ABSTRACT
The high host specificity of phages is a real challenge in the therapy applications of the individual phages. This study aimed to edit the long tail fiber proteins (pb1) of a T5-like phage to obtain the engineered phages with expanded plaquing host range. Two T5-like Salmonella phages with high genome sequence homology but different plaquing host ranges, narrow-host range phage vB STyj5-1 (STyj5-1) and wide-host range phage vB BD13 (BD13), were isolated and characterized. The pb1 parts of STyj5-1 were replaced by the corresponding part of BD13 using homologous recombination method to obtain the engineered phages. The alterations of the whole pb1 part or the N-terminal amino acids 1-400 of pb1 of STyj5-1 could expand their plaquing host ranges (from 20 strains to 30 strains) and improve their absorption rates (from 0.28–28.84% to 28.10–99.49%). Besides, the one-step growth curves of these engineered phages with modified pb1 parts were more similar to that of STyj5-1. The burst sizes of phages BD13, STyj5-1 and the engineered phages were 250, 236, 166, and 223 PFU per cell, respectively. The expanded plaquing host range and improved absorption rates of these engineered phages revealed that the pb1 part might be the primary determinant of the host specificities of some T5-like phages.
IMPORTANCE Genetic editing can be used to change or expand the host range of phages and have been successfully applied in T2, T4 and other phages to obtain engineered phages. However, there are hardly any similar reports on T5-like phages due to that the determinant regions related to their host ranges have not been completely clarified and the editing of T5-like phages is more difficult compared to other phages. This study attempted and successfully expanded the host range of a narrow-host range T5-like phage (STyj5-1) by exchanging its whole pb1 part or the N-terminal 1-400aa of that part by a broad-host range phage (BD13). These demonstrated the pb1 part might be the primary determinant of the host specificities for some T5-like phages and provided an effective method of extension plaquing host range of these phages.
KEYWORDS: Salmonella, T5-like phage, tail fiber proteins, homologous recombination, therapy
INTRODUCTION
Phages, the most abundant organisms on earth, are non-cellular microorganisms that infect and lyse bacteria and most of them could only infect bacteria in genera with high specificity (1). Phages are becoming one of the most promising alternative tools to conventional antibiotics and have been tested on various bacterial diseases on human as well as industrially raised animals (2–4). However, the excessive host specificity of the individual phage is a major challenge for their applications, and it is important to develop a strategy to expand the host range of phages (5).
Broad-host range phages isolation and phage cocktail configuration are the conventional methods to overcome the narrow-host range of mono-phage therapy (6–8), whereas the separation of wide-host range phage is time-consuming and has accidental features. The design of a phage cocktail is substantially more complicated and customizing phage cocktails to each infection is also time-consuming and costly (9). Moreover, each phage component that is chosen for making the cocktail acquires procedures and market access license, which is more complex than individual phage application (10). Recently, the progress in phage engineering techniques makes that possible to obtain engineered phages with expanded host range by rational phage editing (11, 12). The long tail fibers have been considered as the key determinants of host specificity of T2-, T3-, T4-, and T7-like phages during infection process, and some of these phages have been engineered to acquire the changed host range by altering their long tail parts. Mahichi et al. replaced the long tail fiber of a T2 phage with that of phage IP008 and acquired the recombinant with expanded host range (13). For T3 phages, tail fiber mutagenesis method was used to acquire the phage libraries containing expanded or altered host range (14). Another study showed that the alterations in long tail fiber proteins could expand the host range of a T4-like phage (15). Besides, yeast-based platform for phage engineering was successfully applied in T7 phage family to modulate phage host range (16).
T5-like phages, the representative organisms of Siphoviridae, have a straight tail fiber or spike with the terminal receptor binding protein (pb5) that directly attached to the tail or baseplate. The pb5 part ensures the binding of phage to the outer membrane proteins (OMPs), such as FhuA, BtuB, and FepA (17–19), of the host bacteria for irreversible absorption and DNA injection (20). They also have three additional long tail fibers (L-shaped tail fibers, ltfs) that consist of pb1 at the upper end of the conical basal structure attaching to the thin collar (21). It was reported that the pb1 part of T5-like phages targeting O-antigens of lipopolysaccharides (LPS) are the first part for initial host recognition as well as related to reversible absorption (22, 23), which can be encoded by one gene (ltf) or two genes (ltfA, ltfB) (22). Compared with the T2-, T3-, T4-, and T7-like phages, the engineering of T5-like phages is more difficult due to that these phages can escape the CRISPR-Cas type I-E from Escherichia coli (E. coli) (24, 25). The studies of engineering of T5-like phages are relatively limited, particularly in the tail fiber alteration of these phages. Previous studies showed that E. coli phages T5 and BF23 used the tail spikes as the receptor site (26, 27), and there was not absolutely necessary for the presence of the pb1 part on the phage. There remains a need to identify if pb1 parts are the host range-determining regions of T5-like phages and to acquire the host range-expanded phages.
In this study, two T5-like Salmonella phages, BD13 and STyj5-1, showed a high homology on the level of the entire genome but exhibited different host ranges. BD13 could lyse 28 Salmonella and 2 E. coli strains as well as STyj5-1 could lyse 19 Salmonella and 1 E. coli strains, which were selected to be the ideal model for identifying the influence factors on their host specificity. A homologous recombination method was established to obtain the recombinant phages, and the effect of long tail fiber proteins on the plaquing host range was studied by measuring the plaquing host range and adsorption rate.
RESULTS
Morphologies of phages.
Two Salmonella phages, named BD13 and STyj5-1, were isolated from Qingdao sewage by plaque purification using Salmonella ATCC 14028 (14028) and Salmonella CMCC 50115 (50115). Both phages formed plaques with the size of 0.5–1.0 mm and without halo on the soft agar plates, which were shown in Fig. S1 in the supplemental material. The transparency of plaques formed by BD13 was higher than STyj5-1. Transmission electron microscope (TEM) photos of these two phages were shown in Fig. 1, and both phages showed typical Siphoviridae morphology with a polyhedral head (~85 nm) and a long tail (~170 nm).
FIG 1.
TEM photographs of phages STyj5-1 (A) and BD13 (B).
Genome and phylogenetic tree analysis of phages BD13 and STyj5-1.
The complete genomes of phages BD13 and STyj5-1 were sequenced and deposited in GenBank with the accession number of OL451946.1 and MW423798.1. DNA sequencing results showed that the genomes of phages BD13 and STyj5-1 are 121,769-bp and 110,592-bp with low average GC contents of 40.04% and 39.87%. One overall collinearity blockand was found in the genomes of BD13 and STyj5-1 via Mauve alignment analysis (Fig. 2), and BLASTn alignment results showed that the identity of the genomes of these two phages was 96.44% with 88.00% of query cover. These suggested that the whole genomes of BD13 and STyj5-1 have high homology with each other.
FIG 2.
Mauve alignment results and sketch maps of long tail fiber proteins of phages BD13 and STyj5-1. (A) The mauve alignment is made by Mauve software based on the whole genomes of phages BD13 and STyj5-1. (B) The pb1 part of STyj5-1 are composed of two ORFs while BD13 has only one.
The phylogenetic tree of phages BD13 and STyj5-1 with different types of representative phages (T1~T7) based on the whole genome was constructed and shown in Fig. 3. According to the phylogenetic tree, phages BD13 and STyj5-1 were classified to the T5-like phages. Besides, these two phages showed closest relationship with Salmonella phages OSY-STA, Stitch and SH9, which all from Epseptimavirus category of Markadamsvirinae subfamily in the order Caudovirales. These demonstrated that BD13 and STyj5-1 are two members of T5-like phages from Epseptimavirus category of Markadamsvirinae subfamily in the order Caudovirales.
FIG 3.
Phylogenomic analysis of phages BD13 and STyj5-1 at the nucleotide level. The recommended VICTOR tree (formula D6) is shown and is conducted using the Genome-BLAST Distance Phylogeny (GBDP) method under settings recommended for prokaryotic viruses. The symbol on the tree branch shows the bootstraps values form 100 replications and the branch lengths of the trees are scaled in terms of the used distance formula. The annotations at the right-hand side (genus, subfamilies and family) are annotated according to ICTV.
Plaquing host range of phages BD13 and STyj5-1.
The plaquing host range of phage BD13 and STyj5-1 against 28 Salmonella and 4 E. coli strains were tested and shown in Fig. 6. Phage BD13 has a wider plaquing host range than phage STyj5-1 for it could lyse all tested Salmonella strains and 2 E. coli strains, whereas STyj5-1 could lyse only 19 Salmonella strains and 1 E. coli strain.
FIG 6.
Comparison of the plaquing host range of chimeric phages and parental phages. The legend at right reflects the conditions of plaque formed by the tested phages. “+++”: Clear, big plaques, “++”: Turbid, big plaques, “+”: Phage circle consisting of small plaques, “—”: No plaque.
Preliminary identification of phage absorption receptor.
The effects of OMPs and LPS on the absorption of phages BD13 and STyj5-1 to Salmonella 14028 and 50115 were assessed by measuring these two phages' absorption rates to the bacteria treated with proteinase K and periodate (Fig. 4). The absorption rates of BD13 and STyj5-1 to the untreated and proteinase K-treated 14028 and 50115 were 67.03% and 69.43% as well as 50.27% and 50.21%, respectively. Those of BD13 and STyj5-1 to 14028 and 50115 after periodate treatments were significantly decreased (P < 0.01) to 13.65% and 9.38%. These data verified that the disruption of the LPS resulted in the absorption decrease of phages BD13 and STyj5-1 to the host bacteria.
FIG 4.
Preliminary identification of absorption receptor of phages STyj5-1 and BD13 to Salmonella 50115 and 14028. Untreated bacteria group: untreated bacteria + phage. Proteinase K-treated group: bacterial cells treated with proteinase K (1 mg/mL, 37°C for 2 h) + phage. Periodate-treated group: bacterial cells treated with NaIO4 (100 mM, 25°C for 2 h) + phage. Error bars represent the standard deviation of at least three determinations. ** indicated significant difference between same group columns at P < 0.01 level.
Long tail fiber protein comparison of phages BD13 and STyj5-1.
The sequences of pb1 parts of phages BD13 and STyj5-1 were compared with another three Epseptimavirus genus phages (Salmonella phages OSY-STA, Stitch and SH9). Phages OSY-STA and SH9 showed high percentage identity with BD13 and STyj5-1 (Fig. S2 in the supplemental material). In addition, phage OSY-STA has a broad-host range (NCBI data). Therefore, the further comparison of pb1 part of phages BD13, STyj5-1 and OSY-STA was conducted. As displayed in Fig. 5A, most of the differential amino acids in pb1 part between BD13 and STyj5-1 were consistent with those of OSY-STA. Besides, the pb1 part of phage STyj5-1 is composed of two open reading frames (ORFs) while BD13 and OSY-STA contain only one (Fig. 2B). Moreover, the identity of pb1 part of BD13 and OSY-STA (99.81%) was higher than that of STyj5-1 with BD13 and OSY-STA, which were 90.71% and 90.32%, respectively. These differences might be critical for the different plaquing host ranges of phages BD13 and STyj5-1.
FIG 5.
Comparison and recombination positions between BD13 and STyj5-1. (A) Comparison of amino acid sequences (pb1 part) of phages STyj5-1, BD13 and OSY-STA by Clustal Omega, and the color depth deepened with the increase of percentage identity. (B) The specific engineering segments of phage STyj5-1, and the numbers represent the location of amino acids.
Homologous recombination of STyj5-1 and BD13.
The specific amino acid sequences of pb1 part of STyj5-1 were replaced by the corresponding sequences of the phage BD13 using homologous recombination method, and the replaced sequences were presented in Fig. 5B. The recombinant chimeric phages with replaced whole pb1 part and partial pb1 parts (1-400aa, 406-723aa, 737-878aa, 805-994aa, 1-214aa, 215-400aa) were successfully obtained by a large number of plaque purification tests combining PCR (PCR) identification (Fig. S3 in the supplemental material). These phages were named STB-pb1, STB-pb1A, STB-pb1B, STB-pb1C, STB-pb1D, STB-pb1E, and STB-pb1F, respectively.
Plaquing host range of chimeric phages.
The plaquing host ranges of chimeric phages were tested and those of phage STyj5-1 and BD13 were shown in Fig. 6. Two chimeric phages (STB-pb1, STB-pb1A) showed the same plaquing host ranges with their donor phage BD13, which could lyse another 10 strains (Salmonella 2~9, Salmonella 14028, and E. coli ATCC 25922) compared with the receptor phage STyj5-1. Although other chimeric phages (STB-pb1B, STB-pb1C, STB-pb1D, STB-pb1E, STB-pb1F) showed the same plaquing host ranges with the receptor phage STyj5-1. Besides, phages STB-pb1 and STB-pb1A obtained higher abilities to lyse the host strains as they formed more clear plaques than STyj5-1 in 24 strains.
Adsorption rates of chimeric phages and parental phages.
Twelve bacterial strains based on the susceptibility to phages STyj5-1, BD13, STB-pb1, and STB-pb1A were selected, and the adsorption rates of these four phages to the selected bacteria were determined and shown in Fig. 7. For parental phages (STyj5-1 and BD13), the values of phage STyj5-1 were all significantly lower (P < 0.01) than BD13. The adsorption rates of phage STB-pb1 were all significantly improved (P < 0.01) compared with phage STyj5-1, and there was no significant statistics difference in adsorption rates between STB-pb1 and BD13 except for Salmonella C1-1. For another chimeric phage, STB-pb1A, its adsorption rates were improved compared to the phage STyj5-1 and with significant difference against 6 tested strains. Besides, the adsorption rates of STB-pb1A were still significantly (P < 0.01) lower than the phage BD13 and chimeric phage STB-pb1.
FIG 7.
Adsorption rates of chimeric and parental phages. Twelve bacterial strains based on the susceptibility were selected and the adsorption rates of phages STyj5-1, BD13, STB-pb1 and STB-pb1A to these bacteria were determined. Different letters (a–d) on the columns indicate significant difference between each other at P < 0.01 level. Error bars represent the standard deviation of at least three determinations.
One-step growth curve of chimeric phages and parental phages.
The one-step growth curves of chimeric phages STB-pb1, STB-pb1A and their parental phages were measured and displayed in Fig. 8. The latent phases of all phages were approximately 30 min, and the burst period of phage BD13 lasted 60 min, while those of others were 120 min for STyj5-1 and STB-pb1A as well as 150 min for STB-pb1. The phage titer values of BD13 during its burst period were all significantly higher than those of phages STyj5-1, STB-pb1 and STB-pb1A (P < 0.05). After 90, 150, 180, and 150 min of infectious, phages BD13, STyj5-1, STB-pb1, and STB-pb1A entered the stationary phase successively with the burst sizes of 250, 236, 166, 223 PFU per cell, respectively.
FIG 8.
One-step growth curve of chimeric and parental phages. The x axis shows the time, and the y axis shows the plaque-forming units per milliliter (PFU/mL).
DISCUSSION
The reversible absorption of phage long tail fiber proteins to the surface receptor of host bacteria is the first step in phage infectious and might directly influence the host range of phages (12). The present study attempted to expand the host range of a T5-like phage by editing its long tail fiber proteins using genetic engineering (11, 28, 29). Two Salmonella phages, named BD13 and STyj5-1, were isolated form sewage and both phages showed typical Siphoviridae morphology (Fig. 1). Phylogenetic tree analysis (Fig. 3) demonstrated that these two phages have close evolutionary relationship and can be classified into T5-like phages from Epseptimavirus category of Markadamsvirinae subfamily in the order Caudovirales. Phages BD13 and STyj5-1 have high genome homology on whole genomes (Fig. 2A), but their plaquing host range are obviously different (Fig. 6). Receptor identification results verified that the LPS of bacterial outer membrane was closely related to these two phages' recognition and absorption to their host bacteria (Fig. 4). These were consistent with the previous studies that the long tail fibers (pb1) of T5-like phages could specifically recognize the O-antigen of outer membrane LPS to reversibly absorb the host bacteria (30, 31). Detailed comparative sequence analysis of pb1 part between these two phages and OSY-STA, another broad-spectrum T5-like phage belonged to the same genus, were shown in Fig. 5. The alignment results showed that the amino acid sequences of these two broad-host ranges phages, BD13 and OSY-STA, were indeed similar and were different with STyj5-1 on the whole pb1 part, except for 525-589aa. The differences of pb1 parts among these phages might lead to the different plaquing host range of phages STyj5-1 and BD13. To further investigate the relationships between the pb1 parts of T5-like phages and their plaquing host range, the pb1 part of STyj5-1 was replaced in whole or in part by the corresponding part of BD13 using homologous recombination method (15). Previous studies indicated that the success of direct editing using homologous recombination method is greatly relied on the high homology of the editing objects (15, 32). Phages BD13 and STyj5-1 have high genome homology but distinguished plaquing host range (Fig. 6), making them the ideal materials for this study. E.coli K12 was used as the infected bacteria by phages during the reprogramming process, and engineered phages were isolated and purified after a large number of plaque identification tests using the original host. The appearance frequency of the engineered phages in this study was about 1.0%, which was higher than that (0.093 ± 0.014%) in the study of Mahichi et al. (13). The plaquing host range and absorption rates of the obtained engineered phages were also determined.
At first, the whole pb1 part of phage STyj5-1 was replaced by the corresponding sequence of BD13, and the engineered phage was named STB-pb1. The plaquing host range of phage STB-pb1 was expanded compared with STyj5-1 and was same as BD13, as well as absorption rates of phage STB-pb1 were significantly higher than STyj5-1. It was reported that long tail fiber proteins of T2-, T3-, T4-, and T7-like phages can specifically recognize the surface receptors and the host range of these phages can be expanded by the reconstruction of their long tail fiber proteins (13–15). Previous studies reported that the tail spikes were the major host range determinant of T5-like phages (33, 34), and Heller et al. showed that the long tail fibers of a T5 phage was closely related to the phage's absorption rates but had little influence on the phage's host range (33). However, the replacement of pb1 part of phage STyj5-1 by that of BD13 could not only significantly improve its absorption rates (Fig. 7) but also expand its plaquing host range (Fig. 6). These results indicated that the long tail fibers might be necessary for some T5-like phages to identify and absorb their hosts and their functions as well as relationships with plaquing host range need to be further explored.
Next, the pb1 part of STyj5-1 was replaced in part by that of BD13 according to the fragment size, location and genome diversity, and the engineered phages were named STB-pb1A, STB-pb1B, STB-pb1C, STB-pb1D, STB-pb1E and STB-pb1F. STB-pb1A (1-400aa) showed the changed plaquing host range which were same with BD13, while those of STB-pb1B (406-723aa), STB-pb1C (737-878aa), STB-pb1D (805-994aa), STB-pb1E (1-214aa), and STB-pb1F (215-400aa) were remain unchanged which corresponding with STyj5-1. The absorption rates of STB-pb1A were improved compared with STyj5-1 but still significantly lower than STB-pb1 and BD13. The results indicated that the N-terminal amino acids 1–400 of pb1 part is the critical primary plaquing host range determinant of the phages (Figs. 6 and 7) and other regions of pb1 part are also necessary for the phage's complete absorption function, which need to be further researched. At present, most of the findings suggested that the C-terminal regions of tail fibers were the determinant of the phage's plaquing host range (14, 15, 35). The result in this study showed that the N-terminal of pb1 part has a significant influence on the plaquing host range of phage STyj5-1. Ando et al. also demonstrated that the N terminus of the phage 13a tail fiber can alter the infectivity of the virus (16). These indicated that the function and mechanism of N-terminal part of long tail fibers of the phages still need to be investigated. It is commonly recognized that the growth cycles of T5-like phages including the reversible adsorption of long tail fibers, irreversible adsorption of tail spikes and DNA injection, phage DNA synthetize, phage DNA assembly, and the release of progeny phages. One-step growth curve is an important biological index of virulent phages that can describe the growth trend and reflect parameters such as the length of phage latency and burst size. The effects of the pb1 part modification on the growth cycles of phages STyj5-1, BD13, STB-pb1, and STB-pb1A were evaluated by measuring their one-step growth curves. Results showed that the one-step growth curves of STB-pb1 and STB-pb1A were more similar to that of STyj5-1, indicating that the modification of pb1 part did not significantly change the growth characteristics of those phages.
Conclusions.
In this study, two T5-like Salmonella phages, STyj5-1 and BD13, with high genome homology were isolated and characterized. These two phages have obvious differences in their plaquing host ranges and long tail fiber proteins (pb1). The replacement of the pb1 part of the narrow-host range phage STyj5-1 by the corresponding part of the wide-host range phage BD13 expanded the phage's plaquing host range and significantly improved its absorption rates. The results revealed that the pb1 part might be the primary determinant of the host specificities for some T5-like phages. Besides, the replacement of the N-terminal amino acids 1–400 of pb1 part of STyj5-1 by that of BD13 also expanded the phage's plaquing host range, but the absorption rates of the engineered phages are still lower than BD13. These indicated that the N-terminal amino acids 1–400 of pb1 part is the critical primary host range determinant of these phages and other regions of pb1 part are also necessary for the phage's complete absorption function. Besides, the alteration of pb1 part did not significantly change the growth characteristics of those engineered phages compared with the original phage. These provide a theoretical basis and reference for exploring the functions of pb1 part of T5-like phages and modifying other T5-like phages to change or expand their host range.
MATERIALS AND METHODS
Bacterial strains and phages.
Phages STyj5-1 and BD13 were isolated from Qingdao sewage using Salmonella 50115 and 14028 as the host bacteria and stored in Food Safety Laboratory, Ocean University of China. The filtered sewage (10 mL) and log-phase bacteria (500 μL) were mixed with LB broth (40 mL) and then cultured at 37°C (220 rpm, 24 h) to enrich the phages. After that, the mixture was centrifuged (5,000 × g, 10 min) and the obtained supernatant was filtered through 0.22-μm filter to remove the bacteria. Aliquots of 100 μL of phage suspensions and 100 μL of log-phase bacteria cultures were mixed with 5 mL molten LB containing 0.5% agar and the mixture was poured on the LB plates. After incubation (37°C, 12 h), plaques were picked and purified using double-layer method as described above for more than six rounds. Bacterial strains used to test the plaquing host ranges of phages were listed in Fig. 6. The 28 Salmonella strains belonged to four serotypes: Salmonella Typhimurium, Salmonella 2, 5, 6, 7, 8, 9, ATCC 14028, CMCC (B) 50115, CMCC (B) 50015, and CMCC (B) 50071; Salmonella Enteritidis, Salmonella 3, 4, B3-1, B3-2, B3-3, B3-4, B3-5, B3-6, C1-1, C1-2, D6-1, D6-2, D7-1, D7-2, CMCC 50014, and CMCC 50041; Salmonella paratyphi-A, CMCC (B) 50001; Salmonella paratyphi-B, CMCC 50094. Salmonella CMCC 50014, CMCC 50041, CMCC 50094, CMCC (B) 50115, CMCC (B) 50001, CMCC (B) 50015, and CMCC (B) 50071 were purchased from China Medical Culture Collection Center (CMCC). Salmonella ATCC 14028 and E. coli ATCC 25922 were purchased from American Type Culture Collection (ATCC). E. coli BL21(DE3), O157·G2583 and K12 were purchased from Beijing Baioubowei Biotechnology Co., Ltd. Other strains (Salmonella 2~9 and B3-1~D7-2) were isolated from sewage, sick chicken, and manure of chicken and pig samples and were identified by PCR of 16S rRNA. All strains were cultivated in LB broth (Qingdao Haibo Technology Co. Ltd, Qingdao, PR China) at 37°C (200 rpm). The dilution and preservation of the phages were conducted using SM buffer (10 mM MgSO4, 100 mM NaCl, 0.01% gelatin, and 50 mM Tris-HCl, pH 7.5).
Determination of the plaque and the morphology of phage.
Plaques of the purified phages on LB agar plates were observed and photoed after propagation at 37°C overnight. Phage particles were concentrated to 1010 PFU/mL by centrifugation (4,000 × g, 10 min) using 100 kDa sterile ultrafiltration centrifuge tube. The concentrated phage particles were deposited on carbon-coated copper grids and negatively stained with 2% phosphotungstic acid (pH 6.8). The morphology of phage was observed by TEM (JEM-1200EX, JEOL, Japan) after drying at 25°C.
Genome analysis.
The genome DNA of phages STyj5-1 and BD13 were extracted and purified using Phage DNA isolation kit (Tiangen Biotek, Beijing). The purified phage DNA was sequenced by Illumina HiSeq sequencing platform and assembled by SeqMan II sequence analysis software (DNASTAR Inc., USA) by Personal Biotechnology Co., Ltd. (Shanghai, China). The ORF of the sequenced genomes were predicted with RAST software (https://rast.nmpdr.org/rast.cgi) and verified with ORF finder (https://www.ncbi.nlm.nih.gov/orffinder/).
Phylogenetic tree analysis.
Genome BLASTn analysis (https://blast.ncbi.nlm.nih.gov/Blast.cgi) of STyj5-1 and BD13 were performed to identify the type of phages with the high identity scores to them. The representative phages in this type and other types were selected according to the classification of the International Committee on Taxonomy of Viruses (ICTV). The genome sequences of STyj5-1, BD13 and other selected phages (from NCBI database) were used to build the phylogenetic tree using Virus Classification and Tree Building Online Resource (VICTOR, https://victor.dsmz.de). All pairwise comparisons of these genome sequences were conducted using the Genome-BLAST Distance Phylogeny (GBDP) method (36) under settings recommended for prokaryotic viruses (37). Branch support was inferred from 100 pseudo-bootstrap replicates each. Trees were rooted at the midpoint and visualized with iTOL (https://itol.embl.de/).
Phage absorption receptor analysis.
Salmonella 50115 and 14028 cells from the log phase were collected and treated with proteinase K and periodate, respectively. For the proteinase K-treated group, the bacterial cells were treated with proteinase K (1 mg/mL, Solarbio) at 37°C for 2 h and then washed twice and resuspended with PBS. For the periodate-treated group, the log-phase bacterial cells were resuspended with CH3COONa (50 mM, pH 5.2) containing NaIO4 (100 mM) and incubated at 25°C for 2 h. After that, the treated cells were washed twice and resuspended with PBS. Aliquots of 200 μL of the proteinase K- and periodate-treated bacterial suspensions were separately mixed with 200 μL of STyj5-1 and BD13 suspensions (approximately 105 PFU/mL) and incubated at 37°C for 10 min. Aliquots of 200 μL of PBS and untreated bacterial suspension were set as the blank and negative control groups. After that, the mixtures were centrifuged (10,625 × g, 2 min) to obtain the supernatants, and the phages in the supernatants were calculated by double-layer plate method (38). Adsorption rate = (phage titer of blank control group − phage titer of experimental group)/phage titer of blank control group × 100%.
Long tail fiber proteins analysis.
The sequences of long tail fiber proteins of phages BD13 and STyj5-1 were compared with those of phages OSY-STA, SH9 and Stitch (UQT65207.1, QQV89381.1 & QQV89382.1, YP_009851906.1, ASZ77796.1, YP_009146081.1) using online website Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/). The results were further visualized by Jalview software.
Construction of the plasmids for alteration of phage.
The recombinant plasmids were constructed according to seamless DNA cloning technology (39). The vector, pUC57-Kana plasmid, was purchased from Nanjing Tsingke Biotechnology Co., Ltd. The linearized pUC57-Kana plasmid fragment, pb1 part and other partial pb1 parts with upstream and downstream homologous arms were amplified by PCR using the corresponding primers (Table 1). The pUC57-Kana plasmid, the DNA sequences of phages STyj5-1 and BD13 were used as templates, respectively. After amplification, all the sequences were spliced using recombinant enzyme CloneExpress Ultra (Nanjing Vazyme Biotechnology Co., Ltd). The constructed recombinant vectors were sent to BGI Tech Solutions (Beijing Liuhe) Co. Ltd. for sequencing, and the subsequent experimental operations were carried out using the plasmid identified to be correct. The procedures of rationale construction of the recombinant vector were shown in Fig. 9.
TABLE 1.
Primers used for constructing the plasmids for alteration of phages
| Primers | Sequences (5′→3′) | Usage |
|---|---|---|
| pb1-F1 | actggccgtcgttttacaacg | Amplification of recombinant vector of pb1 |
| pb1-R1 | ggtgtaatcatggtcatagctg | |
| pb1-F2 | cagctatgaccatgattacaccaccggtgtcgcggtggaaattcc | Amplification of upstream skeleton fragment of pb1 |
| pb1-R2 | ccaacaattacagaactaccgtaatataaatggagtgcaatctgtc | |
| pb1-F3 | caataattttagttttaagtgccattattgagttactccatcgctgatg | Amplification of downstream skeleton fragment of pb1 |
| pb1-R3 | cgttgtaaaacgacggccagttgggatgtactccatgg | |
| pb1-F4 | gacagattgcactccatttatattacggtagttctgtaattgttgg | Amplification of pb1 fragment |
| pb1-R4 | catcagcgatggagtaactcaataatggcacttaaaactaaaattattg | |
| pb1-F5 | acatctgctactgagtctacc | Identification primers of pb1 |
| pb1-R5 | gctgcagctgatgattctatag | |
| pb1-A-F1 | tggcattgatactggccgtcgttttacaa | Amplification of recombinant vector of pb1-A |
| pb1-A-R1 | acaatatcaaggtgtaatcatggtcatagctgtttc | |
| pb1-A-F2 | tgattacaccttgatattgttgttgatgagaaagtgc | Amplification of upstream skeleton fragment of pb1-A |
| pb1-A-R2 | taagtgccattattgagttactccatcgctgatg | |
| pb1-A-F3 | caacgacagcaacagacaaggccctgga | Amplification of downstream skeleton fragment of pb1-A |
| pb1-A-R3 | cgacggccagtatcaatgccaaagtttatttttgcac | |
| pb1-A-F4 | taactcaataatggcacttaaaactaaaattattgtacag | Amplification of pb1-A fragment |
| pb1-A-R4 | cttgtctgttgctgtcgttgcagcagta | |
| pb1-A-F5 | agctactaatgccaccagtg | Identification primers of pb1-A |
| pb1-A-R5 | taagacctgaatcatgatcccca | |
| STyj5-1-F | gtgtgattgtagcaccccct | Identification primers of fragment of vB STyj5-1 |
| STyj5-1-R | tacaagaggttcgttttgcccc | |
| pb1-B-F1 | aactgggttaactggccgtcgttttacaacgt | Amplification of recombinant vector of pb1-B |
| pb1-B-R1 | gtttcactagggtgtaatcatggtcatagctgtttcctgt | |
| pb1-B-F2 | tgattacaccctagtgaaactaatgcaaaaactagtgagactaacgc | Amplification of upstream skeleton fragment of pb1-B |
| pb1-B-R2 | accagcggcctccagggccttgtctgttgctg | |
| pb1-B-F3 | atgggatcgtgatggtcacataagcgcgtttgc | Amplification of downstream skeleton fragment of pb1-B |
| pb1-B-R3 | gacggccagttaacccagtttgaggcgctacca | |
| pb1-B-F4 | aggccctggaggccgctggtagcgct | Amplification of pb1-B fragment |
| pb1-B-R4 | tgtgaccatcacgatcccatttaagacctgaatcatg | |
| pb1-B-F5 | agctactaatgccaccagtg | Identification primers of pb1-B |
| pb1-B-R5 | taagacctgaatcatgatcccca | |
| pb1-C-F | gttgatgataacgcaagg | Identification primers of pb1-C |
| pb1-C-R | ccatttccagcactatca | |
| pb1-D-F1 | acatatccacactggccgtcgttttacaa | Amplification of recombinant vector of pb1-D |
| pb1-D-R1 | aatgatacccggtgtaatcatggtcatagctg | |
| pb1-D-F2 | tgattacaccgggtatcatttgcactaatgg | Amplification of upstream skeleton fragment of pb1-D |
| pb1-D-R2 | taaatatggcgacagccgaatcaaaactag | |
| pb1-D-F3 | actaccgtaatataaatggagtgcaatctgtc | Amplification of downstream skeleton fragment of pb1-D |
| pb1-D-R3 | gacggccagtgtggatatgtttggcaatatag | |
| pb1-D-F4 | ttcggctgtcgccatatttaaatctgtttattgggg | Amplification of pb1-D fragment |
| pb1-D-R4 | tccatttatattacggtagttctgtaattgttgg | |
| pb1-D-F5 | gttgttccgtggacttctggc | Identification primers of pb1-D |
| pb1-D-R5 | ttttgggtctagctgaccatcgtt | |
| pb1-E-F1 | tgaagacgctactggccgtcgttttac | Amplification of recombinant vector of pb1-E |
| pb1-E-R1 | acaatatcaaggtgtaatcatggtcatagc | |
| pb1-E-F2 | tgattacaccttgatattgttgttgatgagaaagtgcc | Amplification of upstream skeleton fragment of pb1-E |
| pb1-E-R2 | taagtgccattattgagttactccatcgctgatg | |
| pb1-E-F3 | atctgctatttctgctgaagcttctgaag | Amplification of downstream skeleton fragment of pb1-E |
| pb1-E-R3 | gacggccagtagcgtcttcactagcttttg | |
| pb1-E-F4 | taactcaataatggcacttaaaactaaaattattgtacagcag | Amplification of pb1-E fragment |
| pb1-E-R4 | cttcagcagaaatagcagattcattctcagaattc | |
| pb1-E-F5 | tcggagaacctagctgcaatttacg | Identification primers of pb1-E |
| pb1-E-R5 | cctgattggtagactcagtagcagatgt | |
| pb1-F-F1 | tggcattgatactggccgtcgttttac | Amplification of recombinant vector of pb1-F |
| pb1-F-R1 | agttagcataggtgtaatcatggtcatagc | |
| pb1-F-F2 | tgattacacctatgctaactcttcagaagc | Amplification of upstream skeleton fragment of pb1-F |
| pb1-F-R2 | cttcagcagaaaatagcagattcatgctcag | |
| pb1-F-F3 | caacgacagcaacagacaaggccctgga | Amplification of downstream skeleton fragment of pb1-F |
| pb1-F-R3 | gacggccagtatcaatgccaaagtttatttttgcacc | |
| pb1-F-F4 | tctgctattttctgctgaagcttctga | Amplification of pb1-F fragment |
| pb1-F-R4 | cttgtctgttgctgtcgttgcagcagta | |
| pb1-F-F5 | ctgctatagaatcatcagc | Identification primers of pb1-F |
| pb1-F-R5 | ctacctgatgcactttg |
FIG 9.
Rationale construction of the recombinant plasmids and procedures of homologous recombination. Step 1 is the construction process of the recombinant plasmids using seamless DNA cloning technology. Firstly, the linearized pUC57-Kana plasmid fragment, pb1 part and other partial pb1 parts with upstream and downstream homologous arms are amplified by PCR. Then, all the sequences are spliced using recombinant enzyme to obtain the recombinant plasmids. Step 2 is the process of phages infect into the host bacteria and the homologous recombination process to obtain the chimeric phages. The recombinant plasmid and plasmid pKD46 are transformed into E. coli K12 via electroporated DNA method and then STyj5-1 infects the host bacteria. The progeny phages are acquired after phage DNA synthetize, phage DNA assembly in the host and the release out of the host.
Homologous recombination and isolation of recombinant phage.
The procedures of homologous recombination was shown in Fig. 9. E. coli K12 was used as the infected bacteria, and each recombinant plasmid and helper plasmid pKD46 (contain the lambda Red (exo/bet/gam) gene) were transformed successively into E. coli K12 via electroporated DNA method (40). The transformed strain with the two plasmids was cultured in 50 mL LB liquid medium containing 50 μg/mL of kanamycin and ampicillin at 30°C (200 rpm). L-arabinose (100 μL, 1 M) and phage STyj5-1 (100 μL, approximately 108 PFU/mL) were added to the culture until its OD600 nm reached 0.2 and 0.4, respectively. After 8 h of incubation, chloroform was added to the culture to lyse the bacterial cells to obtain the progeny phages and the bacterial cell debris were removed by centrifugation at 8,000 × g for 15 min. The obtained supernatant with phages (100 μL, approximately 105 PFU/mL) was mixed with Salmonella 50115 (100 μL, approximately 108 PFU/mL) and 0.5% agar (5 mL) as well as overlaid on an LB plate and incubated at 37°C overnight to obtain single clear plaques. The obtained single plaques were selected and suspended in SM buffer. PCR test was used for identifying the recombinant phages containing the target replacement fragment of BD13 using the corresponding primers (Table 1). Then, these recombinant phages were further verified by the second PCR test via the target replacement fragment of BD13 and the skeleton fragment of STyj5-1. The phage samples with correct PCR results were sent to BGI Tech Solutions (Beijing Liuhe) Co. Ltd. for sequencing (unbiased Sanger sequencing). Samples with the correct replaced fragments were proliferated to approximately 109 PFU/mL for further studies.
Plaquing host range determination.
The plaquing host range of STyj5-1, BD13 and chimeric phages were determined. Briefly, the bacterial culture during log phase (100 μL, approximately 108 PFU/mL) was mixed with 5 mL molten LB containing 0.5% agar and the mixture was poured on LB plates. After solidification, phage suspensions (3 μL, approximately 109 PFU/mL) were dropped on the plate surface and the plates were incubated at 37°C for 8 h to observe the plaques.
Phage absorption assay.
An aliquot of 1 mL of log phase bacterial culture was centrifuged, washed twice and resuspended with PBS to approximately 108 CFU/mL. Aliquots of 500 μL of the obtained bacterial suspensions were mixed with 500 μL of phage suspension (approximately 105 PFU/mL) and incubated at 37°C for 10 min. The group (500 μL PBS + 500 μL phage suspension) was set as the blank control and incubated at the same culture conditions. After that, the mixture was centrifuged (10,625 × g, 2 min) to obtain the supernatant, and the phages in the supernatant were calculated by double-layer plate method. Adsorption rate = (phage titer of control group − phage titer of experimental group)/phage titer of control group × 100%.
One-step growth curve.
The one-step growth curves of phages were constructed as described by Xi et al. (41). Firstly, the phage suspension was mixed (MOI = 0.1) with host strains (log phase) in 50 mL LB broth and incubated in 37°C water bath for 15 min. Next, the mixture was centrifuged (10,625 × g, 1 min) and the supernatant was discarded to remove the unabsorbed phages. The pellet was resuspended in 50 mL of fresh LB liquid medium and cultured at 37°C (140 rpm). An aliquot of (1 mL) the sample was taken every 10 min for the first 120 min and every 30 min from 120 to 300 min. The obtained samples were centrifuged (10,625 × g, 1 min) and the phages in the supernatant were counted. The burst size of phage was calculated as the ratio of the final number of phage particles to the initial number of infected host cells at the beginning of the test (42).
Statistical analysis.
All experiments were performed in triplicates and the data presented as means with standard deviations. The graphs made in this study were produced using GraphPad Prism 7. A one-way ANOVA followed by a Tukey's post hoc analysis was used to determine the significance on the treatments (at 95% and 99% confidence interval). The differences between the means were considered statistically significant and extremely significant at P < 0.05 and P < 0.01.
Data availability.
The complete genome sequence of phage vB BD13 and vB STyj5-1 are available in the GenBank database, with the accession number OL451946.1 and MW423798.1.
ACKNOWLEDGMENTS
This work was supported by Natural Science Foundation of China (3187066); The National Key Research and Development (R&D) Program of China (2017YFC1600703); China Agriculture Research System of MOF and MARA (CARS-47).
Jing Zhang: Methodology, Writing. Houqi Ning: Methodology, Validation. Hong Lin: Validation. Jiaying She: Methodology. Luokai Wang: Methodology. Yujie Jing: Methodology. Jingxue Wang: Conceptualization, Funding acquisition and Validation.
We declare that they have no conflict of interests.
Footnotes
Supplemental material is available online only.
Contributor Information
Jingxue Wang, Email: snow@ouc.edu.cn.
Karyn N. Johnson, University of Queensland
REFERENCES
- 1.Zablocki O, Adriaenssens EM, Cowan D. 2016. Diversity and ecology of viruses in hyperarid desert soils. Appl Environ Microbiol 82:770–777. 10.1128/AEM.02651-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Ning H, Lin H, Wang J. 2021. Synergistic effects of endolysin Lysqdvp001 and ε-poly-lysine in controlling Vibrio parahaemolyticus and its biofilms. Int J Food Microbiol 343:109112. 10.1016/j.ijfoodmicro.2021.109112. [DOI] [PubMed] [Google Scholar]
- 3.Dedrick RM, Guerrero-Bustamante CA, Garlena RA, Russell DA, Ford K, Harris K, Gilmour KC, Soothill J, Jacobs-Sera D, Schooley RT, Hatfull GF, Spencer H. 2019. Engineered bacteriophages for treatment of a patient with a disseminated drug-resistant Mycobacterium abscessus. Nat Med 25:730–733. 10.1038/s41591-019-0437-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Gill JJ, Pacan JC, Carson ME, Leslie KE, Griffiths MW, Sabour PM. 2006. Efficacy and pharmacokinetics of bacteriophage therapy in treatment of subclinical Staphylococcus aureus mastitis in lactating dairy cattle. Antimicrob Agents Chemother 50:2912–2918. 10.1128/AAC.01630-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Lobocka M, Dabrowska K, Gorski A. 2021. Engineered bacteriophage therapeutics: rationale, challenges and future. Biodrugs 35:255–280. 10.1007/s40259-021-00480-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Tang F, Zhang P, Zhang Q, Xue F, Ren J, Sun J, Qu Z, Zhuge X, Li D, Wang J, Jiang M, Dai J. 2019. Isolation and characterization of a broad-spectrum phage of multiple drug resistant Salmonella and its therapeutic utility in mice. Microb Pathog 126:193–198. 10.1016/j.micpath.2018.10.042. [DOI] [PubMed] [Google Scholar]
- 7.Park H, Kim J, Kim M, Park Y, Ryu S. 2021. Development of new strategy combining heat treatment and phage cocktail for post-contamination prevention. Food Res Int 145:110415. 10.1016/j.foodres.2021.110415. [DOI] [PubMed] [Google Scholar]
- 8.Shahin K, Bao H, Zhu S, Soleimani-Delfan A, He T, Mansoorianfar M, Wang R. 2022. Bio-control of O157:H7, and colistin-resistant MCR-1-positive Escherichia coli using a new designed broad host range phage cocktail. LWT-Food Sci Technol 154:112836. 10.1016/j.lwt.2021.112836. [DOI] [Google Scholar]
- 9.Lin DM, Koskella B, Lin HC. 2017. Phage therapy: an alternative to antibiotics in the age of multi-drug resistance. World J Gastrointest Pharmacol Ther 8:162–173. 10.4292/wjgpt.v8.i3.162. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Chan BK, Abedon ST, Loc-Carrillo C. 2013. Phage cocktails and the future of phage therapy. Future Microbiol 8:769–783. 10.2217/fmb.13.47. [DOI] [PubMed] [Google Scholar]
- 11.Dunne M, Rupf B, Tala M, Qabrati X, Ernst P, Shen Y, Sumrall E, Heeb L, Plückthun A, Loessner MJ, Kilcher S. 2019. Reprogramming bacteriophage host range through structure-guided design of chimeric receptor binding proteins. Cell Rep 29:1336–1350. 10.1016/j.celrep.2019.09.062. [DOI] [PubMed] [Google Scholar]
- 12.Dunne M, Prokhorov NS, Loessner MJ, Leiman PG. 2021. Reprogramming bacteriophage host range: design principles and strategies for engineering receptor binding proteins. Curr Opin Biotechnol 68:272–281. 10.1016/j.copbio.2021.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Mahichi F, Synnott AJ, Yamamichi K, Osada T, Tanji Y. 2009. Site-specific recombination of T2 phage using IP008 long tail fiber genes provides a targeted method for expanding host range while retaining lytic activity. FEMS Microbiol Lett 295:211–217. 10.1111/j.1574-6968.2009.01588.x. [DOI] [PubMed] [Google Scholar]
- 14.Yehl K, Lemire S, Yang AC, Ando H, Mimee M, Torres MDT, De la Fuente-Nunez C, Lu TK. 2019. Engineering phage host-range and suppressing bacterial resistance through phage tail fiber mutagenesis. Cell 179:459–469. 10.1016/j.cell.2019.09.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Chen M, Zhang L, Abdelgader SA, Yu L, Xu J, Yao H, Lu C, Zhang W. 2017. Alterations in gp37 expand the host range of a T4-like phage. Appl Environ Microbiol 83:e01576. 10.1128/AEM.01576-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Ando H, Lemire S, Pires DP, Lu TK. 2015. Engineering modular viral scaffolds for targeted bacterial population editing. Cell Syst 1:187–196. 10.1016/j.cels.2015.08.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Flayhan A, Wien F, Paternostre M, Boulanger P, Breyton C. 2012. New insights into pb5, the receptor binding protein of bacteriophage T5, and its interaction with its Escherichia coli receptor FhuA. Biochimie 94:1982–1989. 10.1016/j.biochi.2012.05.021. [DOI] [PubMed] [Google Scholar]
- 18.Mondigler M, Ayoub AT, Heller KJ. 2006. The DNA region of phage BF23 encoding receptor binding protein and receptor blocking lipoprotein lacks homology to the corresponding region of closely related phage T5. J Basic Microbiol 46:116–125. 10.1002/jobm.200510047. [DOI] [PubMed] [Google Scholar]
- 19.Rabsch W, Ma L, Wiley G, Najar FZ, Kaserer W, Schuerch DW, Klebba JE, Roe BA, Gomez JAL, Schallmey M, Newton SMC, Klebba PE. 2007. FepA- and TonB-dependent bacteriophage H8: receptor binding and genomic sequence. J Bacteriol 189:5658–5674. 10.1128/JB.00437-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Bohm J, Lambert O, Frangakis AS, Letellier L, Baumeister W, Rigaud JL. 2001. FhuA-mediated phage genome transfer into liposomes: a cryo-electron tomography study. Curr Biol 11:1168–1175. 10.1016/S0960-9822(01)00349-9. [DOI] [PubMed] [Google Scholar]
- 21.Flayhan A, Vellieux FMD, Lurz R, Maury O, Contreras-Martel C, Girard E, Boulanger P, Breyton C. 2014. Crystal structure of pb9, the distal tail protein of bacteriophage T5: a conserved structural motif among all siphophages. J Virol 88:820–828. 10.1128/JVI.02135-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Golomidova AK, Kulikov EE, Prokhorov NS, Guerrero-Ferreira RС, Knirel YA, Kostryukova ES, Tarasyan KK, Letarov AV. 2016. Branched lateral tail fiber organization in T5-like bacteriophages DT57C and DT571/2 is revealed by genetic and functional analysis. Viruses 8:26. 10.3390/v8010026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Sváb D, Falgenhauer L, Rohde M, Szabó J, Chakraborty T, Tóth I. 2018. Identification and characterization of T5-Like bacteriophages representing two novel subgroups from food products. Front Microbiol 9:202. 10.3389/FMICB.2018.00202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Strotskaya A, Savitskaya E, Metlitskaya A, Morozova N, Datsenko KA, Semenova E, Severinov K. 2017. The action of Escherichia coli CRISPR-Cas system on lytic bacteriophages with different lifestyles and development strategies. Nucleic Acids Res 45:1946–1957. 10.1093/nar/gkx042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ramirez-Chamorro L, Boulanger P, Rossier O. 2021. Strategies for bacteriophage T5 mutagenesis: expanding the toolbox for phage genome engineering. Front Microbiol 12:667332. 10.3389/fmicb.2021.667332. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Heller KJ. 1984. Identification of the phage gene for host receptor specificity by analyzing hybrid phages of T5 and BF23. Virology 139:11–21. 10.1016/0042-6822(84)90325-8. [DOI] [PubMed] [Google Scholar]
- 27.Zivanovic Y, Confalonieri F, Ponchon L, Lurz R, Chami M, Flayhan A, Renouard M, Huet A, Decottignies P, Davidson AR, Breyton C, Boulanger P. 2014. Insights into bacteriophage T5 structure from analysis of its morphogenesis genes and protein components. J Virol 88:1162–1174. 10.1128/JVI.02262-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Lai M, Chang K, Huang S, Luo C, Chiou P, Wu C, Lin N. 2016. The Tail associated protein of Acinetobacter baumannii phage ΦAB6 is the host specificity determinant possessing exopolysaccharide depolymerase activity. PLoS One 11:e0153361. 10.1371/journal.pone.0153361. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Lenneman BR, Fernbach J, Loessner MJ, Lu TK, Kilcher S. 2021. Enhancing phage therapy through synthetic biology and genome engineering. Curr Opin Biotechnol 68:151–159. 10.1016/j.copbio.2020.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Kulikov EE, Golomidova AK, Prokhorov NS, Ivanov PA, Letarov AV. 2019. High-throughput LPS profiling as a tool for revealing of bacteriophage infection strategies. Sci Rep 9:2958. 10.1038/s41598-019-39590-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Maffei E, Shaidullina A, Burkolter M, Heyer Y, Estermann F, Druelle V, Sauer P, Willi L, Michaelis S, Hilbi H, Thaler DS, Harms A. 2021. Systematic exploration of Escherichia coli phage-host interactions with the BASEL phage collection. PLoS Biol 19:e3001424. 10.1371/journal.pbio.3001424. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Le S, He X, Tan Y, Huang G, Zhang L, Lux R, Shi W, Hu F. 2013. Mapping the tail fiber as the receptor binding protein responsible for differential host specificity of Pseudomonas aeruginosa bacteriophages PaP1 and JG004. PLoS One 8:e68562. 10.1371/journal.pone.0068562. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Heller K, Braun V. 1982. Polymannose O-antigens of Escherichia coli, the binding sites for the reversible adsorption of bacteriophage T5+ via the L-shaped tail fibers. J Virol 41:222–227. 10.1128/JVI.41.1.222-227.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Guan J, Ibarra D, Zeng L. 2019. The role of side tail fibers during the infection cycle of phage lambda. Virology 527:57–63. 10.1016/j.virol.2018.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Yoichi M, Abe M, Miyanaga K, Unno H, Tanji Y. 2005. Alteration of tail fiber protein gp38 enables T2 phage to infect Escherichia coli O157:H7. J Biotechnol 115:101–107. 10.1016/j.jbiotec.2004.08.003. [DOI] [PubMed] [Google Scholar]
- 36.Meier-Kolthoff JP, Auch AF, Klenk HP, Goker M. 2013. Genome sequence-based species delimitation with confidence intervals and improved distance functions. BMC Bioinf 14:60. 10.1186/1471-2105-14-60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Meier-Kolthoff JP, Goker M. 2017. VICTOR: genome-based phylogeny and classification of prokaryotic viruses. Bioinformatics 33:3396–3404. 10.1093/bioinformatics/btx440. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Bao H, Shahin K, Zhang Q, Zhang H, Wang Z, Zhou Y, Zhang X, Zhu S, Stefan S, Wang R. 2019. Morphologic and genomic characterization of a broad host range Salmonella enterica serovar Pullorum lytic phage vB_SPuM_SP116. Microb Pathog 136:103659. 10.1016/j.micpath.2019.103659. [DOI] [PubMed] [Google Scholar]
- 39.Lu Q. 2005. Seamless cloning and gene fusion. Trends Biotechnol 23:199–207. 10.1016/j.tibtech.2005.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Arai T, Aikawa S, Sudesh K, Kondo T, Kosugi A. 2022. Electrotransformation of thermophilic bacterium Caldimonas manganoxidans. J Microbiol Methods 192:106375. 10.1016/j.mimet.2021.106375. [DOI] [PubMed] [Google Scholar]
- 41.Xi H, Dai J, Tong Y, Cheng M, Zhao F, Fan H, Li X, Cai R, Ji Y, Sun C, Feng X, Lei L, Rahman SU, Han W, Gu J. 2019. The characteristics and genome analysis of vB_AviM_AVP, the first phage infecting Aerococcus viridans. Viruses 11:104. 10.3390/v11020104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Wang C, Chen Q, Zhang C, Yang J, Lu Z, Lu F, Bie X. 2017. Characterization of a broad host-spectrum virulent Salmonella bacteriophage fmb-p1 and its application on duck meat. Virus Res 236:14–23. 10.1016/j.virusres.2017.05.001. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig. S1 to S3. Download aem.00895-22-s0001.pdf, PDF file, 1.2 MB (1.2MB, pdf)
Data Availability Statement
The complete genome sequence of phage vB BD13 and vB STyj5-1 are available in the GenBank database, with the accession number OL451946.1 and MW423798.1.