Keywords: detrusor overactivity, mice, soluble guanylate cyclase, spinal cord injury, urodynamics
Abstract
We aimed to evaluate the effects of a soluble guanylate cyclase (sGC) activator, BAY 60-2770, on neurogenic lower urinary tract dysfunction in mice with spinal cord injury (SCI). Mice were divided into the following three groups: spinal cord intact (group A), SCI + vehicle (group B), and SCI + BAY 60-2770 (group C). SCI mice underwent Th8–Th9 spinal cord transection and treatment with BAY 60-2770 (10 mg/kg/day) once daily for 2–4 wk after SCI. We evaluated urodynamic parameters using awake cystometry and external urethral sphincter electromyograms (EMG); mRNA levels of mechanosensory channels, nitric oxide (NO)-, ischemia-, and inflammation-related markers in L6–S1 dorsal root ganglia, the urethra, and bladder tissues; and protein levels of cGMP in the urethra at 4 wk after SCI. With awake cystometry, nonvoiding contractions, postvoid residual, and bladder capacity were significantly larger in group B than in group C. Voiding efficiency (VE) was significantly higher in group C than in group B. In external urethral sphincter EMGs, the duration of notch-like reductions in intravesical pressure and reduced EMG activity time were significantly longer in group C than in group B. mRNA expression levels of transient receptor potential ankyrin 1, transient receptor potential vanilloid 1, acid-sensing ion channel (ASIC)1, ASIC2, ASIC3, and Piezo2 in the dorsal root ganglia, and hypoxia-inducible factor-1α, VEGF, and transforming growth factor-β1 in the bladder were significantly higher in group B than in groups A and C. mRNA levels of neuronal NO synthase, endothelial NO synthase, and sGCα1 and protein levels of cGMP in the urethra were significantly lower in group B than in groups A and C. sGC modulation might be useful for the treatment of SCI-related neurogenic lower urinary tract dysfunction.
NEW & NOTEWORTHY This is the first report to evaluate the effects of a soluble guanylate cyclase activator, BAY 60-2770, on neurogenic lower urinary tract dysfunction in mice with spinal cord injury.
INTRODUCTION
Neurogenic lower urinary tract (LUT) dysfunction (LUTD) after spinal cord injury (SCI) features detrusor overactivity (DO) and loss of detrusor and urethral sphincter coordination (termed detrusor sphincter dyssynergia), which result in inefficient voiding, high postvoid residual (PVR) volume, bladder hypertrophy, and high intravesical pressure. Nitric oxide (NO) promotes intracellular cGMP production in smooth muscles, reduces the intracellular Ca2+ concentration, and enhances smooth muscle relaxation (1). Previous studies have shown that NO-mediated pathways are involved in the control of LUT function in multiple ways, including urethral and bladder neck smooth muscle relaxation, increased blood flow due to vascular smooth muscle relaxation, and inhibition of afferent bladder activity (2). Phosphodiesterase type 5 (PDE5) inhibitors, which increase cellular levels of cGMP, are used for the treatment of LUT symptoms in males with benign prostatic hyperplasia (3). NO is known to promote the production of cGMP from GTP via activation of soluble guanylate cyclase (sGC) (4); therefore, this study examined the effects of sGC activation, which can increase cGMP production independent of intracellular NO, on bladder and urethral dysfunction as well as the changes in mechanosensory channel expression in dorsal root ganglia (DRG) in a mouse model of SCI.
MATERIALS AND METHODS
Animals
Fifty female C57BL/6N mice (9 wk old, Envigo, Fredrick, MD) were used in this study. Mice were housed in standard conditions under a 12:12-h light-dark cycle (lights on at 7:00 AM) with ad libitum access to water and standard laboratory chow. SCI was induced by complete transection of the Th8–9 spinal cord. Mice were divided into the following three groups: spinal cord-intact mice (group A), SCI mice treated with vehicle (group B), and SCI mice treated with the sGC activator BAY 60-2770 (group C). Mice in the SCI groups were treated by oral administration of vehicle or BAY 60-2770. The bladder of SCI mice was emptied via abdominal compression once daily after the spinal cord transection was performed (5). We evaluated urodynamic parameters using awake cystometry (CMG) and external urethral sphincter (EUS) electromyograms (EMG); mRNA levels of mechanosensory channels, NO-, ischemia-, and inflammatory-related markers in L6–S1 DRG, the urethra, and bladder tissues; and protein levels of cGMP in urethral tissues at 4 wk after SCI.
Bay 60-2770 Treatment
In the sGC group, BAY 60-2770 (10 mg/kg/day) was orally administered for 2–4 wk after SCI induction. BAY 60-2770 was dissolved in diethylene glycol, cremophor, and water (1:2:7, respectively) using an agate mortar and pestle set to produce a 1.5 mg/mL solution. The drug (10 mg/kg body wt) or vehicle was orally administered by gavage once daily in the morning for 2–4 wk after SCI induction (6, 7).
Awake Cystometry
Four weeks after SCI, mice (group B: n = 5 and group C: n = 6) were anesthetized with isoflurane, and a midline abdominal incision was made to insert a transvesical catheter with a fire-flared tip (PE-50, Clay-Adams, Parsippany, NJ) through the bladder dome. The catheter was secured with a silk thread and connected with a three-way stopcock for bladder filling and monitoring of bladder pressure. Single-filling CMG was performed under an awake condition in motion-restricted animals in restraining cages (Yamanaka Chemical, Kyoto, Japan). In addition, a local anesthetic (EMLA cream containing 2.5% lidocaine and 2.5% prilocaine) was applied to the abdominal skin wound to reduce surgical pain during cystometric recordings. Saline was continually infused through the transvesical catheter at 22°C–24°C for at least 3 h at a speed of 0.01 mL/min to record intravesical pressure. After stabilization of cystometric traces and emptying of the bladder through the catheter, the evaluation of single-filling CMG was immediately initiated by infusing saline. The following parameters were measured: maximal micturition pressure, time to void, number of nonvoiding contractions (NVCs) per voiding cycle, time required to induce the first NVC, voided volume, PVR, bladder capacity, bladder compliance, and VE. NVC was defined as an increase in intravesical pressure of more than 8 cmH2O above the baseline and was evaluated during at least two voiding cycles in the filling phase in each mouse, to obtain average values for statistical comparison (8). PVR was determined by the withdrawal of intravesical fluid by gravity through the bladder catheter. Bladder capacity was calculated based on the infusion rate (0.01 mL/min) multiplied by the time to void (in min) after the initiation of saline infusion. Voided volume was determined by subtracting PVR from the calculated bladder capacity. Bladder compliance was calculated according to the following formula: compliance = bladder capacity/(pressure at volume threshold for inducing a voiding contraction − initial pressure at the start of saline infusion). VE was determined by the following equation: voided volume/bladder capacity × 100. These parameters were evaluated using a PowerLab unit and LabChart (ADInstruments, Colorado Springs, CO).
EUS-EMG Analysis
After cystometric analyses, EUS-EMG was recorded (group B: n = 5 and group C: n = 6) under an awake condition according to previously described methods (9). Eleven animals were briefly reanesthetized for the insertion of EMG electrodes. Epoxy-coated stainless steel wire EMG electrodes (50-µm diameter, M. T. Giken, Tokyo, Japan) were placed percutaneously from the perineum into the EUS using a 28-gauge needle with a tip portion of the EMG electrode hooked at the needle tip. The needle was inserted into the sphincter and withdrawn, leaving the EMG wires embedded in the muscle. After every EUS-EMG experiment, the location of the EMG wire ends was visually examined by dissecting each animal, and if they were located more than 1.0 mm from the urethra, the data were excluded from analyses. EUS-EMG activity was passed through a discriminator, and the output was recorded using an amplifier and data acquisition software (sampling rate: 400 Hz, Chart, ADInstruments) on a computer system equipped with an analog-to-digital converter (PowerLab, ADInstruments). Animals were placed in restraining cages, and simultaneous measurements of intravesical pressure and EUS-EMG activity (under awake conditions) were performed during intravesical saline infusion after recovery from anesthesia. After rhythmic bladder contractions and EUS-EMG activities were confirmed for at least 60 min, two serial filling CMGs and EUS-EMGs were recorded and averaged for statistical analyses. CMG-EMG traces during the voiding phase can detect intermittent voiding coinciding with reductions in intravesical pressure in CMG recordings, which occurred during periods of reduced EUS-EMG activity. In CMG-EMG recordings, we measured voiding contraction time, duration of reduced EMG activity, and the ratio of reduced EMG activity time to voiding contraction time. “Reduced” EMG activity was measured when EMG activity was reduced to baseline levels between tonic firings of EUS-EMG activity during voiding bladder contraction. The voiding contraction time was measured as the duration between the rise of intravesical pressure beyond the threshold pressure and the point at which intravesical pressure returned to the threshold pressure level (10). These EUS-EMG parameters were obtained during the voiding phase of at least two voiding cycles and averaged for statistical comparisons.
Analysis of Expression of NO-, Ischemia-, and Inflammation-Related Markers
In separate groups of animals at 4 wk after SCI induction, L6–S1 DRG, the urethra, and the bladder were harvested from each anesthetized mouse (group A: n = 8, group B, n = 8, and group C, n = 8) under a microscope. The specimens were immediately frozen in liquid nitrogen and stored at −80°C until further processing. Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. All samples were treated with DNase (Promega, Madison, WI) to prevent contamination with genomic DNA, followed by filtering using the RNeasy mini kit (Qiagen, Valencia, CA) or TRIzol reagent. RNA levels were quantified using a spectrophotometer (Biochrom, Cambridge, UK). One microgram of total RNA from DRG, urethra, and bladder tissues was reverse transcribed using Thermoscript with oligo (dT) primers (Invitrogen) according to the manufacturer’s instructions. Real-time PCR was performed in 96-well plates using the MX3000P system (Stratagene, La Jolla, CA). The reaction mixture contained 1.0 μL of diluted cDNA, 25 μL of SYBR Green PCR Master Mix (Qiagen), and a 0.3 μM primer pair, in a total volume of 25 μL. Synthetic oligonucleotide primers were designed (Integrated DNA Technologies, Coralville, IA) to amplify cDNA for the following genes: transient receptor potential ankyrin 1 (TRPA1) (11), transient receptor potential vanilloid 1 (TRPV1) (11), acid-sensing ion channel (ASIC)1 (10), ASIC2 (10), ASIC3 (10), Piezo2 (12), neuronal NO synthase (nNOS) (13), endothelial NO synthase (eNOS) (13), sGCα1 (13), hypoxia-inducible factor-1α (HIF-1α) (14), vascular endothelial growth factor A (VEGF-A) (14), transforming growth factor-β1 (TGF-β1) (15), and β-actin (15). Primers of these genes are shown in Table 1. All primer pairs were tested in silico for specificity against Mus musculus sequences using BLAST software (National Center for Biotechnology Information, Bethesda, MD) and were synthesized by Integrated DNA Technologies. The cycling conditions were as follows: polymerase activation for 10 min, 45 cycles of denaturation at 94°C for 15 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s. A fivefold dilution series of cDNA was used to establish standard curves. The ratio of each marker to β-actin mRNA was used for statistical analyses. Thereafter, the fold increase of each marker’s expression in groups A, B, and C compared with that of the control group was calculated using the average values of each group. β-Actin transcript levels were similar between the different groups.
Table 1.
Real-time PCR primer list
| Forward (5′-3′) | Reverse (5′-3′) | |
|---|---|---|
| TRPA1 | TCGTGTGAAGTGCTGAATAT | AACTTTACACTTTCAACTTGATTTT |
| TRPV1 | TACTTTTCTTTGTACAGTCACT | TCAATCATGACAGCATAGAT |
| ASIC1 | GCCTATGAGATCGCAGGG | AAAGTCCTCAAACGTGCCTC |
| ASIC2 | GAAGAGGAAGGGAGCCATGAT | GGCAGAAGTTCGCAATGTGT |
| ASIC3 | CCCAGCTCTGGACGCTATG | TCTTCCTGGAGCAGAGTGTTG |
| Piezo2 | GCACTCTACCTCAGGAAGACTG | CAAAGCTGTGCCACCAGGTTCT |
| nNOS | TCAGTCTCCCAGGCTAATGG | CTGTCCACCTGGATTCCTGT |
| eNOS | GACCCTCACCGCTACAACAT | GCTCATTTTCCAGGTGCTTC |
| sGCα1 | AGCGACTGAACCTTGCACTT | ACCTGCTGCAATTGCTTCTT |
| HIF-1α | TCAAGTCAGCAACGTGGAAG | TATCGAGGCTGTGTCGACTG |
| VEGF-A | CAGGCTGCTGTAACGATGAA | CAATTTGGCTCCTCCTACCA |
| TGF-β1 | ACAGGGCTTTCGATTCAGCG | GGGGCTGATCCCGTTGATTTC |
| β-Actin | GCCCTGAGGCTCTTTTCCAG | TGCCACAGGATTCCATACCC |
ASIC, acid-sensing ion channel; eNOS, endothelial nitric oxide synthase; HIF-1α, hypoxia-inducible factor-1α; nNOS, neuronal nitric oxide synthase; sGCα1, soluble guanylyl cyclase α1; TGF-β1, transforming growth factor-β1; TRPA1, transient receptor potential ankyrin 1; TRPV1, transient receptor potential vanilloid 1; VEGF-A, vascular endothelial growth factor A.
Determination of cGMP Levels in the Urethra
In separate groups of mice at 4 wk after SCI induction, the urethra was immediately excised after mice were euthanized (group A: n = 6, group B: n = 6, and group C: n = 6). Tissues were pulverized and subsequently processed for cGMP measurements using an enzyme-linked immunoassay kit following the manufacturer’s protocol (Cayman Chemical Cyclic GMP EIA kit, Ann Arbor, MI). The assays were performed in duplicate, and tissues were weighed to normalize the data as picomoles per milligram of tissue (7, 16).
Ethical Considerations
All animal experiments were conducted in accordance with Animal Research: Reporting of In Vivo Experiments and National Institutes of Health guidelines and were approved by the Institutional Animal Care and Use Committee of the University of Pittsburgh (Protocol Approval No. 18093579).
Statistical Analysis
All values are expressed as means ± SD. A Mann–Whitney U test and Kruskal–Wallis one-way ANOVA were used to evaluate statistical differences between two groups and among three groups, respectively. Prism software (v. 8.4.2, GraphPad Software, San Diego, CA) was used for statistical analyses and data plotting. Statistical significance was set at P < 0.05.
RESULTS
Mice were divided into the following three groups: spinal cord-intact mice (group A), SCI mice treated with vehicle (group B), and SCI mice treated with the sGC activator BAY 60-2770 (group C).
Body Weight
Body weight was significantly lower in group B than in group A (17.2 ± 0.4 vs. 19.5 ± 0.5 g, P = 0.0051). However, there was no significant difference between groups B and C and between groups A and C.
Cystometric Evaluation
Typical CMGs are shown in Fig. 1, and cystometric parameters are shown in Table 2. Because changes in bladder function in SCI mice versus spinal-intact control mice have already been documented in our previous studies (9, 17), urodynamic evaluation using cystometry and EUS-EMG recordings were made between vehicle-treated and sGC-treated SCI mice to focus on the drug treatment effects on SCI-induced LUTD.
Figure 1.
Representative charts of single-filling cystometry in a vehicle-treated spinal cord-injured (SCI) mouse (A) and a BAY 60-2770-treated SCI mouse (B). Time to voiding, nonvoiding contractions (NVCs) per minute, postvoid residual, and bladder capacity were greater in the vehicle-treated mouse than in the BAY 60-2770-treated mouse.
Table 2.
Comparison of cystometric parameters
| SCI With Vehicle (n = 5) | SCI With Soluble Guanylyl Cyclase (n = 6) | |
|---|---|---|
| Micturition pressure, cmH2O | 42.1 ± 2.1 | 38.3 ± 6.1 |
| Time to void, min | 44.4 ± 12.3 | 33.5 ± 9.2* |
| NVCs, number of NVCs/min | 0.9 ± 0.3 | 0.5 ± 0.1† |
| Time to first NVC, min | 15.1 ± 7.6 | 18.6 ± 4.2 |
| Voided volume, mL | 0.0 ± 0.0 | 0.0 ± 0.0 |
| Postvoid residual, mL | 0.4 ± 0.1 | 0.3 ± 0.1* |
| Bladder capacity, mL | 0.5 ± 0.1 | 0.3 ± 0.1* |
| Bladder compliance, mL/cmH2O | 0.0 ± 0.0 | 0.1 ± 0.0 |
| Voiding efficiency, % | 6.5 ± 1.5 | 13.0 ± 4.0† |
Shown is a comparison of cystometric parameters in vehicle-treated (n = 5) and BAY 60-2770-treated spinal cord-injured (SCI) mice (n = 6). NVCs, nonvoiding contractions. *P < 0.05 compared with the SCI with vehicle-treated group; †P < 0.01 compared with the SCI with vehicle-treated group.
In single-filling CMG, time to voiding, NVCs per minute, PVR, and bladder capacity were significantly larger in group B than in group C (time to voiding: 44.4 ± 12.3 vs. 33.5 ± 9.2 s, P = 0.0303; NVCs: 0.9 ± 0.3 vs. 0.5 ± 0.1 NVCs/min, P = 0.0022; PVR: 0.4 ± 0.1 vs. 0.3 ± 0.1 mL, P = 0.0303; and bladder capacity: 0.5 ± 0.1 vs. 0.3 ± 0.1 mL, P = 0.0303). On the other hand, efficiency was significantly higher in group C than in group B (13.0 ± 4.0% vs. 6.5 ± 1.5%, P = 0.0087).
EUS-EMG Analysis
Typical charts of CMG and EUS-EMG recordings are shown in Fig. 2, and EUS-EMG parameters are shown in Table 3. Voiding contraction time was significantly less in group C than in group B (20.2 ± 1.9 vs. 25.1 ± 3.5 s, P = 0.0303). The duration of notch-like reductions in intravesical pressure on CMG traces and reduced EMG activity time were significantly longer in group C than in group B (notch-like reductions: 1.7 ± 0.5 vs. 1.0 ± 0.3 s, P = 0.0303; and reduced EMG activity: 1.5 ± 0.2 vs. 0.9 ± 0.1 s, P = 0.0043).
Figure 2.
Representative charts of cystometry and external urethral sphincter-electromyograms (EMGs) in a vehicle-treated spinal cord-injured (SCI) mouse (A) and a BAY 60-2770-treated SCI mouse (B). Voiding contraction time was shorter in the soluble guanylate cyclase-treated mouse than in the vehicle-treated mouse. The durations of notch-like reductions in intravesical pressure on awake cystometry traces and reduced EMG activity time on external urethral sphincter (EUS) EMG traces were longer in the soluble guanylate cyclase-treated mouse than in the vehicle-treated mouse.
Table 3.
Comparison of cystometry and external urethral sphincter-EMG parameters
| SCI With Vehicle (n = 5) | SCI With Soluble Guanylyl Cyclase (n = 6) | |
|---|---|---|
| Voiding contraction time, s | 25.1 ± 3.5 | 20.2 ± 1.9* |
| Notch-like reduction time, s | 1.0 ± 0.3 | 1.7 ± 0.5* |
| Reduced EMG activity time, s | 0.9 ± 0.1 | 1.5 ± 0.2† |
Shown is a comparison of cystometry and external urethral sphincter-electromyogram (EMG) parameters in vehicle-treated (n = 5) and BAY 60-2770-treated spinal cord-injured (SCI) mice (n = 6). *P < 0.05 compared with the SCI with vehicle-treated group; †P < 0.01 compared with the SCI with vehicle-treated group.
Molecular Analysis
In the comparison among spinal intact (group A) and SCI mouse groups (groups B and C), mRNA expression levels of TRPA1, TRPV1, ASIC1, ASIC2, ASIC3, and Piezo2 in L6–S1 DRG were significantly higher in group B than in groups A and C (TRPA1: 1.7 ± 0.3 vs. 1.0 ± 0.3, P = 0.0035, and 1.1 ± 0.4-fold, P = 0.0413; TRPV1: 1.7 ± 0.3 vs. 1.0 ± 0.5, P = 0.0413, and 1.1 ± 0.3-fold, P = 0.0240; ASIC1: 2.6 ± 1.1 vs. 1.0 ± 0.4, P = 0.0021, and 1.1 ± 0.7-fold, P = 0.0062; ASIC2: 3.0 ± 1.8 vs. 1.0 ± 0.6, P = 0.0385, and 0.9 ± 0.4-fold, P = 0.0205; ASIC3: 3.0 ± 2.3 vs. 1.0 ± 0.7, P = 0.0054, and 1.1 ± 0.3-fold, P = 0.0449; and Piezo2: 1.7 ± 0.8 vs. 1.0 ± 0.8, P = 0.0331, and 0.8 ± 0.4-fold, P = 0.0198, respectively). mRNA levels of nNOS, eNOS, and sGCα1 in the urethra were significantly lower in group B than in groups A and C (nNOS: 0.1 ± 0.0 vs. 1.0 ± 0.5, P = 0.0001, and 0.4 ± 0.2-fold, P = 0.0469; eNOS: 0.3 ± 0.1 vs. 1.0 ± 0.4, P = 0.0011, and 0.7 ± 0.2-fold, P = 0.0406; and sGCα1: 0.4 ± 0.1 vs. 1.0 ± 0.2, P = 0.0001, and 0.7 ± 0.2-fold, P = 0.0447, respectively). mRNA levels of HIF-1α, VEGF, and TGF-β1 in the bladder were significantly higher in group B than in groups A and C (HIF-1α: 3.2 ± 1.4 vs. 1.0 ± 0.4, P = 0.0005, and 1.5 ± 0.6-fold, P = 0.0486; VEGF: 5.1 ± 2.3 vs. 1.0 ± 0.9, P = 0.0019, and 1.9 ± 1.3-fold, P = 0.0449; and TGF-β1: 1.8 ± 0.3 vs. 1.0 ± 0.2, P < 0.0001, and 1.2 ± 0.2-fold, P = 0.0295, respectively; Fig. 3).
Figure 3.
mRNA expression in the L6−S1 dorsal root ganglia (DRG), urethra, and bladder in spinal cord-intact mice (n = 8; group A), vehicle-treated mice (n = 8; group B), and BAY 60-2770-treated spinal cord-injured (SCI) mice (n = 8; group C). mRNA levels of transient receptor potential ankyrin 1 (TRPA1), transient receptor potential vanilloid 1 (TRPV1), acid-sensing ion channel (ASIC)1, ASIC2, ASIC3, and Piezo2 in L6−S1 DRG were significantly higher in group B than in groups A and C. mRNA levels of neuronal nitric oxide synthase (nNOS), endothelial nitric oxide synthase (eNOS), and soluble guanylate cyclase (sGC)α1 in the urethra were significantly lower in group B than in groups A and C. mRNA levels of hypoxia-inducible factor-1α (HIF-1α), vascular endothelial growth factor (VEGF), and transforming growth factor-β1 (TGF-β1) in the bladder were significantly higher in group B than in groups A and C. y-axis values are expressed as the ratio of each marker to the β-actin mRNA level for statistical analyses. *P < 0.05, **P < 0.01, and ***P < 0.001 vs. spinal cord-intact mice. †P < 0.05 and ††P < 0.01 vs. vehicle-treated SCI mice.
cGMP Levels in the Urethra
cGMP concentrations in the urethra were significantly lower in group B than in groups A and C (1.9 ± 1.0 vs. 4.4 ± 1.0, P < 0.0386, and 6.1 ± 3.3, P = 0.0125, respectively; Fig. 4).
Figure 4.
Protein levels of cGMP in the urethra in spinal cord-intact mice (n = 6; group A), vehicle-treated spinal cord-injured (SCI) mice (n = 6; group B), and BAY 60-2770-treated SCI mice (n = 6; group C). cGMP concentrations in the urethra were significantly lower in group B than in groups A and C. *P < 0.05 vs. spinal cord-intact mice. †P < 0.05 vs. vehicle-treated SCI mice.
DISCUSSION
This is the first study to examine the effects of sGC activation on LUTD in SCI mice. In this study, after sGC activator treatment, which can directly increase cGMP production independent of NO, detrusor overactivity and detrusor sphincter dyssynergia were improved, evident as reduced NVCs and an increase in reduced EMG activity time during voiding in 4-wk post-SCI mice, respectively. In addition, the duration of notch-like reductions on CMG traces and reduced EMG activity time on EUS-EMG traces were significantly increased in the sGC-treated SCI group, indicating an improvement in the EUS synergic relaxation during voiding, leading to better VE after sGC treatment. Thus, these results suggest that sGC-targeting treatment might be an efficacious modality for ameliorating bladder storage dysfunction due to plasticity of bladder afferent pathways and also voiding dysfunction and detrusor sphincter dyssynergia in SCI mice.
The bladders of various species are innervated by two types of afferent fibers, Aδ- and C-fibers, which have different functions. Normal micturition in spinal cord-intact mice is predominantly controlled by Aδ bladder afferent pathways, whereas, after SCI, increased excitability of capsaicin-sensitive, C-fiber bladder afferents contributes to the emergence of detrusor overactivity (18–20). The increased excitability of capsaicin-sensitive bladder afferent neurons (18) is mediated in part by overexpression of neurotrophic factors such as nerve growth factor and brain-derived neurotrophic factor (21, 22). A previous cystometric study in awake mice at 4 wk after SCI revealed that pretreatment with capsaicin, a C-fiber neurotoxin, suppressed NVCs during bladder filling but did not affect increased bladder capacity, low bladder compliance, high voiding pressure, or poor VE after SCI (23). These results suggest that detrusor overactivity in the storage phase and inefficient urine elimination in the voiding phase are induced by different afferent mechanisms in C-fiber and Aδ afferent pathways, respectively, in SCI mice. In the present study, sGC treatment for 2 wk significantly reduced the number of NVCs and expression of C-fiber afferent markers such as TRPV1 and TRPA1 in L6–S1 DRG, which contain bladder afferent pathways, in SCI mice, suggesting the improvement of C-fiber-mediated storage LUTD after sGC activation.
ASICs were initially characterized as ion channels that respond to the extracellular pH environment but were later found to have mechanosensitive functions (24, 25). In addition, Piezo2 is an ion channel receptor that is mechanically activated and expressed in a subpopulation of sensory neurons, which is classified as low-threshold mechanosensory neurons that detect the direction of stimulus movements (26, 27). Previous studies have reported that ASICs and Piezo2 act as mechanosensitive channels in afferent pathways and that ASIC1–ASIC3 receptors are expressed in TRPV1-expressing, unmyelinated, C-fiber neurons as well as in mechanosensitive, myelinated A-fiber neurons, whereas Piezo2 is predominantly expressed in mechanosensitive, myelinated A-fiber neurons (26–29). In the present study, the durations of reduced EMG activity in EUS-EMG recordings and notch-like reduction periods of intravesical pressure in CMG were increased in the sGC-treated SCI group, indicating that sGC activation improved urethral synergic relaxation during voiding, leading to increased VE. Furthermore, the improvement of voiding dysfunction and detrusor sphincter dyssynergia after sGC treatment was associated with downregulation of ASICs and Piezo2 channels; thus, it is assumed that sGC treatment can reduce the excessive activity of ASICs/Piezo2-expressing mechanosensitive Aδ-fiber afferent pathways, thereby improving post-SCI inefficient voiding. Because a previous study showed that PDE5 is expressed in rat EUS striated muscle more abundantly than in urethral smooth muscle (30), the sGC-induced improvement of detrusor sphincter dyssynergia in SCI mice might be mediated by the enhanced NO-cGMP pathway after sGC in EUS striated muscles. In addition, it should be noted that changes in the NO-related function in urethral smooth muscles after SCI and sGC treatment were not examined in this study partly because it was technically difficult to measure urethral pressure in vivo in mice. Thus, further studies are needed to clarify these points.
Molecular studies have also shown that sGC treatment restored mRNA expression of nNOS, eNOS, and sGCα1 in the urethra of SCI mice and that downregulated protein levels of cGMP in the urethra in vehicle-treated SCI mice were significantly increased after sGC treatment in SCI mice. These results raised the possibility that NO-GC-cGMP function, which is impaired after SCI, might be improved after sGC activation.
Moreover, sGC treatment might be effective in reducing ischemia and inflammatory changes in the bladder, evidenced by decreased expression of HIF-1α, VEGF, and TGF-β1 after the treatment. In recent years, various studies have been conducted to examine the influence of blood supply on LUT function and raised the possibility that changes in blood supply to the LUT may affect voiding and storage function (31, 32). Tadalafil, a PDE5 inhibitor, has been approved for the treatment of urinary symptoms associated with benign prostatic hyperplasia. PDE5 inhibitors increase the levels of cGMP produced through the activation of NO-dependent pathways by inhibiting cGMP breakdown (33). Because sGC treatment in this study increased urethral levels of cGMP in NO-independent manner and reduced post-SCI bladder ischemia and associated inflammatory changes, we could expect a larger therapeutic effect of sGC treatment on LUTD compared with PDE5 inhibitors (4) in disease conditions such as SCI (Fig. 3) or diabetes mellitus (34, 35), in which NO synthase activity is reduced.
This study has some limitations that should be acknowledged. First, we only tested one dose (10 mg/kg) of sGC treatment; therefore, a dose-response relationship using multiple sGC doses should be examined in future studies. Second, we did not directly measure afferent nerve activity, although this study suggested that sGC treatment may have affected afferent nerve function to improve detrusor overactivity in SCI mice. Thus, direct afferent nerve activity measurements during bladder filling are needed in future studies. Third, systemic sGC treatment could potentially induce other systemic effects such as a hypotensive response due to cGMP-dependent vascular relaxation (4); however, we did not examine the effects of sGC treatment on blood pressure, although there was no mortality in SCI mice with sGC treatment. Thus, future studies are needed to examine the cardiovascular effects of sGC treatment in SCI mice. Fourth, we did not investigate the effect of sGC treatment in spinal cord-intact mice. Therefore, the sGC-induced effects, including those on any targets other than the LUT, under the spinal cord-intact condition are not known. Finally, because we evaluated only mRNA levels of various markers, future studies are needed to examine whether their protein levels are similarly altered to induce phenotypic changes in LUT function after SCI and sGC treatment.
Conclusions
BAY 60-2770, a sGC activator, reduced the number of NVCs and increased VE and mRNA expression of NO-related markers while decreasing the mRNA expression of C-fiber afferent markers, mechanosensitive channels, and ischemia- and inflammation-related markers in SCI mice. Thus, sGC activation, which can increase cGMP levels inside the cell in a NO-independent manner, could be an effective modality for the treatment of SCI-related neurogenic LUTD such as detrusor overactivity and detrusor sphincter dyssynergia.
GRANTS
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant R01DK129194.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
AUTHOR CONTRIBUTIONS
D.G. and N.Y. conceived and designed research; D.G. and T.S. performed experiments; D.G. analyzed data; D.G. interpreted results of experiments; D.G. prepared figures; D.G. drafted manuscript; S.K., Y.M., S.H., Y.N., M.M., K.T., K.F., and N.Y. edited and revised manuscript; all authors approved final version of manuscript.
REFERENCES
- 1. Anderson KE. Pharmacology of lower urinary tract smooth muscles and penile erectile tissues. Pharmacol Rev 45: 253–308, 1993. [PubMed] [Google Scholar]
- 2. Moncada S, Palmer RM, Higgs EA. Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol Rev 43: 109–142, 1991. [PubMed] [Google Scholar]
- 3. Andersson K-E, De Groat WC, McVary KT, Lue TF, Maggi M, Roehrborn CG, Wyndaele JJ, Melby T, Viktrup L. Tadalafil for the treatment of lower urinary tract symptoms secondary to benign prostatic hyperplasia: pathophysiology and mechanism(s) of action. Neurourol Urodyn 30: 292–301, 2011. doi: 10.1002/nau.20999. [DOI] [PubMed] [Google Scholar]
- 4. Mónica FZ, Antunes E. Stimulators and activators of soluble guanylate cyclase for urogenital disorders. Nat Rev Urol 15: 42–54, 2018. doi: 10.1038/nrurol.2017.181. [DOI] [PubMed] [Google Scholar]
- 5. Wada N, Shimizu T, Takai S, Shimizu N, Kanai AJ, Tyagi P, Kakizaki H, Yoshimura N. Post-injury bladder management strategy influences lower urinary tract dysfunction in the mouse model of spinal cord injury. Neurourol Urodyn 36: 1301–1305, 2017. doi: 10.1002/nau.23120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Alexandre EC, Leiria LO, Silva FH, Mendes-Silvério CB, Calmasini FB, Davel APC, Mónica FZ, De Nucci G, Antunes E. Soluble guanylyl cyclase (sGC) degradation and impairment of nitric oxide-mediated responses in urethra from obese mice: reversal by the sGC activator BAY 60-2770. J Pharmacol Exp Ther 349: 2–9, 2014. doi: 10.1124/jpet.113.211029. [DOI] [PubMed] [Google Scholar]
- 7. Gotoh D, Cao N, Alexandre EC, Saito T, Morizawa Y, Hori S, Miyake M, Torimoto K, Fujimoto K, Yoshimura N. Effects of low-dose insulin or a soluble guanylate cyclase activator on lower urinary tract dysfunction in streptozotocin-induced diabetic rats. Life Sci 286: 120001, 2021. doi: 10.1016/j.lfs.2021.120001. [DOI] [PubMed] [Google Scholar]
- 8. Kadekawa K, Sugaya K, Nishijima S, Ashitomi K, Miyazato M, Ueda T, Yamamoto H. Effect of naftopidil, an alpha1D/A-adrenoceptor antagonist, on the urinary bladder in rats with spinal cord injury. Life Sci 92: 1024–1028, 2013. doi: 10.1016/j.lfs.2013.03.021. [DOI] [PubMed] [Google Scholar]
- 9. Kadekawa K, Yoshimura N, Majima T, Wada N, Shimizu T, Birder LA, Kanai AJ, de Groat WC, Sugaya K, Yoshiyama M. Characterization of bladder and external urethral activity in mice with or without spinal cord injury–a comparison study with rats. Am J Physiol Regul Integr Comp Physiol 310: R752–R758, 2016. doi: 10.1152/ajpregu.00450.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Wada N, Shimizu T, Shimizu N, Kurobe M, de Groat WC, Tyagi P, Kakizaki H, Yoshimura N. Therapeutic effects of inhibition of brain-derived neurotrophic factor on voiding dysfunction in mice with spinal cord injury. Am J Physiol Renal Physiol 317: F1305–F1310, 2019. doi: 10.1152/ajprenal.00239.2019. [DOI] [PubMed] [Google Scholar]
- 11. Wada N, Shimizu T, Shimizu N, de Groat WC, Kanai AJ, Tyagi P, Kakizaki H, Yoshimura N. The effect of neutralization of nerve growth factor (NGF) on bladder and urethral dysfunction in mice with spinal cord injury. Neurourol Urodyn 37: 1889–1896, 2018. doi: 10.1002/nau.23539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Murthy SE, Loud MC, Daou I, Marshall KL, Schwaller F, Kühnemund J, Francisco AG, Keenan WT, Dubin AE, Lewin GR, Patapoutian A. The mechanosensitive ion channel Piezo2 mediates sensitivity to mechanical pain in mice. Sci Transl Med 10: eaat9897, 2018. doi: 10.1126/scitranslmed.aat9897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Liang D-Y, Clark JD. Modulation of the NO/CO-cGMP signaling cascade during chronic morphine exposure in mice. Neurosci Lett 365: 73–77, 2004. doi: 10.1016/j.neulet.2004.04.054. [DOI] [PubMed] [Google Scholar]
- 14. Majumder A, Singh M, George AK, Behera J, Tyagi N, Tyagi SC. Hydrogen sulfide improves postischemic neoangiogenesis in the hind limb of cystathionine-β-synthase mutant mice via PPAR-γ/VEGF axis. Physiol Rep 6: e13858, 2018. doi: 10.14814/phy2.13858. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Gotoh D, Shimizu N, Wada N, Kadekawa K, Saito T, Mizoguchi S, Morizawa Y, Hori S, Miyake M, Torimoto K, de Groat WC, Fujimoto K, Yoshimura N. Effects of a new β3-adrenoceptor agonist, vibegron, on neurogenic bladder dysfunction and remodeling in mice with spinal cord injury. Neurourol Urodyn 39: 2120–2127, 2020. doi: 10.1002/nau.24486. [DOI] [PubMed] [Google Scholar]
- 16. Alexandre EC, Cao N, Mizoguchi S, Saito T, Kurobe M, Gotoh D, Okorie M, Igarashi T, Antunes E, Yoshimura N. Urethral dysfunction in a rat model of chemically induced prostatic inflammation: potential involvement of the MRP5 pump. Am J Physiol Renal Physiol 318: F754–F762, 2020. doi: 10.1152/ajprenal.00566.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Saito T, Gotoh D, Wada N, Tyagi P, Minagawa T, Ogawa T, Ishizuka O, Yoshimura N. Time-dependent progression of neurogenic lower urinary tract dysfunction after spinal cord injury in the mouse model. Am J Physiol Renal Physiol 321: F26–F32, 2021. doi: 10.1152/ajprenal.00622.2020. [DOI] [PubMed] [Google Scholar]
- 18. De Groat WC, Yoshimura N. Changes in afferent activity after spinal cord injury. Neurourol Urodyn 29: 63–76, 2010. doi: 10.1002/nau.20761. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. De Groat WC, Yoshimura N. Plasticity in reflex pathways to the lower urinary tract following spinal cord injury. Exp Neurol 235: 123–132, 2012. doi: 10.1016/j.expneurol.2011.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Vizzard MA. Neurochemical plasticity and the role of neurotrophic factors in bladder reflex pathways after spinal cord injury. Prog Brain Res 152: 97–115, 2006. doi: 10.1016/S0079-6123(05)52007-7. [DOI] [PubMed] [Google Scholar]
- 21. Qiao L, Vizzard MA. Up-regulation of tyrosine kinase (Trka, Trkb) receptor expression and phosphorylation in lumbosacral dorsal root ganglia after chronic spinal cord (T8-T10) injury. J Comp Neurol 449: 217–230, 2002. doi: 10.1002/cne.10283. [DOI] [PubMed] [Google Scholar]
- 22. Vizzard MA. Changes in urinary bladder neurotrophic factor mRNA and NGF protein following urinary bladder dysfunction. Exp Neurol 161: 273–284, 2000. doi: 10.1006/exnr.1999.7254. [DOI] [PubMed] [Google Scholar]
- 23. Kadekawa K, Majima T, Shimizu T, Wada N, de Groat WC, Kanai AJ, Goto M, Yoshiyama M, Sugaya K, Yoshimura N. The role of capsaicin-sensitive C-fiber afferent pathways in the control of micturition in spinal-intact and spinal cord-injured mice. Am J Physiol Renal Physiol 313: F796–F804, 2017. doi: 10.1152/ajprenal.00097.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. McIlwrath SL, Hu J, Anirudhan G, Shin J-B, Lewin GR. The sensory mechanotransduction ion channel ASIC2 (acid sensitive ion channel 2) is regulated by neurotrophin availability. Neuroscience 131: 499–511, 2005. doi: 10.1016/j.neuroscience.2004.11.030. [DOI] [PubMed] [Google Scholar]
- 25. Traini C, Del Popolo G, Lazzeri M, Mazzaferro K, Nelli F, Calosi L, Vannucchi MG. γEpithelial Na+ channel (γENaC) and the acid-sensing ion channel 1 (ASIC1) expression in the urothelium of patients with neurogenic detrusor overactivity. BJU Int 116: 797–804, 2015. doi: 10.1111/bju.12896. [DOI] [PubMed] [Google Scholar]
- 26. Romero LO, Caires R, Nickolls AR, Chesler AT, Cordero-Morales JF, Vásquez V. A dietary fatty acid counteracts neuronal mechanical sensitization. Nat Commun 11: 2997, 2020. [Erratum in Nat Commun 11: 3938, 2020]. doi: 10.1038/s41467-020-16816-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Szczot M, Pogorzala LA, Solinski HJ, Young L, Yee P, Le Pichon CE, Chesler AT, Hoon MA. Cell-type-specific splicing of piezo2 regulates mechanotransduction. Cell Rep 21: 2760–2771, 2017. doi: 10.1016/j.celrep.2017.11.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Rutlin M, Ho C-Y, Abraira VE, Cassidy C, Bai L, Woodbury CJ, Ginty DD. The cellular and molecular basis of direction selectivity of AδLTMRs. Cell 159: 1640–1651, 2014. [Erratum in Cell 160: 1027, 2015]. doi: 10.1016/j.cell.2014.11.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Schrenk-Siemens K, Wende H, Prato V, Song K, Rostock C, Loewer A, Utikal J, Lewin GR, Lechner SG, Siemens J. PIEZO2 is required for mechanotransduction in human stem cell-derived touch receptors. Nat Neurosci 18: 10–16, 2015. doi: 10.1038/nn.3894. [DOI] [PubMed] [Google Scholar]
- 30. Lin G, Huang Y-C, Wang G, Lue TF, Lin CS. Prominent expression of phosphodiesterase 5 in striated muscle of the rat urethra and levator ani. J Urol 184: 769–774, 2010. doi: 10.1016/j.juro.2010.03.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Yamaguchi O, Nomiya M, Andersson K-E. Functional consequences of chronic bladder ischemia. Neurourol Urodyn 33: 54–58, 2014. doi: 10.1002/nau.22517. [DOI] [PubMed] [Google Scholar]
- 32. Gotoh D, Torimoto K, Tatsumi Y, Hori S, Yamada A, Miyake M, Morizawa Y, Aoki K, Tanaka N, Hirayama A, Fujimoto K. Tadalafil, a phosphodiesterase type 5 inhibitor, improves bladder blood supply and restores the initial phase of lower urinary tract dysfunction in diabetic rats. Neurourol Urodyn 37: 666–672, 2018. doi: 10.1002/nau.23372. [DOI] [PubMed] [Google Scholar]
- 33. Morelli A, Sarchielli E, Comeglio P, Filippi S, Mancina R, Gacci M, Vignozzi L, Carini M, Vannelli GB, Maggi M. Phosphodiesterase type 5 expression in human and rat lower urinary tract tissues and the effect of tadalafil on prostate gland oxygenation in spontaneously hypertensive rats. J Sex Med 8: 2746–2760, 2011. doi: 10.1111/j.1743-6109.2011.02416.x. [DOI] [PubMed] [Google Scholar]
- 34. Tong Y-C, Cheng J-T. Changes in bladder nerve-growth factor and p75 genetic expression in streptozotocin-induced diabetic rats. BJU Int 96: 1392–1396, 2005. doi: 10.1111/j.1464-410X.2005.05854.x. [DOI] [PubMed] [Google Scholar]
- 35. Torimoto K, Hirao Y, Matsuyoshi H, de Groat WC, Chancellor MB, Yoshimura N. alpha1-Adrenergic mechanism in diabetic urethral dysfunction in rats. J Urol 173: 1027–1032, 2005. doi: 10.1097/01.ju.0000146268.45662.36. [DOI] [PubMed] [Google Scholar]