocyst development.

The purified recombinant FtsZ_Ana (Fig. 1) was used as an antigen to produce polyclonal antibodies from a rabbit. The specificity of the antibodies was controlled by immunoblotting with protein lysate from Anabaena sp. strain PCC 7120 prepared as described previously (30), and the recombinant FtsZ_Ana was purified from an E. coli overexpressing strain. The results of this experiment are shown in Fig. 4. A band of 47 kDa was revealed from Anabaena sp. strain PCC 7120 (Fig. 4, lane 2). The size of this signal correlates well with the theoretical molecular weight of FtsZ_Ana, as well as that of the purified recombinant FtsZ_Ana antigen detected on the same blot (lane 1).

FIG. 4.

Detection of FtsZ_Ana by immunoblotting. Purified FtsZ_Ana produced from E. coli (lane 1) and protein lysate from Anabaena sp. strain PCC 7120 (lane 2) were immunodetected with a serum raised against the recombinant FtsZ_Ana. Immunodetection was carried out as described elsewhere (30). Sizes are indicated in kilodaltons.

To determine whether the amount of FtsZ changes during heterocyst development, a 500-ml culture of Anabaena sp. strain PCC 7120 was grown to an optical density of 0.5 at 700 nm in nitrate-containing BG11 medium (21) and then transferred to combined nitrogen-free medium BG11₀ to induce heterocyst development (28); 60-ml aliquots of cells were collected at different time points from 10 min to 3 days after induction to make protein preparations. After protein separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, similar amounts of FtsZ_Ana were detected in all protein samples by immunoblotting (data not shown). These results suggested that the overall amount of FtsZ_Ana was little changed in filaments induced to differentiate heterocysts. As in E. coli (19), most FtsZ_Ana was found in the soluble fraction in Anabaena sp. strain PCC 7120 (data not shown).

Cell-type-specific localization of FtsZ_Ana.

Since heterocysts represent only 5 to 10% of all cells under nitrogen-fixing conditions (4, 25, 26), immunodetection of FtsZ_Ana with proteins prepared from total filaments could not determine whether FtsZ_Ana displayed a differential pattern of regulation in heterocysts compared to vegetative cells. Therefore, a heterocyst preparation was made by treating filaments by lysozyme followed by weak sonication (8). Under such conditions, most vegetative cells were lysed to give vegetative proteins, while heterocysts were resistant due to its thick cell wall. Short and repetitive sonications were performed to eliminate vegetative cells as much as possible. Total proteins from purified heterocysts were extracted. Similar amounts of proteins from total filaments, heterocysts, and vegetative cells were separated by electrophoresis and blotted with anti-FtsZ_Ana antibodies. The results of the immunodetection experiments indicated that FtsZ_Ana was undetectable in protein preparations from heterocyst fractions, while it was detected strongly in total cells (heterocysts plus vegetative cells) in similar amount as in vegetative cells (Fig. 5). This detected protein showed a molecular weight similar to that of the recombinant FtsZ_Ana detected on the same blot (data not shown). A similar pattern of protein localization was found with polyclonal antibodies against RbcL (12), the larger subunit of ribulose-1,5-bisphosphate carboxylase, a well-established element specifically localized in vegetative cells (7, 27). Another polyclonal antibody against NifD, the dinitrogenase α subunit known to be present only in heterocysts (7, 27), was also used in this experiment. Consistent with the fact that NifD is heterocyst specific, the immunodetection experiment revealed a signal of high intensity in heterocyst proteins, a signal of low intensity in total filaments, and no signal in vegetative cells (Fig. 5).

FIG. 5.

Cell-type-specific localization of FtsZ_Ana in Anabaena sp. strain PCC 7120. Proteins were prepared from total filaments (lane 1), heterocysts (lane 2), or vegetative cells (lane 3). Similar amounts of proteins were loaded onto each lane. Immunodetection was carried out as described elsewhere (30) with a polyclonal antibody against FtsZ_Ana, RbcL of Nicotiana sylvestris (12), or NifD of Rhodospirillum rubrum (kindly provided by P. W. Ludden, University of Wisconsin), as indicated. The position of each detected antigen is indicated by an arrow; sizes are indicated in kilodaltons.

From these results, we conclude that FtsZ is a vegetative-cell-specific element in Anabaena sp. strain PCC 7120. Our results correlate with the fact that heterocysts are terminally differentiated cells; they also indicate that the inability of heterocysts to undergo division is not simply due to a physical constraint of the thick heterocyst cell wall but rather is a result of an actively regulated process.

Sporulation in B. subtilis involves asymmetrically localized septum, and a switch of FtsZ location from medial to polar is one of the earliest signs of sporulation. In this organism, FtsZ polar localization is regulated by elements directly involved in sporulation (2, 11, 13). Although no asymmetrical septum formation has been observed at the onset of heterocyst formation in Anabaena sp. strain PCC 7120, cell-type-specific localization of FtsZ observed in the present study is likely to be regulated by some elements involved in heterocyst development. It has been shown in another developmental bacterium, Caulobacter crescentus, that FtsZ is found in the stalk cell and absent in the swarmer cell immediately after division and before the latter differentiates to a stalk cell. This cell-type-specific localization is the result of both transcriptional and proteolytic regulations of FtsZ (10, 20). Similar regulatory mechanisms could account for the cell-type-specific localization of FtsZ in Anabaena sp. strain PCC 7120. FtsZ is thus likely to provide a control point for the coordination between cell division and cell differentiation.