Abstract
A gene encoding DNA ligase (ligTk) from a hyperthermophilic archaeon, Thermococcus kodakaraensis KOD1, has been cloned and sequenced, and its protein product has been characterized. ligTk consists of 1,686 bp, corresponding to a polypeptide of 562 amino acids with a predicted molecular mass of 64,079 Da. Sequence comparison with previously reported DNA ligases and the presence of conserved motifs suggested that LigTk was an ATP-dependent DNA ligase. Phylogenetic analysis indicated that LigTk was closely related to the ATP-dependent DNA ligase from Methanobacterium thermoautotrophicum ΔH, a moderate thermophilic archaeon, along with putative DNA ligases from Euryarchaeota and Crenarchaeota. We expressed ligTk in Escherichia coli and purified the recombinant protein. Recombinant LigTk was monomeric, as is the case for other DNA ligases. The protein displayed DNA ligase activity in the presence of ATP and Mg2+. The optimum pH of LigTk was 8.0, the optimum concentration of Mg2+, which was indispensable for the enzyme activity, was 14 to 18 mM, and the optimum concentration of K+ was 10 to 30 mM. LigTk did not display single-stranded DNA ligase activity. At enzyme concentrations of 200 nM, we observed significant DNA ligase activity even at 100°C. Unexpectedly, LigTk displayed a relatively small, but significant, DNA ligase activity when NAD+ was added as the cofactor. Treatment of NAD+ with hexokinase did not affect this activity, excluding the possibility of contaminant ATP in the NAD+ solution. This unique cofactor specificity was also supported by the observation of adenylation of LigTk with NAD+. This is the first biochemical study of a DNA ligase from a hyperthermophilic archaeon.
DNA ligases (EC 6.5.1.1 and EC 6.5.1.2) catalyze the phosphodiester bond formation between adjacent 3′-hydroxyl and 5′-phosphoryl groups at a single-strand break in double-stranded DNA (22). They are essential enzymes for maintaining the integrity of the genome during DNA replication (24), DNA excision repair (48), and DNA recombination (16). DNA strand breaks are commonly generated as reaction intermediates in these events, and the sealing of these breaks solely depends on the proper function of DNA ligase. Therefore, DNA ligases are indispensable enzymes in all organisms.
DNA ligases fall into two groups on the basis of the required cofactor for activity: the group requiring ATP (8) and the group requiring NAD+ (43). There is high similarity among the ligases within the ATP-dependent group (19) or NAD+-dependent group (42). ATP-dependent DNA ligase I from humans and Saccharomyces cerevisiae are 42% identical, and NAD+-dependent enzymes from Escherichia coli and Thermus thermophilus are 46% identical. However, enzymes between the two groups show no similarity, with the exception of the KXDG motif, which includes the active-site lysine (19). Furthermore, biochemical investigations have indicated that there is strict specificity towards the respective cofactors. This suggests that the two groups have evolved through completely different pathways.
It is now accepted that both ATP-dependent and NAD+-dependent DNA ligases catalyze their reactions through a common mechanism (7). The ligation reaction proceeds through three steps: (i) activation of the enzyme through the covalent addition of AMP to the conserved active-site lysine of the protein, accompanied by the release of PPi or nicotinamide mononucleotide from the cofactor (ATP or NAD+), (ii) transfer of AMP from the protein to the 5′-phosphoryl group of the nick on the DNA, and (iii) phosphodiester bond formation with concomitant release of free AMP from the adenylated DNA intermediate.
Biochemical and genetic studies have been performed for DNA ligases from various organisms. It has been shown that eukaryotes (17, 33, 46), viruses (29, 30), and bacteriophages (7, 20) harbor ATP-dependent enzymes. Although only a single type of DNA ligase has been reported for viruses and bacteriophages, eukaryotic organisms have multiple enzymes. Five distinct DNA ligases have been reported from mammalian cells (17, 33, 45, 46). ATP-dependent enzymes show a wide range in molecular mass, from 41 kDa (bacteriophage T7) (7) to 102 kDa (human DNA ligase I) (2). This considerable difference in size is mainly due to the diversity of the N-terminal region of each DNA ligase. DNA ligase I from humans includes a regulatory domain of 216 amino acid residues in its N-terminal region, which is dispensable for DNA ligase activity in vitro (5, 31). On the other hand, the C-terminal catalytic domain of DNA ligase I is highly similar among ATP-dependent DNA ligases (19, 47). The active-site lysine of these DNA ligases is mostly located at a distance of 332 ± 20 residues from the C terminus (47).
Various DNA ligases from bacteria (3, 15, 41, 42) have also been characterized and have been shown to utilize NAD+ as a cofactor. These enzymes include those from mesophiles, such as E. coli (11), and thermophilic bacteria, such as Bacillus stearothermophilus (3), T. thermophilus (41), Thermus scotoductus (42), and Rhodothermus marinus (42). The enzyme from T. thermophilus has been reported to show DNA ligase activity at temperatures of up to 85°C, with an optimal reaction temperature of approximately 70°C (41). Interestingly, genome analysis has indicated the presence of an ATP-dependent DNA ligase gene on the chromosome of the bacterium Aquifex aeolicus VF5 (6).
Little is known about DNA ligases from Archaea, the third kingdom of life. The recently reported ATP-dependent DNA ligase (Mth ligase) from Methanobacterium thermoautotrophicum ΔH, a moderate thermophilic archaeon, is the only enzyme that has been characterized (38). Genome analyses of hyperthermophilic archaeal strains, such as Pyrococcus abyssi (http://www.genoscope.cns.fr/Pab/), Archaeoglobus fulgidus (18), and Methanococcus jannaschii (4), have revealed the presence of putative DNA ligase genes on their genomes. The sequence of the gene from Desulfurolobus ambivalens has also been reported and compared with eukaryotic DNA ligases (19). Sequence comparison of these putative genes, along with the data from Mth ligase, indicates that archaeal enzymes are ATP dependent (19). Thermococcus kodakaraensis KOD1 (previously reported as Pyrococcus kodakaraensis KOD1) is a sulfur-reducing hyperthermophilic archaeon that was isolated from a geothermal spring in Kodakara Island, Kagoshima, Japan (28). We have been focusing on the biochemical and structural characterization of protein products of genes with putative functions, including archaeal DNA polymerase (14, 40), archaeal ribulose 1,5-bisphosphate carboxylase/oxygenase (9, 26), O6-methylguanine-DNA methyltransferase (13, 21), and archaeal aspartyl-tRNA synthetase (12, 35). As there is no information concerning DNA ligases from hyperthermophilic archaea, we performed detailed characterization of the protein product of a DNA ligase gene from T. kodakaraensis KOD1. This is the first characterization of a DNA ligase from a hyperthermophilic archaeon.
MATERIALS AND METHODS
Microbial strains, plasmids, phages, and media.
T. kodakaraensis KOD1 was cultivated using a medium described in the previous report (28). E. coli DH5α and the vector pUC19 were used for cloning and gene manipulation. E. coli XL1-Blue MRA (P2) (Stratagene, La Jolla, Calif.) was used as a host strain for λEMBL4 phage (Toyobo, Osaka, Japan). E. coli BL21(DE3)pLysS (Stratagene) and the vector pET21a(+) (Novagen, Madison, Wis.) were used for overexpression of ligTk. Luria-Bertani (LB) medium was used for the cultivation of E. coli, and NZYM medium was used for the amplification of phage (27).
Isolation of ligTk.
A genomic library was constructed from T. kodakaraensis KOD1 by using the λEMBL4 phage vector system. A DNA fragment containing a part of the ligTk gene was obtained through sequence analysis of the genome of T. kodakaraensis KOD1. A phage clone which carried the complete ligTk gene was screened from the genomic library by plaque hybridization using the DNA fragment as a probe.
DNA manipulation and sequencing.
For isolation of plasmid DNA, Plasmid Mini-, Midi-, and Lambda Kits (QIAGEN, Hilden, Germany) were used along with the alkaline extraction method (27). Restriction enzymes and modifying enzymes were purchased from Toyobo, Takara (Kyoto, Japan), and Boehringer GmbH (Mannheim, Germany). DNA sequencing on both strands of DNA was conducted using the ABI PRISM kit and Model 310 capillary DNA sequencer (Perkin-Elmer Applied Biosystems, Foster City, Calif.). Sequence data were analyzed and compared using DNASIS software package (Hitachi Software Engineering, Yokohama, Japan).
Phylogenetic analysis.
The multiple alignment of protein sequences and the identity and similarity between sequences were obtained with the program ALIGN contained within the ClustalW program provided by DNA Data Bank of Japan (DDBJ). The phylogenetic tree was constructed by the neighbor-joining method after alignment. Bootstrap resampling was performed with the BSTRAP program 2,000 times.
Cloning and expression of the ligTk gene.
Two oligonucleotides derived from the ligTk gene sequence were designed: a 5′-primer containing an NdeI site (in bold), 5′ CGGTGGTGCATATGAGCGATATGCGCTACTCTGAACTGG 3′, and a 3′ primer containing a BamHI site (in bold), 5′ CTCGGGATCCCTGGGAGGGAAAAGGAATCTCACTCGCC 3′. PCR was performed with these primers, along with the phage DNA as a template. The PCR product, cleaved with NdeI and BamHI, was inserted into an NdeI-BamHI site of pET-21a(+) (Novagen). The resulting plasmid pET-lig was transferred to E. coli BL21(DE3)pLysS. The transformants were cultivated in LB medium containing 50 μg of ampicillin/ml at 37°C until the optical density at 660 nm reached 1.0. Isopropyl-d-thiogalactopyranoside (IPTG) was added at a final concentration of 1 mM to induce ligTk gene expression for 6 h.
Purification of recombinant LigTk.
The cells were harvested by centrifugation (5,000 × g, 15 min, 4°C), washed with buffer A (50 mM Tris-HCl [pH 7.5], 10 mM MgCl2), and then resuspended in buffer A. The cells were disrupted by sonication, and the supernatant was obtained by centrifugation (12,000 × g, 30 min, 4°C). The soluble fraction of cell-free extract was heat treated at 80°C for 30 min, and the precipitate was removed by centrifugation (12,000 × g, 30 min, 4°C) to obtain thermostable proteins. The supernatant was applied to a ResourceQ column (Amersham Pharmacia Biotech, Uppsala, Sweden) equilibrated with buffer A. LigTk did not bind to the resin, and the flowthrough fractions were collected and applied to a cation-exchange column (ResourceS; Amersham Pharmacia Biotech) equilibrated with buffer B (50 mM Tris-HCl, pH 7.5). After washing with buffer B, the enzyme was eluted with a 0 to 1.0 M MgCl2 linear gradient with buffer B. The peak fractions containing LigTk, which eluted between 0.09 and 0.10 M MgCl2, were concentrated by using Centricon-30 (Millipore, Bedford, Mass.). The enzyme solution was applied to a gel filtration column (Superdex 200HR 10/30; Amersham Pharmacia Biotech) equilibrated with buffer C (50 mM Tris-HCl [pH 7.5], 100 mM MgCl2) and eluted with the same buffer. The active fractions were desalted with buffer B and used as purified LigTk in the following experiments. The protein concentration was determined by the Bio-Rad protein assay system (Bio-Rad, Hercules, Calif.) with bovine serum albumin as a standard. The N-terminal amino acid sequence of purified LigTk was determined by a protein sequencer (Model 270; Perkin-Elmer Applied Biosystems).
DNA substrates.
DNA ligase activity measurements were carried out with synthesized oligonucleotides consisting of a 5′-phosphorylated 30-mer (5′ P-CAGAGGATTGTTGACCGGCCCGTTTGTCAG 3′) and a 40-mer (5′ CGCACCGTGACGCCAAGCTTGCATTCCTACAGGTCGACTC-OH 3′) annealed to a complementary 80-mer (5′ CGTTGCTGACAAACGGGCCGGTCAACAATCCTCTGGAGTCGACCTGTAGGAATGCAAGCTTGGCGTCACGGTGCGCCAAC 3′).
DNA ligase assays.
Nick joining activity was measured by using the DNA substrates described above. Unless otherwise stated, ligation reaction mixtures (20 μl) contained 20 mM Bicine-KOH, pH 8.0, 15 mM MgCl2, 20 mM KCl, 1 mM ATP, 10 μM concentration of the 30-mer, 10 μM concentration of the 40-mer, 5 μM concentration of the 80-mer, and 200 nM LigTk. The enzyme and other constituents of the reaction mixture were incubated separately at the desired temperature, and reactions were initiated by mixing the two solutions. Standard reactions were carried out at 80°C for 15 min. The reactions were stopped by addition of 30 μl of loading buffer (98% [vol/vol] formamide, 10 mM EDTA, 0.05% [wt/vol] xylene cyanol FF) and cooling in ice water. The products (12 μl) were heated at 95°C for 3 min and then electrophoresed through a denaturing 6% polyacrylamide–7 M urea gel (18 cm [width] × 20 cm [height] × 0.5 mm). Super Reading DNA Sequence PreMix Solution (6%) (Toyobo) and Gel-Mix Running Mate TBE buffer (GIBCO BRL, Rockville, Md.) were used for electrophoresis. The gel was stained with ethidium bromide, and the 70-mer ligation product was quantified by densitometric analysis and Quantity One software (pdi; Huntington Station, N.Y.).
DNA ligase assays with labeled oligonucleotide.
A nonphosphorylated 30-mer oligonucleotide (5′ CAGAGGATTGTTGACCGGCCCGTTTGTCAG 3′) was synthesized and phosphorylated at its 5′ terminus by using [γ-32P]ATP. The oligonucleotide (10 pmol) was phosphorylated and radiolabeled by incubation with 1.85 MBq of [γ-32P]ATP (Amersham Pharmacia Biotech) and 10 U of T4 polynucleotide kinase (MEGALABEL; Takara) at 37°C for 30 min. The reaction product was purified by centrifugation through a CENTRI-SEP Spin Column (Perkin-Elmer Applied Biosystems). Nick joining activity was measured by using the DNA substrates described above. Ligation reaction mixtures (20 μl) contained 20 mM Bicine-KOH, pH 8.0, 15 mM MgCl2, 20 mM KCl, 1 mM ATP, 0.1 μM concentration of the labeled 30-mer, 0.1 μM concentration of the 40-mer, 0.1 μM concentration of the 80-mer, and 200 nM LigTk. The reaction was carried out at 80°C for 15 min and stopped by addition of 30 μl of loading buffer (98% [vol/vol] formamide, 10 mM EDTA, 0.05% [wt/vol] xylene cyanol FF) and cooling in ice water. The products (10 μl) were heated at 95°C for 3 min and then electrophoresed through a denaturing 6% polyacrylamide–7 M urea gel. Super Reading DNA Sequence PreMix Solution (6%) (Toyobo) and Gel-Mix Running Mate TBE buffer (GIBCO BRL) were used for electrophoresis. The gel was dried, and labeled oligonucleotides were detected by autoradiography.
Measurement of DNA ligase activity with other cofactors.
NAD+ and ADP were added at a concentration of 0.1 mM each, and reactions were carried out under the same conditions as when ATP was used as a cofactor. Methods used for detailed analysis of NAD+ utilization as a cofactor are described below.
Elimination of ATP from NAD+ solution.
NAD+ of the highest grade commercially available (99+%; Sigma, St. Louis, Mo.) was used for initial examination of cofactor specificity. We further eliminated any small traces of contaminant ATP enzymatically. ATP was eliminated from NAD+ solution by treating the solution with hexokinase (Sigma) and d-glucose. As a control, ATP solution was also treated with hexokinase. NAD+ solution (1 ml) contained 20 mM Tris-HCl (pH 7.5), 10 mM d-glucose, 10 mM MgCl2, 20 mM NAD+, and 0.2 U of hexokinase. ATP solution (1 ml) contained 20 mM Tris-HCl (pH 7.5), 10 mM d-glucose, 10 mM MgCl2, 2 mM ATP, and 0.2 U of hexokinase. One unit of hexokinase consumes 1.0 μmol of ATP to phosphorylate 1.0 μmol of d-glucose per min. Optimal conditions for the enzyme are pH 7.6 and 25°C. These solutions were incubated at 25°C for 2 h. After incubation, the enzyme was excluded from these solutions by using Centricon-10 (Millipore).
Adenylation of LigTk.
Adenylation of LigTk was performed with [α-32P]ATP or [adenylate-32P]NAD+, both with 32P in the phosphate group of the AMP moieties. The adenylation reaction mixture (20 μl) contained 20 mM Bicine-KOH, pH 8.0, 15 mM MgCl2, 200 nM LigTk, and 740 kBq of [α-32P]ATP (Amersham Pharmacia Biotech) or 258 kBq of [adenylate-32P]NAD+ (ICN Pharmaceuticals, Costa Mesa, Calif.). Reactions were carried out at 80°C for 2 h. The proteins were applied to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels, and after gels were dried, adenylated proteins were detected by autoradiography.
Nucleotide sequence accession number.
The gene sequence and deduced amino acid sequence of ligTk are available under the accession no. AB042527.
RESULTS
Cloning and nucleotide sequence of the DNA ligase gene (ligTk).
Through sequence analysis of the genome of T. kodakaraensis KOD1, we found a sequence with similarity to the DNA ligase gene of M. thermoautotrophicum. A genomic library was constructed from T. kodakaraensis KOD1 by using the λEMBL4 phage vector system. A phage clone harboring the complete open reading frame (ligTk) was isolated by plaque hybridization. We determined the nucleotide sequence of approximately 7 kbp within the isolated DNA fragment, in which the complete ligTk gene was included. ligTk consists of 1,686 bp, corresponding to a polypeptide of 562 amino acids with a predicted molecular mass of 64,079 Da.
Phylogenetic analysis of LigTk.
An unrooted phylogenetic tree of DNA ligases from various sources was constructed by the neighbor-joining method (Fig. 1). Phylogenetic analysis indicated that LigTk was closely related to Mth ligase, along with putative DNA ligases from Euryarchaeota and Crenarchaeota. These archaeal sequences showed close relationships with DNA ligase I from eukaryotes, suggesting that all archaeal DNA ligases, including LigTk, belong to the ATP-dependent group (19). The NAD+-dependent DNA ligases were considerably distant in the tree from ATP-dependent enzymes, indicating that ATP-dependent and NAD+-dependent enzymes are clearly different in primary structure.
Sequence comparison of LigTk with other ATP-dependent DNA ligases.
We compared the deduced amino acid sequence of LigTk with other previously reported ATP-dependent enzymes (Fig. 2). LigTk showed high identity with other archaeal DNA ligases: P. abysii (81%), A. fulgidus (53%) (18), M. jannaschii (43%) (4), M. thermoautotrophicum (43%) (37), Pyrobaculum aerophilum (40%) (http://genome.caltech.edu/pyrobaculum/), and D. ambivalens (39%) (19). Identity of LigTk with eukaryotic DNA ligase I was as follows: human (30%) (2) and S. cerevisiae (29%) (1). The C-terminal domain of human DNA ligase I has been reported to be responsible for enzymatic activity (44). As shown in Fig. 2, alignment of LigTk with human DNA ligase I indicated that LigTk corresponds to the C-terminal catalytic domain of human DNA ligase I. Other archaeal DNA ligases also showed the same tendency. Most residues that were conserved among all archaeal sequences were also conserved in the eukaryotic sequences. The only major region which was characteristic of the archaeal sequences was the region from Phe182 to Ala206 in LigTk. Thirteen of the 25 residues compared were similar (4 identical residues) in all archaeal sequences, while only five positions were similarly conserved in the eukaryotic ligases. There was also a 29-residue insertion in the human DNA ligase I and a 20-residue insertion in the enzyme from S. cerevisiae. Six motifs (I, III, IIIa, IV, V, VI) have been previously proposed to be conserved in various ATP-dependent DNA ligases (39). All motifs were found in LigTk and other archaeal sequences with the exception of motif V. Although motif V was conserved in the sequences from Crenarchaeota, half of the motif was lacking in all enzymes from Euryarchaeota, including LigTk. The crystal structure of the ATP-dependent DNA ligase from bacteriophage T7 complexed with ATP has been reported, and residues directly interacting with the ATP molecule have been identified (36, 39). The corresponding residues in the human DNA ligase I are Lys568, which covalently binds with AMP, Arg573, Arg589, and Glu621, which form hydrogen bonds with the ribose ring, Phe660, which stacks on the purine base, and Lys737 and Lys744, which contact the phosphate groups. Corresponding residues Lys252 (AMP binding), Arg257, Arg272, and Glu302 (ribose binding), Phe342 (purine stacking), and Lys423 (phosphate binding) were conserved in LigTk. However, an Asn416 residue replaced the position corresponding to Lys737 in the human enzyme.
Overexpression of ligTk and purification of the recombinant protein.
In order to examine the enzymatic properties of LigTk, we expressed ligTk in E. coli. Cells harboring the expression plasmid pET-lig were induced by IPTG. The cells were disrupted by sonication, and the recombinant protein was purified by heat treatment and column chromatography with ResourceQ, ResourceS, and Superdex-200 as described in Materials and Methods. Most proteins from E. coli were precipitated by heat treatment. ResourceQ column chromatography removed nucleic acids as well as proteins, and ResourceS and Superdex-200 chromatography provided the purified recombinant protein (Fig. 3). We could observe one major and two minor protein bands with apparent molecular masses of 62 kDa (band I), 56 kDa (band II), and 50 kDa (band III), respectively. As we have encountered some cases in which archaeal proteins showed aberrant migration rates on SDS-PAGE gels (10), the protein was denatured under various SDS and reducing-agent concentrations (data not shown). We found that the presence of the minor band II was inconsistent, and stronger denaturation conditions led to an increase in this band. This indicates that band II is a modified product of the intact protein during denaturation with SDS and reducing agents. We also determined the N-terminal amino acid sequence of band III. The sequence, FFSQPLTIKR, corresponded to residues 109 to 118 of LigTk, indicating that band III was a cleaved peptide fragment. The N-terminal amino acid sequence of major band I was SDMRYSELADLYRRLEK, identical to amino acid residues 2 to 18 in the deduced sequence of LigTk. Supported by these results, we performed further biochemical characterization of LigTk by using this enzyme fraction after gel filtration.
Subunit composition of recombinant LigTk.
We investigated the subunit composition of the purified enzyme by gel filtration chromatography. The native enzyme showed a molecular mass of 52.1 kDa (data not shown), indicating that LigTk was a monomeric enzyme.
Catalytic properties of LigTk.
We investigated the DNA ligase activity of recombinant LigTk. Enzymatic activity was measured by using complementary oligonucleotides shown in Materials and Methods (an 80-mer as a template and a complementary 30-mer and 40-mer). When the DNA substrates and LigTk were added to the reaction mixture, including 1 mM ATP, 15 mM MgCl2 and 20 mM KCl, we could clearly detect the 70-mer product after incubation at 80°C for 15 min (Fig. 4A, lane 2). The 70-mer was not detected prior to incubation and could not be observed when ATP was depleted from the reaction mixture (Fig. 4A, lanes 1 and 3). The results indicate that LigTk is an ATP-dependent DNA ligase. We also found that LigTk did not show ligase activity on single-stranded DNA substrates without template DNA, as no reaction product could be detected when the 80-mer oligonucleotide was not included in the reaction (Fig. 4A, lane 4). In order to confirm that the 70-mer product derived from the 30-mer and 40-mer substrates, we performed the same experiments with labeled substrates. The 5′ terminus of the 30-mer was phosphorylated using [γ-32P]ATP. We could clearly detect an enzyme-dependent 32P-labeled 70-mer product after the reaction, coinciding with a decrease in the 32P-labeled 30-mer substrate (Fig. 4B, lane 2).
We performed detailed investigations on the reaction conditions for the ligation activity of LigTk. The optimum pH was 8.0 (Fig. 5A). The optimum concentration of Mg2+, which was indispensable for enzyme activity, was 14 to 18 mM (Fig. 5B). A low concentration (0 to 100 mM) of a monovalent cation, K+, significantly stimulated the enzyme activity, with an optimum concentration of 10 to 30 mM (Fig. 5C). Under these optimum conditions, we performed a kinetic analysis of the ligation reaction (Fig. 5D). The reaction was linear for approximately 5 min and nearly complete at 60 min.
Effects of temperature and enzyme concentration on DNA ligase activity of LigTk.
We measured the DNA ligase activity of LigTk at various temperatures. When enzyme concentration was 20 nM (molar ratio of substrate to enzyme = 500:1), LigTk showed significant activity from 35 to 80°C, with an optimal temperature of 65°C (Fig. 6A). A drastic decrease in activity was observed between 80 and 85°C. However, when enzyme concentration was elevated to 200 nM (molar ratio of substrate to enzyme = 50:1), the drastic decrease in activity at temperatures above 80°C could not be observed (Fig. 6B). LigTk showed activity from 30 to 100°C, and the optimal temperature shifted to 70 to 80°C. It should be stressed that in these reactions, LigTk and DNA substrates were preincubated separately and mixed after reaching the respective temperatures.
Cofactor specificity of LigTk.
We have previously reported biochemical investigations on a number of archaeal enzymes from T. kodakaraensis KOD1 whose cofactor specificities differed from their eukaryotic or bacterial counterparts. Namely, aspartyl-tRNA synthetase utilized GTP and UTP as well as the usual ATP (12), while glutamine synthetase was found to utilize not only ATP but also GTP (32). We investigated the DNA ligase activity of LigTk using cofactors other than ATP. LigTk could not utilize ADP as a cofactor. To our surprise, we found that LigTk was able to utilize NAD+ as a cofactor (Fig. 7A). Although the enzymatic activity was lower than when ATP was used, a significant amount of 70-mer product could be observed with 0.1 mM NAD+ after 120 min. We could not detect such a product when no cofactor was added. We also detected DNA ligase activity with NAD+ at concentrations of 1 and 0.01 mM (data not shown). As DNA ligases have been reported to have strict cofactor specificity, we further examined the possibilities of contaminant ATP in our NAD+ solution. In the experiments above, we used NAD+ of the highest grade commercially available (99+%; Sigma). Although the possibilities of enzyme activity due to ATP contamination were low, we ensured the depletion of ATP by treating the NAD+ solution with hexokinase (Sigma) and d-glucose. We first examined the extent of ATP degradation with hexokinase. ATP was incubated with glucose and hexokinase at 25°C for 2 h, and after removal of hexokinase, ligation reactions were carried out. The 70-mer ligation product could not be detected using the hexokinase-treated ATP (Fig. 7B, lane 2). This indicated that the treatment with hexokinase was sufficient to degrade any contaminant ATP. We therefore performed the same hexokinase treatment with NAD+ prior to the ligation reaction. Using the hexokinase-treated NAD+, LigTk was still able to ligate the 30-mer and 40-mer, producing the 70-mer product (Fig. 7B, lane 4). ATP-dependent T4 DNA ligase did not show any activity when NAD+ solution with or without hexokinase treatment was added to the reaction mixture (data not shown). The results strongly indicate that LigTk, a predominantly ATP-dependent DNA ligase, can also utilize NAD+ as a cofactor.
We further pursued the utilization of NAD+ as a cofactor by examining the adenylation activity of LigTk. [α-32P]ATP and [adenylate-32P]NAD+, both with 32P in the phosphate group of the AMP moieties, were used to detect the enzyme-AMP complex. The radiolabeled cofactors were incubated along with the enzyme for 2 h at 80°C. Although the efficiency of adenylation was much lower than in the case of ATP, we found that NAD+ could also be utilized as an AMP donor for adenylation of LigTk (Fig. 8). This further strongly supports the utilization of NAD+ as a cofactor for DNA ligase activity of LigTk.
DISCUSSION
In this paper, we describe the biochemical characterization of a DNA ligase from a hyperthermophilic archaeon. Determination of the primary structure, expression of the ligTk gene, purification of the recombinant protein, and evaluation of its enzymatic properties have been performed. Through these studies, we have clearly indicated that LigTk harbors DNA ligase activity and that the activity is mainly dependent on ATP as a cofactor. The biochemical characterization of LigTk and Mth ligase (38), along with the high similarity among these enzymes and other putative archaeal DNA ligases, suggests that archaeal DNA ligases are predominantly ATP dependent. However, at present, information concerning archaeal DNA ligases is limited to those from thermophilic organisms, and we have no structural or biochemical information on DNA ligases from mesophilic archaea, such as halophiles.
Genome analyses of P. abyssi and M. jannaschii (4) have indicated the presence of only one DNA ligase gene in each organism. The genome of A. fulgidus (18) additionally harbors a short putative open reading frame (939 bp corresponding to 313 amino acid residues) slightly resembling a truncated DNA ligase gene, but there is only a single gene with high similarity to those of known DNA ligases. Judging from structural comparison, there seems to be only a single DNA ligase in hyperthermophilic archaea. In contrast, eukaryotic organisms have multiple DNA ligases which function to seal nicks in specific cellular events, such as DNA replication, DNA excision repair, and DNA recombination. The archaeal DNA ligases would have to function in all of these events.
Comparison of primary structures revealed that LigTk corresponded to the C-terminal domain (703 residues) of human DNA ligase I. DNA ligase I, which is involved in nick sealing during DNA replication, is often cleaved into two fragments during enzyme purification (25, 44). The C-terminal fragment alone displays DNA ligase activity in vitro. The N-terminal region of 118 amino acid residues has been reported to directly interact with the proliferating cell nuclear antigen (PCNA) (23, 34). PCNA binds to DNA polymerase δ during DNA replication, and after completion of the Okazaki fragment, it is left alone in this position after DNA polymerase δ is detached. The interaction between PCNA and the N-terminal region of DNA ligase I explains why DNA ligase I is uniquely able to function in DNA replication (23, 34). As LigTk corresponds to the C-terminal domain of DNA ligase I, it is of interest as to how the enzyme is recruited to the sites where it should function in vivo. Interestingly, putative genes with similarity to the eukaryotic PCNA gene have been identified in P. abyssi, M. jannaschii, and A. fulgidus.
In this study, we have found two unique features in LigTk. One is the ability to ligate DNA fragments at temperatures up to 100°C, which is supposed to be well above the calculated Tm values of the oligonucleotides. This could clearly be observed at high enzyme concentration (Fig. 6B). As LigTk showed no activity when template DNA was depleted, annealing of the substrates, in other words, a double-stranded DNA substrate, is necessary before the ligation reaction can occur. As we could detect a significant amount of 70-mer in the reaction at 100°C with LigTk at high concentration, this suggests that excess LigTk may somehow increase the population of double-stranded DNA substrates. This may occur by binding to double-stranded DNA substrates and lengthening their half-lives. Further studies will be necessary to elucidate this mechanism.
The most unique and unexpected property of LigTk is that the enzyme can utilize NAD+ as a cofactor. Experiments with hexokinase to eliminate contaminant ATP strongly confirm this unique property. Furthermore, we have also detected adenylation of LigTk using NAD+. Although specificity towards ATP is much higher, this is the first observation of an ATP-dependent DNA ligase able to utilize NAD+. The Mth ligase did not show activity with NAD+ as a cofactor (38). Comparison of primary structure and phylogenetic analysis of LigTk strongly indicate that the enzyme is an ATP-dependent DNA ligase. We found no significant similarity between LigTk and bacterial NAD+-dependent enzymes. At present, as we cannot identify a primary structural basis for utilization of NAD+, this unique cofactor specificity may be due to the fact that we were able to measure activities at high temperature, at which cofactor and/or substrate specificities may be less strict. Nevertheless, 80°C is a temperature at which the native host cell shows rapid growth, and the physiological relevance of this cofactor specificity should be addressed in future studies. Three-dimensional structural analysis should also provide the physical basis as to how LigTk utilizes NAD+.
ACKNOWLEDGMENTS
This work was partly supported to T.I. by Japan Science and Technology Corporation (JST) for Core Research for Evolutional Science and Technology (CREST).
REFERENCES
- 1.Barker D G, Johnson A L, Johnston L H. An improved assay for DNA ligase reveals temperature-sensitive activity in cdc9 mutants of Saccharomyces cerevisiae. Mol Gen Genet. 1985;200:458–462. doi: 10.1007/BF00425731. [DOI] [PubMed] [Google Scholar]
- 2.Barnes D E, Johnston L H, Kodama K, Tomkinson A E, Lasko D D, Lindahl T. Human DNA ligase I cDNA: cloning and functional expression in Saccharomyces cerevisiae. Proc Natl Acad Sci USA. 1990;87:6679–6683. doi: 10.1073/pnas.87.17.6679. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Brannigan J A, Ashford S R, Doherty A J, Timson D J, Wigley D B. Nucleotide sequence, heterologous expression and novel purification of DNA ligase from Bacillus stearothermophilus. Biochim Biophys Acta. 1999;1432:413–418. doi: 10.1016/s0167-4838(99)00122-3. [DOI] [PubMed] [Google Scholar]
- 4.Bult C J, White O, Olsen G J, Zhou L, Fleischmann R D, Sutton G G, Blake J A, FitzGerald L M, Clayton R A, Gocayne J D, Kerlavage A R, Dougherty B A, Tomb J F, Adams M D, Reich C I, Overbeek R, Kirkness E F, Weinstock K G, Merrick J M, Glodek A, Scott J L, Geoghagen N S M, Weidman J F, Fuhrman J L, Nguyen D, Utterback T R, Kelley J M, Peterson J D, Sadow P W, Hanna M C, Cotton M D, Roberts K M, Hurst M A, Kaine B P, Borodovsky M, Klenk H P, Fraser C M, Smith H O, Woese C R, Venter J C. Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii. Science. 1996;273:1058–1073. doi: 10.1126/science.273.5278.1058. [DOI] [PubMed] [Google Scholar]
- 5.Cardoso M C, Joseph C, Rahn H P, Reusch R, Nadal-Ginard B, Leonhardt H. Mapping and use of a sequence that targets DNA ligase I to sites of DNA replication in vivo. J Cell Biol. 1997;139:579–587. doi: 10.1083/jcb.139.3.579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Deckert G, Warren P V, Gaasterland T, Young W G, Lenox A L, Graham D E, Overbeek R, Snead M A, Keller M, Aujay M, Huber R, Feldman R A, Short J M, Olsen G J, Swanson R V. The complete genome of the hyperthermophilic bacterium Aquifex aeolicus. Nature. 1998;392:353–358. doi: 10.1038/32831. [DOI] [PubMed] [Google Scholar]
- 7.Doherty A J, Ashford S R, Subramanya H S, Wigley D B. Bacteriophage T7 DNA ligase. Overexpression, purification, crystallization, and characterization. J Biol Chem. 1996;271:11083–11089. doi: 10.1074/jbc.271.19.11083. [DOI] [PubMed] [Google Scholar]
- 8.Doherty A J, Wigley D B. Functional domains of an ATP-dependent DNA ligase. J Mol Biol. 1999;285:63–71. doi: 10.1006/jmbi.1998.2301. [DOI] [PubMed] [Google Scholar]
- 9.Ezaki S, Maeda N, Kishimoto T, Atomi H, Imanaka T. Presence of a structurally novel type ribulose-bisphosphate carboxylase/oxygenase in the hyperthermophilic archaeon, Pyrococcus kodakaraensis KOD1. J Biol Chem. 1999;274:5078–5082. doi: 10.1074/jbc.274.8.5078. [DOI] [PubMed] [Google Scholar]
- 10.Ezaki S, Miyaoku K, Nishi K, Tanaka T, Fujiwara S, Takagi M, Atomi H, Imanaka T. Gene analysis and enzymatic properties of thermostable β-glycosidase from Pyrococcus kodakaraensis KOD1. J Biosci Bioeng. 1999;88:130–135. doi: 10.1016/s1389-1723(99)80190-x. [DOI] [PubMed] [Google Scholar]
- 11.Feldberg R S, Young H, Morrice L F, Keir H M. Some observations on the cofactor requirement for partially purified DNA ligase from Escherichia coli. FEBS Lett. 1972;27:345–349. doi: 10.1016/0014-5793(72)80656-2. [DOI] [PubMed] [Google Scholar]
- 12.Fujiwara S, Lee S G, Haruki M, Kanaya S, Takagi M, Imanaka T. Unusual enzyme characteristics of aspartyl-tRNA synthetase from hyperthermophilic archaeon Pyrococcus sp. KOD1. FEBS Lett. 1996;394:66–70. doi: 10.1016/0014-5793(96)00904-0. [DOI] [PubMed] [Google Scholar]
- 13.Hashimoto H, Inoue T, Nishioka M, Fujiwara S, Takagi M, Imanaka T, Kai Y. Hyperthermostable protein structure maintained by intra and inter-helix ion-pairs in archaeal O6-methylguanine-DNA methyltransferase. J Mol Biol. 1999;292:707–716. doi: 10.1006/jmbi.1999.3100. [DOI] [PubMed] [Google Scholar]
- 14.Hashimoto H, Matsumoto T, Nishioka M, Yuasa T, Takeuchi S, Inoue T, Fujiwara S, Takagi M, Imanaka T, Kai Y. Crystallographic studies on a family B DNA polymerase from hyperthermophilic archaeon Pyrococcus kodakaraensis strain KOD1. J Biochem (Tokyo) 1999;125:983–986. doi: 10.1093/oxfordjournals.jbchem.a022405. [DOI] [PubMed] [Google Scholar]
- 15.Ishino Y, Shinagawa H, Makino K, Tsunasawa S, Sakiyama F, Nakata A. Nucleotide sequence of the lig gene and primary structure of DNA ligase of Escherichia coli. Mol Gen Genet. 1986;204:1–7. doi: 10.1007/BF00330179. [DOI] [PubMed] [Google Scholar]
- 16.Jessberger R, Berg P. Repair of deletions and double-strand gaps by homologous recombination in a mammalian in vitro system. Mol Cell Biol. 1991;11:445–457. doi: 10.1128/mcb.11.1.445. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Johnson A P, Fairman M P. The identification and purification of a novel mammalian DNA ligase. Mutat Res. 1997;383:205–212. doi: 10.1016/s0921-8777(97)00003-7. [DOI] [PubMed] [Google Scholar]
- 18.Klenk H P, Clayton R A, Tomb J F, White O, Nelson K E, Ketchum K A, Dodson R J, Gwinn M, Hickey E K, Peterson J D, Richardson D L, Kerlavage A R, Graham D E, Kyrpides N C, Fleischmann R D, Quackenbush J, Lee N H, Sutton G G, Gill S, Kirkness E F, Dougherty B A, McKenney K, Adams M D, Loftus B, Peterson S, Reich C I, McNeil L K, Badger J H, Glodek A, Zhou L, Overbeek R, Gocayne J D, Weidman J F, McDonald L, Utterback T, Cotton M D, Spriggs T, Artiach P, Kaine B P, Sykes S M, Sadow P W, D'Andrea K P, Bowman C, Fujii C, Garland S A, Mason T M, Olsen G J, Fraser C M, Smith H O, Woese C R, Venter J C. The complete genome sequence of the hyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus. Nature. 1997;390:364–370. doi: 10.1038/37052. [DOI] [PubMed] [Google Scholar]
- 19.Kletzin A. Molecular characterisation of a DNA ligase gene of the extremely thermophilic archaeon Desulfurolobus ambivalens shows close phylogenetic relationship to eukaryotic ligases. Nucleic Acids Res. 1992;20:5389–5396. doi: 10.1093/nar/20.20.5389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Knopf K W. Simple isolation method and assay for T4 DNA ligase and characterization of the purified enzyme. Eur J Biochem. 1977;73:33–38. doi: 10.1111/j.1432-1033.1977.tb11289.x. [DOI] [PubMed] [Google Scholar]
- 21.Leclere M M, Nishioka M, Yuasa T, Fujiwara S, Takagi M, Imanaka T. The O6-methylguanine-DNA methyltransferase from the hyperthermophilic archaeon Pyrococcus sp. KOD1: a thermostable repair enzyme. Mol Gen Genet. 1998;258:69–77. doi: 10.1007/s004380050708. [DOI] [PubMed] [Google Scholar]
- 22.Lehman I R. DNA ligase: structure, mechanism, and function. Science. 1974;186:790–797. doi: 10.1126/science.186.4166.790. [DOI] [PubMed] [Google Scholar]
- 23.Levin D S, Bai W, Yao N, O'Donnell M, Tomkinson A E. An interaction between DNA ligase I and proliferating cell nuclear antigen: implications for Okazaki fragment synthesis and joining. Proc Natl Acad Sci USA. 1997;94:12863–12868. doi: 10.1073/pnas.94.24.12863. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Li J J, Kelly T J. Simian virus 40 DNA replication in vitro. Proc Natl Acad Sci USA. 1984;81:6973–6977. doi: 10.1073/pnas.81.22.6973. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lindahl T, Barnes D E. Mammalian DNA ligases. Annu Rev Biochem. 1992;61:251–281. doi: 10.1146/annurev.bi.61.070192.001343. [DOI] [PubMed] [Google Scholar]
- 26.Maeda N, Kitano K, Fukui T, Ezaki S, Atomi H, Miki K, Imanaka T. Ribulose bisphosphate carboxylase/oxygenase from the hyperthermophilic archaeon Pyrococcus kodakaraensis KOD1 is composed solely of large subunits and forms a pentagonal structure. J Mol Biol. 1999;293:57–66. doi: 10.1006/jmbi.1999.3145. [DOI] [PubMed] [Google Scholar]
- 27.Maniatis T, Fritsch E F, Sambrook J. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory; 1989. [Google Scholar]
- 28.Morikawa M, Izawa Y, Rashid N, Hoaki T, Imanaka T. Purification and characterization of a thermostable thiol protease from a newly isolated hyperthermophilic Pyrococcus sp. Appl Environ Microbiol. 1994;60:4559–4566. doi: 10.1128/aem.60.12.4559-4566.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Odell M, Kerr S M, Smith G L. Ligation of double-stranded and single-stranded [oligo(dT)] DNA by vaccinia virus DNA ligase. Virology. 1996;221:120–129. doi: 10.1006/viro.1996.0358. [DOI] [PubMed] [Google Scholar]
- 30.Parks R J, Lichty B D, Karakis C, Evans D H. Characterization of the Shope fibroma virus DNA ligase gene. Virology. 1994;202:642–650. doi: 10.1006/viro.1994.1385. [DOI] [PubMed] [Google Scholar]
- 31.Prigent C, Lasko D D, Kodama K, Woodgett J R, Lindahl T. Activation of mammalian DNA ligase I through phosphorylation by casein kinase II. EMBO J. 1992;11:2925–2933. doi: 10.1002/j.1460-2075.1992.tb05362.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Rahman R N Z A, Jongsareejit B, Fujiwara S, Imanaka T. Characterization of recombinant glutamine synthetase from the hyperthermophilic archaeon Pyrococcus sp. strain KOD1. Appl Environ Microbiol. 1997;63:2472–2476. doi: 10.1128/aem.63.6.2472-2476.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Robins P, Lindahl T. DNA ligase IV from HeLa cell nuclei. J Biol Chem. 1996;271:24257–24261. doi: 10.1074/jbc.271.39.24257. [DOI] [PubMed] [Google Scholar]
- 34.Rossi R, Villa A, Negri C, Scovassi I, Ciarrocchi G, Biamonti G, Montecucco A. The replication factory targeting sequence/PCNA-binding site is required in G1 to control the phosphorylation status of DNA ligase I. EMBO J. 1999;18:5745–5754. doi: 10.1093/emboj/18.20.5745. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Schmitt E, Moulinier L, Fujiwara S, Imanaka T, Thierry J C, Moras D. Crystal structure of aspartyl-tRNA synthetase from Pyrococcus kodakaraensis KOD: archaeon specificity and catalytic mechanism of adenylate formation. EMBO J. 1998;17:5227–5237. doi: 10.1093/emboj/17.17.5227. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Shuman S. Closing the gap on DNA ligase. Structure. 1996;4:653–656. doi: 10.1016/s0969-2126(96)00070-6. [DOI] [PubMed] [Google Scholar]
- 37.Smith D R, Doucette-Stamm L A, Deloughery C, Lee H, Dubois J, Aldredge T, Bashirzadeh R, Blakely D, Cook R, Gilbert K, Harrison D, Hoang L, Keagle P, Lumm W, Pothier B, Qiu D, Spadafora R, Vicaire R, Wang Y, Wierzbowski J, Gibson R, Jiwani N, Caruso A, Bush D, Safer H, Patwell D, Prabhakar S, McDougall S, Shimer G, Goyal A, Pietrokovski S, Church G M, Daniels C J, Mao J-I, Rice P, Nölling J, Reeve J N. Complete genome sequence of Methanobacterium thermoautotrophicum ΔH: functional analysis and comparative genomics. J Bacteriol. 1997;179:7135–7155. doi: 10.1128/jb.179.22.7135-7155.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Sriskanda V, Kelman Z, Hurwitz J, Shuman S. Characterization of an ATP-dependent DNA ligase from the thermophilic archaeon Methanobacterium thermoautotrophicum. Nucleic Acids Res. 2000;28:2221–2228. doi: 10.1093/nar/28.11.2221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Subramanya H S, Doherty A J, Ashford S R, Wigley D B. Crystal structure of an ATP-dependent DNA ligase from bacteriophage T7. Cell. 1996;85:607–615. doi: 10.1016/s0092-8674(00)81260-x. [DOI] [PubMed] [Google Scholar]
- 40.Takagi M, Nishioka M, Kakihara H, Kitabayashi M, Inoue H, Kawakami B, Oka M, Imanaka T. Characterization of DNA polymerase from Pyrococcus sp. strain KOD1 and its application to PCR. Appl Environ Microbiol. 1997;63:4504–4510. doi: 10.1128/aem.63.11.4504-4510.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Takahashi M, Yamaguchi E, Uchida T. Thermophilic DNA ligase. Purification and properties of the enzyme from Thermus thermophilus HB8. J Biol Chem. 1984;259:10041–10047. [PubMed] [Google Scholar]
- 42.Thorbjarnardottir S H, Jonsson Z O, Andresson O S, Kristjansson J K, Eggertsson G, Palsdottir A. Cloning and sequence analysis of the DNA ligase-encoding gene of Rhodothermus marinus, and overproduction, purification and characterization of two thermophilic DNA ligases. Gene. 1995;161:1–6. doi: 10.1016/0378-1119(95)00286-f. [DOI] [PubMed] [Google Scholar]
- 43.Timson D J, Wigley D B. Functional domains of an NAD+-dependent DNA ligase. J Mol Biol. 1999;285:73–83. doi: 10.1006/jmbi.1998.2302. [DOI] [PubMed] [Google Scholar]
- 44.Tomkinson A E, Lasko D D, Daly G, Lindahl T. Mammalian DNA ligases. Catalytic domain and size of DNA ligase I. J Biol Chem. 1990;265:12611–12617. [PubMed] [Google Scholar]
- 45.Tomkinson A E, Mackey Z B. Structure and function of mammalian DNA ligases. Mutat Res. 1998;407:1–9. doi: 10.1016/s0921-8777(97)00050-5. [DOI] [PubMed] [Google Scholar]
- 46.Tomkinson A E, Roberts E, Daly G, Totty N F, Lindahl T. Three distinct DNA ligases in mammalian cells. J Biol Chem. 1991;266:21728–21735. [PubMed] [Google Scholar]
- 47.Tomkinson A E, Totty N F, Ginsburg M, Lindahl T. Location of the active site for enzyme-adenylate formation in DNA ligases. Proc Natl Acad Sci USA. 1991;88:400–404. doi: 10.1073/pnas.88.2.400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Wood R D, Robins P, Lindahl T. Complementation of the xeroderma pigmentosum DNA repair defect in cell-free extracts. Cell. 1988;53:97–106. doi: 10.1016/0092-8674(88)90491-6. [DOI] [PubMed] [Google Scholar]