Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2000 Dec;182(24):6975–6982. doi: 10.1128/jb.182.24.6975-6982.2000

Mutational Analysis of Conserved Residues in the Putative DNA-Binding Domain of the Response Regulator Spo0A of Bacillus subtilis

Janet K Hatt 1,*, Philip Youngman 2
PMCID: PMC94823  PMID: 11092858

Abstract

The Spo0A protein of Bacillus subtilis is a DNA-binding protein that is required for the expression of genes involved in the initiation of sporulation. Spo0A binds directly to and both activates and represses transcription from the promoters of several genes required during the onset of endospore formation. The C-terminal 113 residues are known to contain the DNA-binding activity of Spo0A. Previous studies identified a region of the C-terminal half of Spo0A that is highly conserved among species of endospore-forming Bacillus and Clostridium and which encodes a putative helix-turn-helix DNA-binding domain. To test the functional significance of this region and determine if this motif is involved in DNA binding, we changed three conserved residues, S210, E213, and R214, to Gly and/or Ala by site-directed mutagenesis. We then isolated and analyzed the five substitution-containing Spo0A proteins for DNA binding and sporulation-specific gene activation. The S210A Spo0A mutant exhibited no change from wild-type binding, although it was defective in spoIIA and spoIIE promoter activation. In contrast, both the E213G and E213A Spo0A variants showed decreased binding and completely abolished transcriptional activation of spoIIA and spoIIE, while the R214G and R214A variants completely abolished both DNA binding and transcriptional activation. These data suggest that these conserved residues are important for transcriptional activation and that the E213 residue is involved in DNA binding.


The Spo0A protein of Bacillus subtilis is a member of the phosphorylation-activated response regulator family of two-component signal transduction proteins (3, 16, 35, 42) and is required in a signal transduction pathway that controls the initiation of sporulation in response to nutrient limitation (10, 47). Spo0A functions as both a repressor and activator of gene transcription during the transition from exponential growth to the stationary phase (43) and during the early stages of sporulation (39, 45, 47). Phosphorylated Spo0A represses the transcription of a key transition state regulator, AbrB, by binding to the promoter of the abrB gene (43, 45). In addition, phosphorylated Spo0A is required for the activation of transcription of key sporulation-specific genes, which include spoIIA (47), spoIIE (53), and spoIIG (6, 7). Spo0A has been shown to bind to specific sequences in the DNA upstream of the promoters it positively regulates and downstream of the promoters it negatively regulates (41). The Spo0A recognition sequence in DNA is referred to as the 0A box and consists of the 7-bp sequence 5′-TGTCGAA-3′ (6, 43).

The response regulator family of two-component signal transduction proteins is characterized by a conserved amino-terminal phosphoacceptor domain and unique carboxyl-terminal effector domains (3, 35, 42) (see Fig. 1A). Response regulators that function as transcription factors, i.e., OmpR (38), UhpA (28), and others (3, 35, 42), generally consist of two domains: the phosphoacceptor domain and an effector domain containing DNA-binding and transcriptional activation functions. The phosphoacceptor domain functions as a receiver of a signal from a protein that senses the environment and is phosphorylated to activate the effector functions. The Spo0A protein consists of this two-domain structure, with DNA-binding and transcriptional activation functions residing in the carboxyl-terminal domain (18) (see Fig. 1A). Recent studies (9, 24) have identified residues of the carboxyl-terminal effector domain involved in transcriptional activation at Spo0A-dependent, ςA-dependent promoters. However, the residues of Spo0A involved in DNA binding have yet to be identified.

FIG. 1.

FIG. 1

(A) Domain structure of Spo0A and the mutations examined in this study. The N-terminal half of Spo0A to residue 127 forms the conserved phosphoacceptor domain, which contains the presumed site of phosphorylation, D56. The C-terminal 113 residues form the effector domain of Spo0A, which contains a putative HTH DNA-binding domain from residue 198 to residue 218 (shaded box) identified by Brown et al. (8) and a transcriptional activation domain (ςA AR) from residue 227 to residue 240 (solid box) (24). The sequence of the proposed HTH DNA-binding domain, which includes a stretch of 15 amino acids perfectly conserved among four diverse species of Bacillus and Clostridium, is shown. Residues in the recognition helix of the putative HTH domain examined in this study are indicated. (B) Helical-wheel projection of the putative HTH recognition helix from residue A209 to residue E221. Residues changed in this study are in bold. Alanine substitutions were made at all three of the changed residues, and glycine substitutions were made at both E213 and R214.

Brown et al. (8) have identified a region of the Spo0A effector domain that is a strong candidate to contain a DNA-binding function. An alignment of the amino acid sequences of multiple Spo0A homologs from diverse Bacillus and Clostridium species revealed three regions of high conservation in the effector domain of the Spo0A protein. One region consists of 15 amino acids perfectly conserved among four diverse species and contains features in common with a helix-turn-helix (HTH) DNA-binding domain. Analysis by the Dodd and Egan weight matrix (12) scored this region as positive for a putative HTH DNA-binding domain. This scoring matrix utilizes a reference set of proteins that includes 91 proteins with known HTH or suspected HTH DNA-binding domains for comparison (12). Therefore, the high conservation seen in the Spo0A homologs from bacteria that had been diverged for over a billion years and the predicted fit we saw by the Dodd and Egan analysis (8) argue strongly that this conserved region is of functional significance and possibly contains an HTH DNA-binding domain.

To test the functional significance of this putative HTH DNA-binding motif of Spo0A and to further define the structure and function of the effector domain of Spo0A, we used site-directed mutagenesis to make Gly and/or Ala changes in residues of this conserved stretch of Spo0A. We then analyzed the effects of the substitutions on sporulation, sporulation-specific transcriptional activation and repression, and DNA binding.

MATERIALS AND METHODS

Bacterial strains, culture media, genetic techniques, and in vitro manipulation of DNA.

Bacterial strains used in this work are listed in Table 1. Oligonucleotides used in this work are listed in Table 2. Routine microbiological procedures and enzymatic manipulations of DNA were carried out using standard methods (5, 23). The concentrations of antibiotics used for selection on Luria-Bertani (LB) or Difco sporulation medium (DSM) agar and in culture were 5 μg/ml for chloramphenicol, 3 μg/ml for neomycin, 100 μg/ml for spectinomycin, and 100 μg/ml for ampicillin.

TABLE 1.

Bacterial strains used in this work

Strain Genotype of description Reference
E. coli
  BL21(DE3)/ pLysS F−ompT hsdSB(rB− mB−) dcm gal λ(DE3) pLysS 46
B. subtilis
  PY79 Prototroph 55
  JKH72 PY79 spoIIA::pPP81 spoIIE::pJKH9 24
  JKH73 JKH72 spo0A::pSPC101-0A 24
  JKH75 JKH72 spo0A::pSPC101-0A null 24
  JKH167 JKH72 spo0A::pSPC101-0A S210A This work
  JKH168 JKH72 spo0A::pSPC101-0A E213G This work
  JKH169 JKH72 spo0A::pSPC101-0A E213A This work
  JKH170 JKH72 spo0A::pSPC101-0A R214G This work
  JKH171 JKH72 spo0A::pSPC101-0A R214A This work
  JKH175 PY79 spo0A::pSPC101-0A SPβ abrB-lacZ This work
  JKH176 PY79 spo0A::pSPC101-0A null SPβ abrB-lacZ This work
  JKH177 PY79 spo0A::pSPC101-0A S210A SPβ abrB-lacZ This work
  JKH178 PY79 spo0A::pSPC101-0A E213G SPβ abrB-lacZ This work
  JKH179 PY79 spo0A::pSPC101-0A E213A SPβ abrB-lacZ This work
  JKH180 PY79 spo0A::pSPC101-0A R214G SPβ abrB-lacZ This work
  JKH182 PY79 spo0A::pSPC101-0A R214A SPβ abrB-lacZ This work

TABLE 2.

Oligonucleotides

Oligonu- cleotide Sequence (5′ to 3′)
STOM CCCTGTGACTGGTGACGCGTCAACCAAGTC
S210G/A CTTTCTACACGGC/GCTGCGGTTGTG
E213G/A GGATCGCTCTTC/GCTACACGGC
R214G/A GCGGATCGCTC/GCTTCTACACG
0ANdeI GGGGAGGAAGACATATGGAGAAAA
0A4HindIII GCAGGAAGCTTCGCCTCCTATTTATCAGCGC
0ABoxa TTTGGTATTGTTACCTTCTTTCGACAAAATCCTATCTGTGCT
0ABoxb AAAGCACAGATAGGATTTTGTCGAAAGAAGGTAACAATACCA
ΔBoxa TTTGGTATTGTTACCTTCTAGGCCCTAAATCCTATCTGTGCT
ΔBoxb AAAGCACAGATAGGATTTAGGGCCTAGAAGGTAACAATACCA

Site-directed mutagenesis and mutant strain construction.

Site-specific mutations in spo0A were made using the Unique Site Elimination mutagenesis kit (Pharmacia) based on the method of Deng and Nickoloff (11). Mutagenesis and selection were carried out according to the manufacturer's instructions. The desired base substitutions were made directly in a pKK223-3-0A clone using mutagenic primers S210G/A, E213G/A, and E214G/A and the selection primer STOM (Table 2). Each mutagenic primer was designed with degeneracy to allow the introduction of mutations that would result in both the glycine and alanine substitutions desired. The presence of the desired mutation was confirmed by sequencing the spo0A allele from positive clones using the fmol sequencing kit (Promega). The mutant spo0A alleles were then subcloned into the pSPC101 integrational vector (24) on a BglII-HindIII fragment containing a portion of the spo0A gene and the relevant mutations. The mutant alleles were subsequently introduced into B. subtilis JKH72 by transformation with selection for spectinomycin resistance. Spectinomycin-resistant transformants resulted from a single reciprocal recombination event between mutant spo0A sequences and the chromosomal spo0A locus generating a single intact copy of the spo0A gene. The presence of the mutation was verified by PCR amplification and sequencing of the intact copy of the spo0A gene from these strains.

Sporulation frequency assay.

B. subtilis strains were grown with shaking at 37°C in DSM containing the appropriate antibiotics until 12 h after entry into stationary phase. The number of viable cells was then determined by dilution and plating onto LB agar containing the appropriate antibiotics. The number of chloroform-resistant spores was determined by a 10-min incubation of 0.45 ml of culture with 50 μl of chloroform at room temperature (RT) and dilution and plating. The sporulation frequency was defined as the number of chloroform-resistant spores compared to the total number of viable cells before chloroform treatment. The sporulation frequency for each mutant was calculated as the average of at least three independent assays.

β-Galactosidase and β-glucuronidase assays.

β-Galactosidase assays were performed by the fluorometric method of Youngman (54). Control and mutant spo0A strains containing both a spoIIA-lacZ transcriptional fusion and a spoIIE-gus transcriptional fusion were grown as previously described (24). Bacteria were cultured for assay at 37°C with shaking. At various intervals during growth and sporulation, 0.5-ml samples were collected and frozen in liquid nitrogen. Samples were stored at −70°C until assayed.

β-Glucuronidase assays were done in an identical manner except that 0.4 mg of 4-methylumbelliferyl-β-d-glucuronide trihydrate substrate (MUGluc) (U.S. Biological) per ml specific to β-glucuronidase was used instead of 0.4 mg of 4-methlyumbelliferyl-β-d-galactoside (MUGal) (U.S. Biological) per ml. One unit of activity was defined as 1 pmol of MUGluc or MUGal hydrolyzed per ml of culture sample per min, normalized for culture cell density (turbidity). Each sample was assayed for both β-glucuronidase and β-galactosidase activities.

Wild-type and mutant spo0A strains containing an abrB-lacZ transcriptional fusion were grown, and samples for assay were collected in the manner described above except that the medium used for growth contained chloramphenicol and spectinomycin. β-Galactosidase assays were done as described above.

Immunoblot detection of Spo0A proteins.

Polyclonal anti-Spo0A antibodies were isolated previously (6). Samples (10 to 25 ml) of B. subtilis cultures grown in DSM at 37°C with shaking were collected, the cells were harvested at various time points, and cell lysates were prepared as previously described (24). Total protein was quantitated using the Bio-Rad protein microassay procedure as described by the manufacturer. Protein samples (1.25 to 5.0 μg) were separated by electrophoresis through a sodium dodecyl sulfate–12% polyacrylamide gel. Proteins were electroblotted onto a PVDF-Plus membrane (Micron Separations, Inc.).

The membrane was treated as previously described (24). Spo0A antiserum was used at a dilution of 1:15,000 in Tris-buffered saline–Tween (100 mM Tris-Cl [pH 8.0], 0.9% NaCl, 0.05% Tween) (TBST) containing 1% bovine serum albumin (BSA), and the secondary goat anti-rabbit immunoglobulin G-horseradish peroxidase conjugate (Promega) was used at a dilution of 1:3,000 in TBST with 1% BSA. The Spo0A proteins were visualized by the Renaissance chemiluminescent reagent (DuPont, NEN), used according to the manufacturer's instructions. Treated membranes were immediately exposed to X-ray film for 10 to 60 s.

Spo0A purification.

Wild-type and mutant spo0A alleles were amplified using either the 0ANdeI and pUCrev primers or the 0ANdeI and 0A4HindIII primers (Table 2) as forward and reverse primers, respectively. The products were then inserted in frame with the His-tag coding sequence between the NdeI and HindIII sites of the pET15b expression vector (Novagen). All proteins were isolated from Escherichia coli strain BL21(DE3)/pLysS containing the pET15b derivatives of the spo0A alleles. E. coli strains were grown at 37°C with shaking in LB medium (1 liter) containing 100 μg of ampicillin per ml and 35 μg of chloramphenicol per ml to an optical density at 600 nm of 0.6 and induced with 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) for 3 to 4 h to overproduce Spo0A proteins. After induction, cells were harvested by centrifugation at 6,000 rpm at 4°C for 10 min in a Beckman JA-10 rotor and then washed with 0.25 volume of cold 50 mM Tris-HCl (pH 8.0)–2 mM EDTA. Cells were repelleted, quick-frozen in liquid nitrogen, and stored at −70°C until needed.

Cell pellets were resuspended in 10 ml of 20 mM Tris-HCl (pH 8.0)–500 mM NaCl–1 mM phenylmethylsulfonyl fluoride (buffer A) containing 20 mM imidazole, and the cells were lysed by two passages through a French pressure cell at 19,000 lb/in2. The cells were centrifuged in a Beckman JA-20 rotor first at 7,000 rpm at 4°C for 20 min to remove cell debris and then at 17,000 rpm at 4°C for 1 h. The cleared lysate was then filtered through a 0.45-μm-pore-size filter (Gelman Sciences), and the His-tagged proteins were adsorbed to 0.75 ml of Ni2+-nitrolotriacetic acid matrix (Qiagen) previously equilibrated with buffer A. After a 4-h incubation with gentle rocking, the matrix was packed into a disposable column (Bio-Rad) and washed with 9 ml of buffer A containing 45 mM imidazole. The His-tagged proteins were then eluted with 3 ml of buffer A containing 250 mM imidazole. The purified proteins were dialyzed overnight at 4°C in 2 liters of storage buffer (20 mM Tris-HCl [pH 8.0], 150 mM KCl, 1 mM dithiothreitol, and 20% glycerol), with an additional buffer change in the morning. Protein purity was verified by Coomassie blue staining of polyacrylamide gels, and protein concentrations were determined using the Bio-Rad protein microassay with BSA as a standard.

Electrophoretic gel mobility shift assays.

Oligonucleotides 0ABoxa and 0ABoxb (Table 2) were annealed to create a double-stranded 40-bp fragment corresponding to the spoIIE promoter sequence from position −59 to position −20 with a change at position −40 from a TA to a CG base pair to generate a consensus 0A box sequence (5′-TGTCGAA-3′) . Oligonucleotides ΔBoxa and ΔBoxb (Table 2) were annealed to create a second double-stranded 40-bp fragment with six base pair substitutions in the 0A box to destroy the binding site. Double-stranded fragments were 5′ end labeled with T4 polynucleotide kinase (Promega) and [γ-32P]ATP (6,000 Ci mmol−1) as previously described (5).

DNA-binding assays contained up to 69 μM purified protein (30 μg) and 1 ng of a 40-bp fragment in 15 μl of a solution of 10 mM HEPES (pH 8.0), 50 mM KCl, 5 mM MgCl2, 1 mM EDTA, 5 mM dithiothreitol, 10% glycerol, and 1 μg of salmon sperm DNA, unless otherwise noted. DNA was incubated for 2 min at RT, the binding was initiated by the addition of purified protein, and the mixture was incubated for 20 min at RT. Specific and nonspecific unlabeled competitor DNA fragments (up to 100 ng) were included in some experiments. Electrophoresis was performed for 1 to 2 h at RT with a 15-mA constant current through 5% nondenaturing polyacrylamide slab gels equilibrated and prerun for at least 1 h in 0.25× Tris-borate-EDTA buffer. Gels were dried before autoradiography.

RESULTS

Rationale and construction of mutations in the putative HTH DNA-binding domain of Spo0A.

To determine the functional significance of a highly conserved stretch of amino acid sequence in the carboxyl-terminal effector domain of Spo0A from B. subtilis, we used site-directed mutagenesis to make specific amino acid substitutions in the coding sequence (Fig. 1). The residues targeted for mutagenesis were chosen on the basis of the polar nature of their side chains. Crystallographic and genetic studies have identified specificity-determining contacts between DNA and many HTH-containing proteins, which include CAP (13–15, 56), λ cI Rep (26, 27), 434 Rep (4, 50), and TrpR (20, 32, 37). What is apparent from these studies is that while not all specificity-determining contacts occur in the second helix, or “recognition helix,” of the HTH-binding motif, polar residues in this helix are important for sequence-specific recognition (22, 33, 34). Quite often, residues 1, 2, 5, and 6 have been shown to play a critical role in specificity determination, and it is thought that residues such as Gln, Asn, Ser, Tyr, Arg, Lys, Glu, and His are commonly used for DNA recognition (22, 33, 34). In addition, helical-wheel projections of the second helix of the putative Spo0A HTH motif show that this helix has an amphipathic character in which hydrophobic residues are clustered on one side of the helix and hydrophilic ones are clustered on the other (Fig. 1B). This structure would allow the hydrophobic side to face the protein core and the hydrophilic residues on the opposite face to contribute sequence-specific contacts to the DNA.

Using these facts as a guide, we chose four polar or charged residues, S210, R211, E213, and E214 (Fig. 1B), in the putative recognition helix of Spo0A as candidates for site-directed mutagenesis. We attempted to make Gly and Ala changes at each position in the hope of isolating mutants that would be deficient in DNA binding but would not introduce altered specificities for binding or perturb the DNA structure drastically. We isolated five mutants that were examined further in this study. The mutants isolated had a Ser-to-Ala change at position 210, Glu-to-Gly and Glu-to-Ala changes at position 213, and Arg-to-Gly and Arg-to-Ala changes at position 214 of the Spo0A coding sequence. Below, each mutant is referred to by its amino acid change as follows: S210A, E213G, E213A, R214G, and R214A. Repeated attempts to isolate a mutant with a Gly substitution at 210 and Gly and Ala substitutions at 211 failed.

Sporulation phenotype of Spo0A mutants in B. subtilis.

To determine the sporulation phenotype of the Spo0A mutants, mutant spo0A alleles were subcloned into the integrational vector pSPC101 and introduced into B. subtilis JKH72. When screening was performed with DSM plates, which allowed us to directly score the sporulation phenotype by colony morphology, all of the mutants except S210A exhibited a Spo− phenotype and failed to sporulate efficiently.

We next quantitated the sporulation defect in the mutant strains (Table 3), and consistent with the results of the plate assay, the strains that exhibited a Spo− phenotype on plates had severely decreased spore production. The S210A strain, which had a Spo+ phenotype on plates, was able to sporulate but had a slight defect in spore formation.

TABLE 3.

Sporulation frequencies

Spo0A strain Description Sporulation frequencya
JKH175 Wild type 0.83
JKH176 Null <0.000001
JKH177 S210A 0.64
JKH178 E213G <0.000001
JKH179 E213A 0.0000348
JKH180 R214G 0.000365
JKH182 R214A 0.0000114
a

Sporulation frequency was calculated as the fraction of the viable count surviving chloroform selection and represents an average of at least three independent experiments. 

Effect of Spo0A mutants on transcriptional activation of sporulation-specific genes.

Sporulation-specific gene expression was assessed by β-galactosidase and β-glucuronidase assays on strains containing mutant Spo0A derivatives and both a spoIIA-lacZ and a spoIIE-gus transcriptional fusion. These two promoters require Spo0A and different forms of RNA polymerase holoenzyme for transcription and therefore represent two different classes of Spo0A-dependent promoters (51–53). Since these two promoters contain multiple Spo0A binding sites and since transcription requires the spo0A gene product (6, 47, 53), we expected that amino acid substitutions in Spo0A that result in a DNA-binding defect would eliminate activation by Spo0A. The ability of mutant Spo0A to activate the transcription of the spoIIA and spoIIE genes was assayed at intervals through the end of the exponential phase and 6 h into the stationary phase (Fig. 2). A strain containing an insertional disruption of the spo0A gene (null) was included as a negative control.

FIG. 2.

FIG. 2

Effects of spo0A mutants on transcriptional activation at Spo0A-dependent promoters. The effects of spo0A mutants on the expression of spoIIA-lacZ (A) and spoIIE-gus (B) transcriptional fusions are shown. Samples were collected and assayed as described in Materials and Methods. T0 marks the end of exponential growth. Samples were collected at half-hour time points from T−2 until T1 and then hourly until T6. Solid circles, wild type; open squares, the Spo0A null strain; inverted solid triangles, S210A; open diamonds, E213G; solid diamonds, E213A; open triangles, R214G; solid triangles, R214A. Data were averaged from at least three independent trials. Error bars represent the standard errors of the means. One unit of activity is defined as 1 pmol of MUGluc or MUGal hydrolyzed per ml of culture sample per min, normalized for culture cell density (turbidity) (54).

The expression of Spo0A-dependent genes was severely decreased in the strains that were phenotypically Spo− on DSM agar plates (E213G, E213A, R214G, and R214A) compared to wild-type expression (Fig. 2). The decreases in expression in these strains were indistinguishable from that of the null strain. Surprisingly, the S210A strain, which is phenotypically Spo+ on DSM agar plates, showed significantly decreased transcription from both promoters (Fig. 2). However, since sporulation efficiency is not decreased significantly unless spoIIE (21) and spoIIG (9, 40) transcription is reduced to less than 10% of that of the wild type, this result is consistent with the Spo+ phenotype of the strain.

Protein levels of Spo0A mutants in B. subtilis.

To determine if the mutant Spo0A proteins were present in B. subtilis, we made total cell extracts from the mutant strains. Cell extracts were then analyzed by immunoblotting with rabbit polyclonal anti-Spo0A antiserum (Fig. 3). All five mutants produced stable full-length protein. However, all of the mutants had reduced levels of protein compared to the wild type. The two mutants with changes at E213 had levels of Spo0A protein four- to fivefold lower than wild-type levels. The S210A, R214G, and R214A mutants had two- to threefold lower Spo0A production. There is no direct correlation between the severity of the sporulation phenotype of the mutant and the level of Spo0A mutant protein.

FIG. 3.

FIG. 3

Immunoblot analysis of wild-type and mutant Spo0A proteins. B. subtilis strains containing wild-type or mutant spo0A alleles were grown, and culture samples were collected and harvested at T1. Samples containing 1.25, 2.5, or 5.0 μg of total cellular protein were subjected to electrophoresis through a 12% polyacrylamide gel. Samples were electroblotted on to a PVDF-Plus membrane, and the Spo0A protein was probed with anti-Spo0A antibody as described in Materials and Methods. The Spo0A protein is indicated by the arrowheads. wt, wild type.

Ability of the mutant Spo0A proteins to bind to DNA in vitro.

In order to assess the DNA-binding ability of the mutant Spo0A proteins in vitro, we first subcloned the mutant spo0A genes into the pET15b expression vector (Novagen) and isolated His-tagged variants of wild-type and mutant Spo0A proteins. Proteins were isolated using affinity purification and were determined to be 50 to 95% pure by Coomassie blue staining (data not shown). We then used these partially purified proteins in electrophoretic gel mobility shift assays. Two complexes were formed when His-Spo0A was added to a radiolabeled 40-bp DNA fragment corresponding to the −59-to-−20 region of the spoIIE promoter containing a single base pair mismatch (TA to CG) at position −40 to create a consensus 0A box (0ABox fragment) (Fig. 4A and data not shown). At low concentrations of protein (0.069 to 2.3 μM), a single shifted complex was detected (Fig. 4A). At high concentrations (6.9 to 69 μM), the lower complex disappeared and was replaced by smearing or a second slowly migrating complex very high in the gel (data not shown). We determined that the second complex was due to a nonspecific interaction, as we detected the same complex in an assay with a DNA fragment in which the 0A box had multiple substitutions (ΔBox fragment), and because a vast excess of salmon sperm DNA (10 μg) could effectively compete for the formation of this complex but not the lower complex (data not shown). Formation of the Spo0A-DNA complex was sequence specific, as the addition of the unlabeled 0ABox fragment effectively competed for the formation of this complex, but the ΔBox fragment, which contains a multiple-substitution derivative of the 0ABox fragment, did not (Fig. 4B).

FIG. 4.

FIG. 4

Ability of His-Spo0A and His-Spo0A mutants to bind and shift a 40-bp spoIIE promoter fragment in an electrophoretic gel mobility shift assay. (A) DNA binding by His-tagged wild-type and mutant Spo0A proteins. One nanogram (0.038 pmol) of a radiolabeled double-stranded oligonucleotide (0ABox) corresponding to the spoIIE promoter from position− 59 to position −20 containing a single base pair substitution (from TA to CG) at position −40 to generate a consensus 0A box sequence was incubated with 1 μg of partially purified protein. All reaction mixtures also included 1 μg of salmon sperm DNA. Proteins were purified as described in Materials and Methods. The Spo0A-DNA complex is indicated by the arrowhead. P, unbound probe (B) Competition for Spo0A-DNA complex formation by a 40-bp spoIIE promoter DNA fragment containing either a consensus (0ABox) or mutated (ΔBox) 0A box sequence. Assays were performed as described for panel A, except that 0.5 μg of protein was used and 400 ng of the indicated unlabeled oligonucleotide was added to the binding reactions. The ΔBox oligonucleotide sequence consists of six base pair substitutions in the 0A box sequence contained within the 0ABox oligonucleotide. WT, wild type.

We analyzed the mutant His-Spo0A derivatives using the same assays. Three mutants, S210A, E213G, and E213A, retained their ability to bind DNA, but two mutants, R214G and R214A, were completely defective in binding at concentrations of protein up to 69 μM (Fig. 4A and data not shown). Titrations with the S210A, E213G, and E213A proteins indicated that S210A bound DNA with an affinity similar to that of the wild type and that E213G and E213A bound DNA with a lower affinity than that of the wild type (data not shown). We also detected an extremely weak shift of the ΔBox fragment by the E213G and E213A proteins (data not shown) under the same conditions as used for the gel mobility shifts shown in Fig. 4, suggesting that complex formation may result from some nonspecific associations between the mutant proteins and the DNA surrounding the 0A box sequence. However, competition assays with these proteins and the 0ABox fragment indicated that specific binding also contributes to the formation of the Spo0A-DNA complex that is observed (Fig. 4B). We were unable to make a rigorous estimate of the binding affinity due to the nonspecific interactions when higher concentrations of protein were added.

Ability of the Spo0A mutants to repress abrB transcription.

To assess the ability of the mutant Spo0A proteins to repress abrB transcription, we introduced wild-type and mutant spo0A genes by chromosomal transformation into a strain containing an abrB-lacZ transcriptional fusion carried on a specialized SPβ transducing phage (9). Transcription of the abrB gene is repressed by the spo0A gene product during the transition from exponential to stationary phase at the onset of sporulation and requires that Spo0A bind to the abrB promoter (36). Therefore, the ability of the Spo0A mutants to bind in vivo and to repress abrB transcription was assayed by monitoring β-galactosidase activity in these strains (Fig. 5). The S210A mutant repressed transcription of abrB in a manner similar to that of the wild type. The E213G and E213A mutants showed some derepression of abrB transcription but not to the same level as the null strain. abrB transcription was derepressed to the same level as in the null strain by the mutant R214A. However, unexpectedly, the R214G mutant showed higher levels of derepression of abrB transcription than the null strain. The same assay results were obtained with subsequent reconstruction of the abrB-lacZ strain containing the R214G mutant.

FIG. 5.

FIG. 5

Ability of spo0A mutants to repress abrB transcription. The ability of Spo0A and mutants to repress abrB transcription was assayed using an abrB-lacZ transcriptional fusion carried on a specialized SPβ-transducing phage. Strains were cultured and assayed as described in the legend for Fig. 2. Samples were collected at half-hour time points from T−2 until T1 and then hourly until T4. Each panel contains the mutant indicated: S210A (inverted solid triangles), E213G (open diamonds), E213A (solid diamonds), R214G (open triangles), or R214A (solid triangles). Data were averaged from at least three independent trials. Error bars represent the standard errors of the means. One unit of activity is defined as described in the legend for Fig. 2. Solid circles, wild type; open squares, Spo0A null strain.

The abrB gene is regulated by its own gene product, and a strain carrying an abrB spo0A double mutant shows higher levels of derepression of abrB transcription than a spo0A single mutant (36, 44). Moreover, spo0A mutants are extremely pleiotropic and are known to accumulate mutations at abrB that relieve some of the defects of a strain lacking the spo0A gene product. One of the defects in a spo0A mutant is the lack of production of certain extracellular proteases, and a mutation at abrB can relieve this defect (19, 49). Since an abrB spo0A double mutant can restore extracellular protease production, we assayed whether our spo0A mutants had accumulated an additional mutation at the abrB gene by screening our mutants on DSM supplemented with 1% nonfat dry skim milk. The S210A mutant gave a large zone of clearing similar to that of the wild type. The E213G and E213A mutants were indistinguishable from the null strain. Independent isolates of each of the R214 mutants gave zones of clearing intermediate to those of the wild-type and null strains. Therefore, none of the mutant strains appeared to have accumulated a second site mutation at abrB. Moreover, subculturing did not change the behavior of the strains.

DISCUSSION

Spo0A is a key transcriptional regulator involved in controlling the expression of genes required during the entry into stationary phase and the onset of endospore formation. In this study, we have made amino acid substitutions in a highly conserved region of the C-terminal domain of Spo0A that contains a possible HTH DNA-binding domain with the hope of isolating DNA-binding mutants of Spo0A. The results reported here give support for the proposed involvement of residue E213 in DNA binding and support a functional role for the conserved residues in this region.

The S210A mutant contains an alanine in the second position of the putative recognition helix and shows little effect on DNA binding. As serine and alanine side chains differ only by a hydroxyl group, it is unlikely that replacement with alanine would greatly perturb the structure of the mutant protein. Therefore, these results indicate that this residue is probably not involved in making specific contacts for DNA binding. However, the transcriptional activity of the spoIIA and spoIIE promoters positively regulated by Spo0A was decreased by this substitution. This result is consistent with the S210 residue being part of the HTH DNA-binding domain, as many mutations within and around the HTH DNA-binding domain in other proteins are known to affect transcriptional activation without necessarily affecting binding (25, 30).

The E213 mutants, however, appear to be involved with DNA binding, as both the glycine and alanine substitution mutants showed decreased binding in vitro compared to that of the wild type. In addition, reductions in the ability to repress the transcription of abrB and to activate transcription of the spoIIA and spoIIE promoters are consistent with a loss of DNA binding. The more drastic effect seen at the promoters positively regulated by Spo0A may be due to the fact that these promoters have multiple 0A boxes (6, 53), and degenerate 0A boxes in these promoters may result in different levels of binding defects in the mutant proteins. Alternatively, since Spo0A functions require phosphorylation for activity in vivo (6, 17, 45), we cannot rule out the possibility that substitutions in E213 somehow affect phosphorylation. However, since a D56N mutation of Spo0A that cannot be phosphorylated cannot repress abrB transcription in vivo (45), our results argue that phosphorylation is not abolished in the E213 mutant strains. Whether there is decreased phosphorylation of our mutants is still in question, since the abrB promoter is most sensitive to low levels of phosphorylation (48), so repression may still occur even with decreased phosphorylation of Spo0A. Moreover, the effects we saw on transcriptional activation could be due to the decreased levels of protein in these strains. However, since DNA binding in vitro does not require phosphorylation (41, 47) and protein levels are standardized, it is clear that there are defects in binding when the E213 residue of Spo0A is replaced.

The substitutions at R214 completely abolished the activity of these proteins. This result is consistent with either an alteration in a sequence-specific contact that is required for DNA binding, a gross conformational change that destroys protein function, or a defect in the ability of the protein to be phosphorylated. There are a few points that argue against the last two cases. First, these proteins retained their ability to bind to DNA nonspecifically, as indicated by the slowly migrating complex that was formed at high concentrations of protein in the mobility shift assays (data not shown). Moreover, they were able to bind to heparin-agarose during affinity chromatography, although with a lower affinity than that of the wild-type protein (data not shown). Therefore, although nonspecific binding of the mutant proteins was not identical to that of the wild type, this binding was not abolished. These results are similar to those observed for mutations in the recognition helix of the λ cII protein, which eliminate sequence-specific binding but do not eliminate nonspecific binding (25).

In addition, the R214G mutant appears to have a gain-of-function alteration that results in higher levels of β-galactosidase expression in a strain containing an abrB-lacZ transcriptional fusion. We have shown that the higher expression from this strain is not due to a second site mutation at abrB. Therefore, either this mutant form of Spo0A either activates abrB transcription or interacts aberrantly at an additional locus. It seems more likely that the mutations we made could result in an altered specificity of Spo0A binding producing an indirect effect on abrB expression. In support of this alternative is the fact that protease expression in the position 214 mutants was intermediate to that of the wild-type and Spo0A null strains on milk plates. In the null strain, protease expression was abolished. Therefore, the results observed for the R214G mutant are not simply due to the destruction of all protein functions. Moreover, this result suggests that the regulation of abrB or repression by Spo0A may be more complicated than previously suspected.

Our studies support the hypothesis that the conserved region of Spo0A identified by Brown et al. (8) is functionally important. The S210A and E213 mutant proteins do maintain some binding activity while decreasing or destroying the ability to activate transcription, so these could be classified as positive-control mutants (1). Mutations within or in regions surrounding the binding motifs of the proteins λ cI (30) and OmpR (2, 29) are positive-control mutations. Therefore, it is possible that these residues are not directly involved in contacting DNA but are still part of the DNA-binding domain. However, the results clearly indicate a role for E213 in DNA binding and implicate R214 as a key functional residue.

Ultimate determination of the functional significance of the conserved region of Spo0A requires determination of its molecular structure. Recently, it has been reported that the full-length protein and the C-terminal domain of Spo0A have both been crystallized (31). Together with genetic and biochemical studies such as the present study, the crystal structure of Spo0A will help us elucidate the functional domains of Spo0A so we can better understand how this protein functions compared to other members of the response regulator family of proteins.

ACKNOWLEDGMENTS

We thank Charles Moran and current and former members of his lab, including Ghislain Schyns and Sarah Satola, for providing us with the SPβ abrB-lacZ bacteriophage and for their technical help. We also thank Tad Seyler and Andrea Milenbachs for helpful discussion and technical assistance.

This work was supported by Public Health Services grant GM35495 to P.Y. from the National Institutes of Health.

REFERENCES

  • 1.Adhya S, Garges S. Positive control. J Biol Chem. 1990;265:10797–10800. [PubMed] [Google Scholar]
  • 2.Aiba H, Kato N, Tsuzuki M, Mizuno T. Mechanism of gene activation by the Escherichia coli positive regulator, OmpR: a mutant defective in transcriptional activation. FEBS Lett. 1994;351:303–307. doi: 10.1016/0014-5793(94)00846-9. [DOI] [PubMed] [Google Scholar]
  • 3.Albright L M, Huala E, Ausubel F M. Prokaryotic signal transduction mediated by sensor and regulator protein pairs. Annu Rev Genet. 1989;23:311–336. doi: 10.1146/annurev.ge.23.120189.001523. [DOI] [PubMed] [Google Scholar]
  • 4.Anderson J E, Ptashne M, Harrison S C. A phage repressor-operator complex at 7 Å resolution. Nature. 1985;316:596–601. doi: 10.1038/316596a0. [DOI] [PubMed] [Google Scholar]
  • 5.Ausubel F M, Brent R, Kingston R E, Moore D D, Seidman J G, Smith J A, Struhl K A, editors. Current protocols in molecular biology. New York, N.Y: John Wiley & Sons, Inc.; 1994. [Google Scholar]
  • 6.Baldus J M, Green B D, Youngman P, Moran C P., Jr Phosphorylation of Bacillus subtilis transcription factor Spo0A stimulates transcription from the spoIIG promoter by enhanced binding to weak 0A boxes. J Bacteriol. 1994;176:296–306. doi: 10.1128/jb.176.2.296-306.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bird T H, Grimsley J K, Hoch J A, Spiegelman G B. Phosphorylation of Spo0A activates its stimulation of in vitro transcription from the Bacillus subtilis spoIIG operon. Mol Microbiol. 1993;9:741–749. doi: 10.1111/j.1365-2958.1993.tb01734.x. [DOI] [PubMed] [Google Scholar]
  • 8.Brown D P, Ganova-Raeva L, Green B D, Wilkinson S R, Young M, Youngman P. Characterization of spo0A homologues in diverse Bacillus and Clostridium species identifies a probable DNA-binding domain. Mol Microbiol. 1994;14:411–426. doi: 10.1111/j.1365-2958.1994.tb02176.x. [DOI] [PubMed] [Google Scholar]
  • 9.Buckner C M, Schyns G, Moran C P., Jr A region in the Bacillus subtilis transcription factor Spo0A that is important for spoIIG promoter activation. J Bacteriol. 1998;180:3578–3583. doi: 10.1128/jb.180.14.3578-3583.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Burbulys D, Trach K A, Hoch J A. Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell. 1991;64:545–552. doi: 10.1016/0092-8674(91)90238-t. [DOI] [PubMed] [Google Scholar]
  • 11.Deng W P, Nickoloff J A. Site-directed mutagenesis of virtually any plasmid by eliminating a unique site. Anal Biochem. 1992;200:81–88. doi: 10.1016/0003-2697(92)90280-k. [DOI] [PubMed] [Google Scholar]
  • 12.Dodd I B, Egan J B. Improved detection of helix-turn-helix DNA-binding motifs in protein sequences. Nucleic Acids Res. 1990;18:5019–5026. doi: 10.1093/nar/18.17.5019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ebright R H, Cossart P, Gicquel-Sanzey B, Beckwith J. Molecular basis of DNA sequence recognition by the catabolite gene activator protein: detailed inferences from three mutations that alter DNA sequence specificity. Proc Natl Acad Sci USA. 1984;81:7274–7278. doi: 10.1073/pnas.81.23.7274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ebright R H, Cossart P, Gicquel-Sanzey B, Beckwith J. Mutations that alter the DNA sequence specificity of the catabolite gene activator protein of E. coli. Nature. 1984;311:232–235. doi: 10.1038/311232a0. [DOI] [PubMed] [Google Scholar]
  • 15.Ebright R H, Kolb A, Buc H, Kunkel T A, Krakow J S, Beckwith J. Role of glutamic acid-181 in DNA-sequence recognition by the catabolite gene activator protein (CAP) of Escherichia coli: altered DNA-sequence-recognition properties of [Val181]CAP and [Leu181]CAP. Proc Natl Acad Sci USA. 1987;84:6083–6087. doi: 10.1073/pnas.84.17.6083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ferrari F A, Trach K, LeCoq D, Spence J, Ferrari E, Hoch J A. Characterization of the spo0A locus and its deduced product. Proc Natl Acad Sci USA. 1985;82:2647–2651. doi: 10.1073/pnas.82.9.2647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Green B D, Olmedo G, Youngman P. A genetic analysis of Spo0A structure and function. Res Microbiol. 1991;142:825–830. doi: 10.1016/0923-2508(91)90061-e. [DOI] [PubMed] [Google Scholar]
  • 18.Grimsley J K, Tjalkens R B, Strauch M A, Bird T H, Spiegelman G B, Hostomsky Z, Whiteley J M, Hoch J A. Subunit composition and domain-structure of the Spo0A sporulation transcription factor of Bacillus subtilis. J Biol Chem. 1994;269:16977–16982. [PubMed] [Google Scholar]
  • 19.Guespin-Michel J E. Phenotypic reversion in some early blocked sporulation mutants of Bacillus subtilis: isolation and phenotype identification of partial revertants. J Bacteriol. 1971;108:241–247. doi: 10.1128/jb.108.1.241-247.1971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Gunes C, Staacke D, von Wilcken-Bergmann B, Muller-Hill B. The possible roles of residues 79 and 80 of the Trp repressor from Escherichia coli K-12 in trp operator recognition. Mol Gen Genet. 1995;246:180–195. doi: 10.1007/BF00294681. [DOI] [PubMed] [Google Scholar]
  • 21.Guzmán P, Westpheling J, Youngman P. Characterization of the promoter region of the Bacillus subtilis spoIIE operon. J Bacteriol. 1988;170:1598–1609. doi: 10.1128/jb.170.4.1598-1609.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Harrison S C, Aggarwal A K. DNA recognition by proteins with the helix-turn-helix motif. Annu Rev Biochem. 1990;59:933–969. doi: 10.1146/annurev.bi.59.070190.004441. [DOI] [PubMed] [Google Scholar]
  • 23.Harwood C R, Cutting S M, editors. Molecular biological methods for Bacillus. Chichester, United Kingdom: John Wiley & Sons Ltd.; 1990. [Google Scholar]
  • 24.Hatt J K, Youngman P. Spo0A mutants of Bacillus subtilis with sigma factor-specific defects in transcription activation. J Bacteriol. 1998;180:3584–3591. doi: 10.1128/jb.180.14.3584-3591.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ho Y S, Mahoney M E, Wulff D L, Rosenberg M. Identification of the DNA binding domain of the phage lambda cII transcriptional activator and the direct correlation of cII protein stability with its oligomeric forms. Genes Dev. 1988;2:184–195. doi: 10.1101/gad.2.2.184. [DOI] [PubMed] [Google Scholar]
  • 26.Hochschild A, Douhan J D, Ptashne M. How lambda repressor and lambda Cro distinguish between OR1 and OR3. Cell. 1986;47:807–816. doi: 10.1016/0092-8674(86)90523-4. [DOI] [PubMed] [Google Scholar]
  • 27.Jordan S R, Pabo C O. Structure of the lambda complex at 2.5 Å resolution: details of the repressor-operator interactions. Science. 1988;242:893–899. doi: 10.1126/science.3187530. [DOI] [PubMed] [Google Scholar]
  • 28.Kadner R J. Expression of the Uhp sugar-phosphate transport system of Escherichia coli. In: Hoch J A, Silhavy T J, editors. Two-component signal transduction. Washington, D.C.: American Society for Microbiology; 1995. pp. 263–274. [Google Scholar]
  • 29.Kato N, Tsuzuki M, Aiba H, Mizuno T. Gene activation by the Escherichia coli positive regulator OmpR: a mutational study of the DNA-binding domain of OmpR. Mol Gen Genet. 1995;248:399–406. doi: 10.1007/BF02191639. [DOI] [PubMed] [Google Scholar]
  • 30.Li M, Moyle H, Susskind M M. Target of the transcriptional activation function of phage lambda cI protein. Science. 1994;263:75–77. doi: 10.1126/science.8272867. [DOI] [PubMed] [Google Scholar]
  • 31.Muchova K, Lewis R J, Brannigan J A, Offen W A, Brown D P, Barak I, Youngman P, Wilkinson A J. Crystallization of the regulatory and effector domains of the key sporulation response regulator Spo0A. Acta Crystallogr Sect D. 1999;55:671–676. doi: 10.1107/s0907444998012682. [DOI] [PubMed] [Google Scholar]
  • 32.Otwinowski Z, Schevitz R W, Zhang R G, Lawson C L, Joachimiak A, Marmorstein R Q, Luisi B F, Sigler P B. Crystal structure of trp repressor/operator complex at atomic resolution. Nature. 1988;335:321–329. doi: 10.1038/335321a0. . (Erratum, 335:837.) [DOI] [PubMed] [Google Scholar]
  • 33.Pabo C O, Sauer R T. Protein-DNA recognition. Annu Rev Biochem. 1984;53:293–321. doi: 10.1146/annurev.bi.53.070184.001453. [DOI] [PubMed] [Google Scholar]
  • 34.Pabo C O, Sauer R T. Transcription factors: structural families and principles of DNA recognition. Annu Rev Biochem. 1992;61:1053–1095. doi: 10.1146/annurev.bi.61.070192.005201. [DOI] [PubMed] [Google Scholar]
  • 35.Parkinson J S, Kofoid E C. Communication modules in bacterial signaling proteins. Annu Rev Genet. 1992;26:71–112. doi: 10.1146/annurev.ge.26.120192.000443. [DOI] [PubMed] [Google Scholar]
  • 36.Perego M, Spiegelman G B, Hoch J A. Structure of the gene for the transition state regulator, abrB: regulator synthesis is controlled by the spo0A sporulation gene in Bacillus subtilis. Mol Microbiol. 1988;2:689–699. doi: 10.1111/j.1365-2958.1988.tb00079.x. [DOI] [PubMed] [Google Scholar]
  • 37.Pfau J, Arvidson D N, Youderian P. Mutants of Escherichia coli Trp repressor with changes of conserved, helix-turn-helix residue threonine 81 have altered DNA-binding specificities. Mol Microbiol. 1994;13:1001–1012. doi: 10.1111/j.1365-2958.1994.tb00491.x. [DOI] [PubMed] [Google Scholar]
  • 38.Pratt L A, Silhavy T J. Porin regulation of Escherichia coli. In: Hoch J A, Silhavy T J, editors. Two-component signal transduction. Washington, D.C.: American Society for Microbiology; 1995. pp. 105–127. [Google Scholar]
  • 39.Satola S, Kirchman P A, Moran C P., Jr Spo0A binds to a promoter used by sigma-A RNA polymerase during sporulation in Bacillus subtilis. Proc Natl Acad Sci USA. 1991;88:4533–4537. doi: 10.1073/pnas.88.10.4533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Schyns G, Buckner C M, Moran C P., Jr Activation of the Bacillus subtilis spoIIG promoter requires interaction of Spo0A and the sigma subunit of RNA polymerase. J Bacteriol. 1997;179:5605–5608. doi: 10.1128/jb.179.17.5605-5608.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Spiegelman G B, Bird T H, Voon V. Transcription regulation by the Bacillus subtilis response regulator Spo0A. In: Hoch J A, Silhavy T J, editors. Two-component signal transduction. Washington, D.C.: American Society for Microbiology; 1995. pp. 159–179. [Google Scholar]
  • 42.Stock J B, Ninfa A J, Stock A M. Protein phosphorylation and regulation of adaptive responses in bacteria. Microbiol Rev. 1989;53:450–490. doi: 10.1128/mr.53.4.450-490.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Strauch M, Webb V, Spiegelman G, Hoch J A. The Spo0A protein of Bacillus subtilis is a repressor of the abrB gene. Proc Natl Acad Sci USA. 1990;87:1801–1805. doi: 10.1073/pnas.87.5.1801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Strauch M A, Perego M, Burbulys D, Hoch J A. The transition state transcription regulator AbrB of Bacillus subtilis is autoregulated during vegetative growth. Mol Microbiol. 1989;3:1203–1209. doi: 10.1111/j.1365-2958.1989.tb00270.x. [DOI] [PubMed] [Google Scholar]
  • 45.Strauch M A, Trach K A, Day J, Hoch J A. Spo0A activates and represses its own synthesis by binding at its dual promoters. Biochimie. 1992;74:619–626. doi: 10.1016/0300-9084(92)90133-y. [DOI] [PubMed] [Google Scholar]
  • 46.Studier F W, Rosenberg A H, Dunn J J, Dubendorff J W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 1990;185:60–89. doi: 10.1016/0076-6879(90)85008-c. [DOI] [PubMed] [Google Scholar]
  • 47.Trach K, Burbulys D, Strauch M, Wu J J, Dhillon N, Jonas R, Hanstein C, Kallio P, Perego M, Bird T, Spiegelman G B, Fogher C, Hoch J A. Control of the initiation of sporulation in Bacillus subtilis by a phosphorelay. Res Microbiol. 1991;142:815–823. doi: 10.1016/0923-2508(91)90060-n. [DOI] [PubMed] [Google Scholar]
  • 48.Trach K A, Hoch J A. Multisensory activation of the phosphorelay initiating sporulation in Bacillus subtilis: identification and sequence of the protein kinase of the alternate pathway. Mol Microbiol. 1993;8:69–79. doi: 10.1111/j.1365-2958.1993.tb01204.x. [DOI] [PubMed] [Google Scholar]
  • 49.Trowsdale J, Chen S M, Hoch J A. Genetic analysis of a class of polymyxin resistant partial revertants of stage O sporulation mutants of Bacillus subtilis: map of the chromosome region near the origin of replication. Mol Gen Genet. 1979;173:61–70. doi: 10.1007/BF00267691. [DOI] [PubMed] [Google Scholar]
  • 50.Wharton R P, Ptashne M. A new-specificity mutant of 434 repressor that defines an amino acid-base pair contact. Nature. 1987;326:888–891. doi: 10.1038/326888a0. [DOI] [PubMed] [Google Scholar]
  • 51.Wu J J, Howard M G, Piggot P J. Regulation of transcription of the Bacillus subtilis spoIIA locus. J Bacteriol. 1989;171:692–698. doi: 10.1128/jb.171.2.692-698.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Wu J J, Piggot P J, Tatti K M, Moran C., Jr Transcription of the Bacillus subtilis spoIIA locus. Gene. 1991;101:113–116. doi: 10.1016/0378-1119(91)90231-y. [DOI] [PubMed] [Google Scholar]
  • 53.York K, Kenney T J, Satola S, Moran C P, Jr, Poth H, Youngman P. Spo0A controls the ςA-dependent activation of Bacillus subtilis sporulation-specific transcription unit spoIIE. J Bacteriol. 1992;174:2648–2658. doi: 10.1128/jb.174.8.2648-2658.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Youngman P. Plasmid vectors for recovering and exploiting Tn917 transpositions in Bacillus and other gram-positive bacteria. In: Hardy K, editor. Plasmids: a practical approach. Oxford, United Kingdom: IRL Press; 1987. pp. 79–103. [Google Scholar]
  • 55.Youngman P, Perkins J B, Losick R. Construction of a cloning site near one end of Tn917 into which foreign DNA may be inserted without affecting transposition in Bacillus subtilis or expression of the transposon-borne erm gene. Plasmid. 1984;12:1–9. doi: 10.1016/0147-619x(84)90061-1. [DOI] [PubMed] [Google Scholar]
  • 56.Zhang X P, Ebright R H. Identification of a contact between arginine-180 of the catabolite gene activator protein (CAP) and base pair 5 of the DNA site in the CAP-DNA complex. Proc Natl Acad Sci USA. 1990;87:4717–4721. doi: 10.1073/pnas.87.12.4717. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES