MicroRNA‐23a‐3p promotes macrophage M1 polarization and aggravates lipopolysaccharide‐induced acute lung injury by regulating PLK1/STAT1/STAT3 signalling

Abstract

Macrophage polarization is an important effector process in acute lung injury (ALI) induced by sepsis. MicroRNAs (miRNAs) have emerged as important players in regulating ALI process. Here, we showed that elevated microRNA‐23a‐3p (miR‐23a‐3p) promoted LPS‐induced macrophage polarization and ALI in mice, while inhibition of miR‐23a‐3p led to reduced macrophage response and ameliorated ALI inflammation. Mechanically, miR‐23a‐3p regulated macrophage M1 polarization through targeting polo‐like kinase 1 (PLK1). PLK1 was downregulated in LPS‐treated macrophages and ALI mouse lung tissues. Knockdown of PLK1 increased macrophage M1 polarization through promoting STAT1/STAT3 activation, while overexpression of PLK1 reduced macrophage immune response. Collectively, our results reveal a key miRNA regulon that regulates macrophage polarization for LPS‐induced immune response.

1. INTRODUCTION

Acute lung injury (ALI) and its more severe form, acute respiratory distress syndrome (ARDS), are severe respiratory syndromes, which cause high morbidity and mortality. Various pathological factors have been inplicated in pathogenesis. ¹ These include increased alveolar capillary permeability and persistent excessive inflammation, which lead to pulmonary oedema, hypoxemia, cell apoptosis and destruction of lung structure. ² , ³ Although the types of available clinical therapy for ALI have increased during the past few decades, the overall survival rate has not improved as much as might be expected. Therefore research into the molecular pathogenesis is still necessary and will provide ‐ hopefully ‐ new ideas and targets for the treatment of ALI.

Macrophages are the most important regulators of the local inflammatory micro‐environment and hence of the overall inflammatory response in the lung, mainly including alveolar macrophage (AM), pulmonary mesenchymal macrophage and bronchial macrophage, of which AM accounted for >90%. ⁴ , ⁵ AM plays a key role in maintaining homeostasis of the lung immune system and host defence, and is the host's first line of defence against foreign invasion. ⁶ Once stimulated by various external pathogenic factors, the immune cells in the lung are activated and release extensive inflammatory mediators, resulting in a cascade of amplified inflammatory responses. Based on differences in cellular metabolic pathways, cytokine secretion and surface markers, macrophage polarization outcomes are classified into macrophages activated by classical pathways (M1 macrophages) and macrophages activated by alternative pathways (M2 macrophages). ⁷ M1 macrophages can be induced by interferon‐γ (IFN‐γ) or LPS both of which promote inflammatory and cytotoxic activity, and are involved in tumour suppression and immune stimulation. But excessive aggregation of M1 macrophages can lead to inflammatory damage in normal tissues of the body. M1 macrophages secrete excessive interleukin‐6 (IL‐6), interleukin‐1 beta (IL‐1β) and tumour necrosis factor‐α (TNF‐α), which can lead to cytokine storm and diffuse lung injury and multi‐organ failure. ⁸ Further research on these pathological processes and molecular mechanisms implicated in ALI will provide a theoretical basis for future clinical diagnosis and treatment of ALI.

MicroRNA (miRNA) is a 20–25 double‐strand non‐coding nucleotide. Its basic functions are characterized by guiding the silencing complex to degrade mRNA or hindering its translation by base pairing with target gene mRNA. ⁹ Recent studies have shown that miRNAs are involved in the pathophysiological processes of various diseases, such as cardiovascular diseases, tumorigenesis and neurological diseases, and have been found to be closely associated with the growth and development of lung diseases such as lung tumours, pulmonary fibrosis and pneumonia, as well as their development and regression. ¹⁰ , ¹¹ miR‐23a‐3p was highly expressed in ovarian cancer, lung cancer, gastric cancer and promoted cancer cell proliferation, migration and invasion. ¹² , ¹³ , ¹⁴ miR‐23a‐3p has also been shown to play an important role in the intrinsic immune and inflammatory response. Loss of miR‐23a‐3p in T cells resulted in elevated T_FH cell frequencies upon different immune challenge hereas overexpression of miR‐23a‐3p led to reduced TFH cell responses. ¹⁵ HBV infection reduced miR‐23a‐3p level and led to increased Tregs recruitment in HCC patients, caused poor survival rate. ¹⁶ There is thus evidence indicating that miR‐23a‐3p may play an important role in immunoinflammatory response, but the role of miR‐23a‐3p in ALI has not been researched.

Polo‐like kinase 1 (PLK1) is a member of PLKs family, regulating cell mitosis, cytoplasmic division, DNA damage response, development and other processes through its kinase activity interacting with a variety of substrates. ¹⁷ PLK1 has a highly conserved structure with a kinase domain at the N terminus and two conserved polo‐box domains (PBD) at the C terminus. PLK1 is overexpressed in breast cancer, and PLK1 inhibition sensitizes breast cancer to radiation via suppressing autophagy. ¹⁸ PLK1 has also been studied in hepatocellular carcinoma, and upregulated ECT2 promotes M2 polarization of tumour‐associated macrophages through PLK1/PTEN signalling pathway. ¹⁹ Based on this, we hypothesized that PLK1 might play an important role in the inflammatory environment of ALI by regulating macrophage polarization through PTEN. But the role of PLK1 and its molecular mechanism have not been studied.

In this study, we investigated the role and mechanism of PLK1in LPS‐induced ALI. PLK1 was decreased especially in macrophages. Overexpression of PLK1 blocked LPS‐induced macrophage M1 polarization. PLK1 expression was regulated by miR‐23a‐3p, while inhibition of miR‐23a‐3p significantly increased PLK1 expression and macrophage M1 polarization, and alleviated LPS‐induced ALI.

2. MATERIALS AND METHODS

2.1. Cell culture and treatment

The mouse lung epithelial cell line MLE‐12, endothelial cell and macrophage cell line Raw 264.7 were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). Cells were maintained in 89% DMEM medium (Gibco, Mississauga, ON, USA) containing 10% FBS (Gibco) + 1% PSG (HyClone, Logan, UT, USA) and kept in a 37°C incubator with 5% CO₂. Mycoplasma contamination testing was carried out to ensure that the cell lines were free of contamination. Cells were treated with 1 μg/ml LPS (Sigma‐Aldrich, St. Louis, MO, USA) or vehicle (dimethyl sulfoxide; Sigma‐Aldrich) for 24 h, in accordance with a previously published method. For PLK1 overexpression, 3‐μg Flag‐tagged PLK1 plasmids (OriGene, Rockville, MD) were transiently transfected into macrophages cultured in 12‐well plates by Lipofectamine 2000 reagent. For PLK1 knockdown, macrophages were infected with lentivirus (Hanbio; Shanghai, China) containing shPLK1 sequence (CCAGGACCACACCAAACTTAT) or shScr control as described previously. ²⁰ For miR‐23a‐3p overexpression or inhibition, miR‐NC (control), miR‐23a‐3p mimics and miR‐23a‐3p antagomir obtained from GenePharma (Shanghai, China) were transfected into the macrophage according to the Lipofectamine RNAiMAX instructions (Thermo Fisher; Waltham, MA, USA). After 24‐h transfection or 48‐h infection, cells were exposed to LPS for another 24 h as described above.

2.2. LPS‐induced ALI model

The ALI model was conducted as described previously. ²¹ 8‐week‐old male mice obtained from Shanghai Slack Laboratory Animal Co., Ltd. (Shanghai, China) were randomly divided into two groups (5/each group). The ALI model was established by one‐time intratracheal instillation of 5 mg/kg lipopolysaccharide (LPS, Sigma‐Aldrich). Animals were euthanized at baseline or 24 h after LPS administration, and then, bronchoalveolar lavage fluid (BALF) and lung tissues were collected for the following experiments. The study was performed accordance with NIH Guide for the Care and Use of Laboratory Animals and approved by the Ethics Committee of Zhejiang University.

2.3. Histopathologicl analysis

After LPS treatment, the lung tissue of mice was harvested and fixed in 4% formaldehyde for 24 h. The fixed lung tissues were embedded in paraffin, and 4‐μm‐thick lung sections were obtained by a microtome. Then, tissues were stained with haematoxylin and eosin (H&E) as previously described. After staining, the histopathological morphology of lung was observed under a light microscope (Olympus, Tokyo, Japan).

2.4. RNA extraction and quantitative real‐time PCR (RT‐PCR)

Total RNA was extracted from mouse lung tissue and from the cell lines respectively by using peqGold RNAPure kit (Peqlab, Erlangen, Germany), according to the manufacturers' instructions. Then, 2 μg of extracted RNA was reverse transcribed into cDNA by Maxima First Strand cDNA synthesis kit (Thermo Fisher) according to the instruction. RT‐PCR was preformed to evaluate the mRNA level of interested genes using SYBR Green dye (Roche; Hoffmann, La, USA) in a Bio‐Rad CFX instrument (Hercules, California, USA). All reactions were executed three times, and gene expression level was calculated relative to 18S housekeeping gene level using $2^{-\mathrm{\Delta \Delta }{C}_{\mathrm{t}}}$ method. All primers used herein are listed in the supplementary table.

2.5. Western blot

For Western blotting analyses, the whole cell lysates of mouse right lung cell lines were prepared in RIPA lysis buffer (pH 7.4, 150 mm NaCl, 50 mm Tris, 0.5% sodium deoxycholate, 0.1% SDS and 1% Nonidet P‐40) containing protease inhibitor cocktail and phosphatase inhibitors. The RIPA lysis was centrifuged (4°C, 10 min) at 13,000 rpm. The supernatant was extracted, and the protein concentration was determined by BCA kit (Beyotime, Shanghai, China). Then, the cell lysates were boiled at 100°C for 5 min. Typically, 10–50 μg of proteins was separated on SDS‐PAGE gel by electrophoresis and transferred to NC membrane (Pall, Port Washington, NY, USA). The membrane was blocked in TBST (pH 7.6, 50 mm Tris, 150 mm NaCl, 0.05% Tween‐20) solution containing 5% defat dried milk for 1 h at room temperature and then washed three times by TBST for first antibodies (listed in Table S1) incubation. After probing by second fluorescence, the membrane was visualized by the Odyssey system (Lincoln, NE, USA). Protein intensity was quantified by ImageJ software and results expressed as a signal ratio (normalized to loading control β‐actin).

2.6. ELISA assay

The presence of TNF‐α, IL‐6 and IL‐1β in serum and culture supernatant was measured with commercial ELISA kits (Thermo Fisher) according to the manufacturer's instructions.

2.7. Bioinformatic analysis

Human PLK1 3’‐UTR sequence was retrieved from UCSC database (http://genome.ucsc.edu/cgi‐bin/hgTables). The potential miRNAs binding to PLK3’‐UTR were predicted using miRNA prediction databases (TargetScan, miRTarBase and miRBase).

2.8. Dual‐luciferase reporter assay

According to predicted binding site of miR‐23a‐3p and PLK1, PLK1wild‐type reporter plasmid (wt‐luc) containing this predicted sequence and PLK1 mutant (mt‐luc) were synthesized. The 293 T cells were seeded in 24‐well plates and transfected with luciferase reporter vectors (wt‐luc or mt‐luc), then cotransfected with miR‐23a‐3p inhibitor, mimic or negative control using Lipofectamine 2000. Luciferase activity was measured using Dual‐Luciferase reporter gene assay kit (Promega; Madison, WI, USA) by SpectraMax M5 (Sunnyvale, CA, USA) after 24‐h transfection.

2.9. Statistical analysis

The GraphPad Prism 7 software was used for statistics analysis. All experiments were performed at least three times and results presented as mean ± SD. The comparison between two groups was analysed by unpaired Student's t test, and the comparison between multiple groups was performed using one‐way ANOVA following by Tukey post hoc analysis. A p value < 0.05 was considered to be significant.

3. RESULTS

3.1. Decreased expression of PLK1 in LPS‐induced ALI model in vivo and in vitro

To detect PLK1 expression in ALI, LPS was used to induce ALI in mice. Lung tissue histological analysis revealed thickened alveolar walls and increased inflammatory cell infiltration in ALI mice, compared with control mice (Figure 1A). Next, lung tissues were collected to detect PLK1 expression, and both RT‐qPCR and Western blot results revealed decreased PLK1 level after LPS treatment (Figure 1B,C). Furthermore, mice lung microvessel endothelial cell, lung epithelial cell MLE‐12 and mouse macrophages Raw 264.7 were treated with LPS. RT‐qPCR results revealed that PLK1 was decreased in macrophages but not in epithelial or endothelial cells (Figure 1D). Consistently, Western blot results revealed decreased PLK1 level in macrophages treated with LPS (Figure 1E). These results indicate PLK1 expression is decreased in macrophages in ALI.

FIGURE 1.

Increased PLK1 expression in macrophage in ALI model. (A) HE stains of lung sections 24 h after the saline or LPS challenge. (B) PLK1 mRNA levels in the lung decreased in the ALI group relative to the normal. (C) PLK1 protein levels in the lung decreased in the ALI group relative to the normal. (D) PLK1 mRNA levels in MLE‐12, macrophages and endothelial cells stimulated with PBS or LPS (100 ng/ml) for 2 h, data were determined by RT‐qPCR, and fold change is compared to PBS group. (E) Western blot analysis of macrophages stimulated with PBS or LPS (100 ng/ml) for 2 h. Cells were blotted for PLK1. Data from three independent experiments are shown. *p < 0.05, **p < 0.01 and ***p < 0.001

3.2. PLK1 inhibits LPS‐induced macrophage M1 polarization by inactivating STAT1 and STAT3

To explore the role of PLK1 in macrophages, lentivirus‐mediated overexpression or silencing of PLK1 was conducted (Figure 2A,C). ELISA analysis revealed PLK1 overexpression in LPS‐induced macrophages led to decrease in the M1 markers TNF‐α, IL‐6 and IL‐1β (Figure 2B), while PLK1 knockdown increased TNF‐α, IL‐6 and IL‐1β level (Figure 2D). Excessive phosphorylation activation of STAT1 and STAT3 is a common signal leading to M1 polarization. Our Western blot results showed PLK1 overexpression reduced STAT1 and STAT3 activation, while STAT1 and STAT3 activations were increased in PLK1 knockdown macrophages (Figure 2E). Thus, PLK1 inhibits LPS‐induced macrophage inflammation through STAT1 and STAT3 deactivation.

FIGURE 2.

PLK1 acts as anti‐inflammation effector through negatively regulating STAT1 and STAT3 activation. (A) Macrophages were transfected with PLK1 overexpression or vector plasmid for 48 h, and PLK1 mRNA level was determined by RT‐qPCR. Fold change is compared to vector. (B) Macrophages (RAW 264.7) were stimulated with LPS (100 ng/ml) for 2 h. The levels of inflammatory cytokine TNF‐α, IL‐6 and IL‐1β were determined by ELISA. Fold change is compared to vector. (C) Macrophages were infected with shPLK1 or shScr lentivirus for 48 h, and PLK1 mRNA level was determined by RT‐qPCR. Fold change is compared to shScr. (D) Macrophages (RAW 264.7) infected with shPLK1 and shScr lentivirus for 48 h were stimulated with LPS (100 ng/ml) for 2 h. The levels of inflammatory cytokine TNF‐α, IL‐6 and IL‐1β were determined by ELISA. Fold change is compared to shScr. (E) p‐STAT1 and p‐STAT3 were detected by Western blot in macrophage infected with shPLK1 or shScr lentivirus; PLK1 overexpression or vector plasmid. Fold change is compared to control shScr or vector. Data from three independent experiments are shown. *p < 0.05, **p < 0.01 and ***p < 0.001

3.3. MiR‐23a‐3p targets PLK1 in LPS‐induced macrophage M1 polarization and ALI

Prediction of miRNA targeted PLK1 was performed in three miRNA prediction databases (TargetScan, miRTarBase and miRBase). Prediction results from the three databases were shown in Venn diagrams, and miR‐1322 and miR‐23a‐3p were the only two in all three databases (Figure 3A). RT‐qPCR results revealed miR‐23a‐3p was highly increased in LPS‐induced macrophages or lung tissues from ALI mice, but miR‐1322 showed no differences (Figure 3B,C), suggesting low expression of PLK1 in macrophages is mediated by upregulated miR‐23a‐3p in ALI mice. To further confirm the hypothesis, dual‐luciferase reporter gene assay was carried out. Result showed macrophages transfected with miR‐23a‐3p and WT‐PLK1 reporter gene had lower fluorescence intensity than cells transfected with miR‐23a‐3p and MUT‐PLK1 reporter gene, indicating that miR‐23a‐3p directly targets PLK1 (Figure 3D). Continuously, macrophages treated with AntagomiR‐23a‐3p resulted in increased PLK1 expression (Figure 3E,F). These results indicated that upregulated miR‐23a‐3p promotes macrophage inflammation response by targeting PLK1.

FIGURE 3.

miR‐23a‐3p directly binds and downregulates PLK1. (A) PLK1‐targeting miRNAs were predicted in three databases (TargetScan, miRTarBase and miRBase), and common miRNA was showed by Venn diagram. (B) Macrophages (RAW 264.7) were stimulated with PBS or LPS (100 ng/ml) for 2 h. The miR‐1322 and miR‐23a‐3p levels were determined by RT‐qPCR. Fold change is compared to PBS. (C) The miR‐1322 and miR23a‐3p‐3p in lung tissue were determined by RT‐qPCR in mice after the saline or LPS challenge. Fold change is compared to normal. (D) TargetScan database showed that miR‐23a‐3p directly bonded to PLK1 3′UTR nucleotide and PLK1 mutation dual‐luciferase plasmid (MUT) was designed. Dual‐luciferase reporter gene assay was preformed to detect PLK1 WT and MUT luciferase activity in HEK293 transfected with miR‐23a mimic or NC mimic. (E) miR‐23a‐3p expression was detected by RT‐qPCR in macrophages transfected with AntagomiR‐23a or AntagomiR‐NC. Fold change is compared to AntagomiR‐NC. (F) PLK1 mRNA level was determined by RT‐qPCR in macrophages (RAW 264.7) transfected with AntagomiR‐23a‐3p or AntagomiR‐NC for 48 h. Fold change is compared to AntagomiR‐NC. Data from three independent experiments are shown. *p < 0.05, **p < 0.01 and ***p < 0.001

3.4. Inhibition of miR‐23a‐3p ameliorates LPS‐induced macrophage M1 polarization in vitro

To investigate the role of macrophage miR‐23a‐3p in LPS‐induced inflammation response, macrophages were transfected using AntagomiR‐23a‐3p or AntagomiR‐NC for 48 h. RT‐qPCR results showed decreased miR‐23a‐3p in macrophages transfected with AntagomiR‐23a‐3p (Figure 4A). After miR‐23a‐3p inhibition, macrophages were treated with LPS to induce an inflammatory response. ELISA results revealed TNF‐α, IL‐6 and IL‐1β level were significantly decreased in AntagomiR‐23a‐3p‐treated macrophages (Figure 4B). Moreover, STAT1 and STAT3 activations were decreased in AntagomiR‐23a‐3p‐treated macrophages. In contrast miR‐23a‐3p overexpression elevated TNF‐α, IL‐6 and IL‐1β levels and promoted STAT1 and STAT3 activations (Figure 4C–E). Taken together, these results revealed that miR‐23a‐3p positively regulates LPS‐induced macrophage M1 polarization.

FIGURE 4.

PLK1 acts as pro‐inflammation effector in ALI. (A) Macrophages were transfected with AntagomiR‐23a‐3p or AntagomiR‐NC for 48 h, and miR‐23a‐3p level was determined by RT‐qPCR. Fold change is compared to AntagomiR‐NC. (B) Macrophages (RAW 264.7) transfected with AntagomiR‐23a‐3p or AntagomiR‐NC were stimulated with LPS (100 ng/ml) for 2 h. The levels of inflammatory cytokine TNF‐α, IL‐6 and IL‐1β were determined by ELISA. Fold change is compared to AntagomiR‐NC. (C) Macrophages were infected with mimic‐NC or mimic‐miR‐23a‐3p for 48 h, and miR‐23a‐3p level was determined by RT‐qPCR. Fold change is compared to mimic‐NC. (D) Macrophages (RAW 264.7) transfected with mimic‐NC or mimic‐miR‐23a‐3p for 48 h were stimulated with LPS (100 ng/ml) for 2 h. The levels of inflammatory cytokine TNF‐α, IL‐6 and IL‐1β were determined by ELISA. Fold change is compared to mimic‐NC. (E) p‐STAT1 and p‐STAT3 were detected by Western blot in macrophage infected with AntagomiR‐23a‐3p or AntagomiR‐NC, lentivirus mimic‐NC or mimic‐miR‐23a‐3p. Fold change is compared to the control AntagomiR‐NC or mimic‐NC. Data from three independent experiments are shown. *p < 0.05, **p < 0.01 and ***p < 0.001

3.5. MiR‐23a‐3p inhibition alleviates LPS‐induced ALI in vivo

To further explore whether miR‐23a‐3p can be a therapeutic target for ALI, AntagomiR‐23a‐3p or AntagomiR‐NC (80 mg/kg) was injected into tail vein for three consecutive days. RT‐qPCR results showed decreased miR‐23a‐3p in lung tissues in AntagomiR‐23a‐3p‐treated ALI mice (Figure 5A). PLK1 was significantly upregulated in miR‐23a‐3p‐inhibited ALI mice (Figure 5B). Lung tissue histological analysis revealed that AntagomiR‐23a‐3p ameliorated lung injury and reduced macrophage infiltration in ALI mice, compared with ALI mice treated with AntagomiR‐NC (Figure 5C). Furthermore, serum TNF‐α, IL‐6 and IL‐1β levels were detected by ELISA, and AntagomiR‐23a‐3p reduced ALI‐induced TNF‐α, IL‐6 and IL‐1β levels (Figure 5D). STAT1 and STAT3 activations were also reduced in AntagomiR‐23a‐3p‐treated ALI mice (Figure 5E). These findings suggest that miR‐23a‐3p is a promising target for LPS‐induced ALI in mice.

FIGURE 5.

miR‐23a‐3p inhibition in vivo alleviates ALI in mice. (A) Mice were tail vein injected with AntagomiR‐23a‐3p or AntagomiR‐NC (80 mg/kg) for three consecutive days, and then, ALI model was established by one‐time intratracheal instillation of 5 mg/kg lipopolysaccharide. 24 h later, mice were sacrificed, and lung tissues were collected, and part of lung tissues were collected for RT‐qPCR to detect miR‐23 expression. Fold change is compared to normal+AntagomiR‐NC. (B) PLK1 mRNA expression was determined by RT‐qPCR. Fold change is compared to normal+AntagomiR‐NC. (C) Histological analysis of lung tissue was performed by HE staining. (D) The levels of inflammatory cytokine IL1β, IL6 and TNF‐α in alveolar macrophages were determined by ELISA. Fold change is compared to normal+AntagomiR‐NC. (E) p‐STAT1 and p‐STAT3 were detected by Western blot in macrophage isolated from mice. Fold change is compared to normal+AntagomiR‐NC. Data from three independent experiments are shown. *p < 0.05, **p < 0.01 and ***p < 0.001

4. DISCUSSION

In this study we investigated the role and mechanism of miR‐23a‐3p in LPS‐induced ALI. Our results showed that miR‐23a‐3p positively regulated LPS‐induced macrophage inflammatory responses by targeting PLK1 and downstream STAT1 and STAT3 activation, indicating miR‐23a‐3p as a potential biomarker and therapeutic target for ALI.

MiRNA binds to target genes to form a RISC complex and thus regulates the expression of these target genes. Much research has shown that miRNA played an important role in sepsis, especially in ALI and ARDS. We predicted that miR‐23a‐3p targets PLK1 through three miRNA databases. Furthermore, we performed a luciferase reporter gene assay by overexpressing PLK1 WT and PLK1 with mutations in the miR‐23a‐3p binding region. Results showed that miR‐23a‐3p directly targeted PLK1. Previous studies have shown that loss of miR‐23~27~24 clusters in T cells resulted in elevated follicular helper T‐cell frequencies upon different immune challenges. ¹⁵ At the same time, studies have shown that miR‐23a‐3p decreased crystal deposition, M1 polarization and injury in the kidney, ²² indicating that miR‐23a‐3p played an important role in regulating immune response. In this study, we found that miR‐23a‐3p was upregulated in LPS‐induced ALI in both lung tissues and macrophages, but not epithelial or endothelial cells. Moreover, inhibition of miR‐23a‐3p ameliorated LPS‐induced macrophage M1 polarization and thus decreased TNF‐α, IL‐6 and IL‐1β levels. In vivo studies also showed inhibition of miR‐23a‐3p ameliorated LPS‐induced ALI in mice.

PLK1 is a conserved mitotic kinase that is essential for the entry into and progression through mitosis. Therefore, previous studies on PLK1 mostly focused on cancer research. PLK1 is highly expressed in tumour cells and promotes tumour cell division and proliferation. Research on PLK1 in the immune response is poorly characterized. Recently, Xu D et al. showed that ECT2 promotes PLK1 expression, and the latter interacts with PTEN, increasing its nuclear translocation and promoting macrophage M2 polarization. ¹⁹ In this study, we showed that PLK1 was decreased in LPS‐induced ALI in both lung tissues and macrophages. Overexpression of PLK1 inhibited macrophage M1 polarization and thus decreased TNF‐α, IL‐6 and IL‐1β levels, while PLK1 knockdown showed the opposite results. Furthermore, we found decreased PLK1 expression was induced by increased miR‐23a‐3p. There results indicate that miR‐23a‐3p decreased PLK1 expression, promotes macrophage M1 polarization, and positively regulates ALI‐induced macrophage immune response.

It is well known that STAT1 and STAT3 play important roles in LPS‐induced macrophage M1 polarization. ²³ , ²⁴ Therefore, we tested the effect of miR‐23a‐3p/PLK1 on the activation of STAT1 and STAT3. The results showed that PLK1 overexpression or miR‐23a‐3p inhibition significantly inhibited the activation of STAT1 and STAT3, suggesting that miR‐23a‐3p/PLK1 promotes the polarization of macrophages and the secretion of inflammatory factors by regulating the activation of STAT1 and STAT3.

In conclusion, our research provides evidence that elevated miR‐23a‐3p in macrophages promotes LPS‐induced ALI by promoting macrophage M1 polarization. The mechanism could be that miR‐23a‐3p directly targeted PLK1, which promotes STAT1/STAT3 activation. Thus the results suggest that miR‐23a‐3p is a potential biomarker and therapeutic target for sepsis‐induced ALI.

AUTHOR CONTRIBUTIONS

TJ and ML involved in conceptualization, methodology, formal analysis and investigation; wrote original draft; and reviewed and edited. LS, JZ and NL involved in conceptualization, methodology, formal analysis and investigation. HG, YZ and JX performed conceptualization and methodology, and reviewed and edited.

CONFLICT OF INTEREST

The authors declare that they have no conflict of interest.

Supporting information

Table S1

Jiang T, Sun L, Zhu J, et al. MicroRNA‐23a‐3p promotes macrophage M1 polarization and aggravates lipopolysaccharide‐induced acute lung injury by regulating PLK1/STAT1/STAT3 signalling. Int J Exp Path. 2022;103:198‐207. doi: 10.1111/iep.12445