Skip to main content
Cureus logoLink to Cureus
. 2022 Aug 21;14(8):e28247. doi: 10.7759/cureus.28247

Frequency of Intron 22 Inversion in Severe Hemophilia A Patients

Javeria Ashfaq 1,, Rehana Ahmed 2, Faryal Tariq 1, Qurat ul Abedin 2, Madiha Abid 2, Munira Borhany 2
Editors: Alexander Muacevic, John R Adler
PMCID: PMC9490293  PMID: 36158401

Abstract

Objective: The aim of our study was to find the frequency of Intron 22 inversion (Inv22) in severe hemophilia A (HA) patients and to evaluate the association between Inv22 and FVIII inhibitor formation.

Method: Data analysis was carried out on IBM SPSS Statistics Version 23.00 (IBM Corp, Armonk, NY). Descriptive statistics were applied to measure the frequencies, percentages, and mean ± SD of the clinical and general history of HA patients, including age, family history, inhibitor status, intron22 inversion, and FVIII levels. Chi-square was applied to evaluate the association between Inv22 and F8 inhibitor formation.

Results: A total of 62 HA patients were enrolled in the study with mean±SD age of (14.39±13.2) years. A family history of HA was observed in 36 (58.1%) patients. Out of 62 patients, 28(45.2%) were reported as Inv22 positive while inhibitor status was observed as positive in three (4.83%) patients. However, an insignificant association was observed between the inhibitor and Inv22 positive patients with a p-value=0.443.

Conclusion: In our study, Inv22 was found to be the major cause of severe HA in our patients, i.e., 45.1%. However, no significant relation was computed between Inv22 and inhibitor formation.

Keywords: factor viii, inhibitor, severity, intron 22 inversion, haemophilia a

Introduction

The most prevalent blood condition induced by a factor VIII shortage or malfunction is called hemophilia A (HA). It is assumed that HA is a recessive trait linked to the X chromosome [1]. HA was defined as mild with>5% FVIII activity, moderate with 1%-5% FVIII activity, or severe with <1% FVIII activity. Intron 22 inversion (Inv22) is the most prevalent genetic abnormality that causes severe HA (45% of patients) [2]. Others include missense mutation, nonsense mutation, frame splicing, and insertion mutation [3]. Inv22 causes 50% of severe HA cases. Another essential genetic anomaly found in 2%-5% of patients with severe HA is also due to inversion of intron 1 (Inv1). The FVIII gene has a 1041-bp region (Int1h-1) along with its 1 extragenic copy in Intron 1 (Int1h-2; 140 kb telomerically). The recombination of chromosomes between extragenic copy, Int1h-2, and Int1h-1 results in factor FVIII Inv1 [4]. Due to this inversion change, messenger RNA (mRNA) for FVIII does not form, resulting in the absence of FVIII, causing severe HA [5-9]. Both Inv22 variants have been postulated to have a higher likelihood of inhibitor formation, making treatment more difficult [5].

Several methods are used to find changes in HA. Methods like mutation screening and linkage analysis are used to see a specific gene section. Along with these, direct sequencing of the entire gene is also used [10]. Due to its high cost, direct sequencing is uncommon. Direct mutation detection is preferable to indirect linkage analysis; nevertheless, due to limited resources in developing countries like Pakistan, there are some issues with its application. Our goal was to determine the frequency of Inv22 in severe HA patients and the relationship between inhibitor formation and Inv22s.

Materials and methods

A single-center, cross-sectional study was conducted at the National Institute of Blood Diseases and Bone Marrow Transplantation, Karachi, Pakistan. From November 2019 to December 2021, patients diagnosed with severe HA were screened for Inv22. For data collection, a convenient sampling technique was considered. The sample size was calculated using the WHO calculator.

The Institutional Review Board/Ethics Committee, Hematology, NIBD (approval number NIBD/RD-198/09-2019) approved the study. Informed consent was obtained from all patients. Only severe HA cases were included in the study. While mild, moderate HA cases and patients with other bleeding disorders were omitted.

Genomic DNA (2 µg) was digested with 20 units of BclI in a 50 µL reaction for 4 h. To isolate digested DNA, we utilized phenol-chloroform and ethanol precipitation. T4 DNA Ligase (Invitrogen, Buenos Aires, Argentina) was used to circularise DNA fragments in 400 µL overnight at 15 °C. Next, ligated DNA was treated with equal volumes of a mixture of chloroform and phenol. After removing the aqueous phase, the ethanol precipitated DNA was collected in 30 µL of distilled water. Polymerase Chain Reaction (PCR) was performed in reactions. 0.5 U of Taq DNA polymerase (Promega, Buenos Aires, Argentina) in the presence of 0.6µM of each primer for a total volume of 25 µL. The primer sequences are listed in Table 1. The thermal cycling process includes initial denaturation for 2 minutes at 94°C. Then approximately 30 cycles of denaturation at 94.0 °C (30 sec) with annealing of the primers (60 sec) at 56.0 °C and extension of 90 sec at 72 °C; finally followed by 5 minutes at 72 °C were part of the process. After PCR, the products were run on 2% agarose gel for 30 mins, and under UV light, an image was prepared [11].

Table 1. Primer sequence for intron 22 inversion.

Primer Sequence 5′ to 3′ NC_000023.9 BclI site
ID ACATACGGTTTAGTCACAAGT 153758587-608 27
ED TCCAGTCACTTAGGCTCAG 154257328-47 154349067-86 99 99
IU CCTTTCAACTCCATCTCCAT 153779730-50 460
2U ACGTGTCTTTTGGAGAAGTC 154270775-95 358
3U CTCACATTGTGTTCTTGTAGTC 154333426-48 306

Data analysis was carried out on IBM SPSS Statistics Version 23.00 (IBM Corp, Armonk, NY). Descriptive statistics were applied to measure the frequencies, percentages, and mean ± SD of the clinical and general history of HA patients, including age, family history, inhibitor status, Inv22, and FVIII levels. Chi-square was applied to evaluate the association between Inv22 and FVIII inhibitor formation.

Results

A total of 62 HA patients were observed in the study with mean±SD age of (14.39±13.2) years; moreover, age was further categorized into subgroups, i.e., group-I (1-10), group-II (11-20), group-III, (21-30), and group-IV (≥31) years. Most patients belong to group-I (1-10) years of age with 53.2% as compared to the other groups. Positive family history of hemophilia was observed in 36 (58.1%) patients. Out of 62 patients, 28 (45.2%) were reported as Inv22 positive while inhibitor status was observed in three (4.83%) patients whereas 59 (95.2%) patients were without inhibitor as presented in Table 2.

Table 2. Demographic Characteristics of Hemophilia A patients .

Variables Frequency (%)
Age Groups (Yrs)
1-10 33 (53.2)
11-20 12 (19.4)
21-30 12 (19.4)
≥31 5 (8.1)
Family History
Present 36 (58.1)
Absent 26 (41.9)
FVIII Inhibitor
Present 3 (4.8)
Absent 59(95.2)
Intron 22 Inversion
Present 28 (45.2)
Absent 34 (54.8)

Table 3 shows the association of FVIII inhibitor with Inv22. 7.1% of patients with Inv22 had FVIII inhibitors, while 92.9% of Inv22 positive HA patients did not have FVIII inhibitors. Insignificant association, i.e. (p-value=0.443), was observed between FVIII inhibitor and Inv22s as displayed in Table 3.

Table 3. Association of FVIII inhibitor with Intron 22 inversions.

Note: p-value >0.05 indicates insignificant association

 Intron 22 Inversion FVIII Inhibitor  
Present Absent p-value
Present 2 (7.1) 26 (92.9) 0.443
Absent 1 (2.9) 33 (97.1)

Figure 1 shows inverse shifting PCR (IS-PCR) analyses for FVIII intron 22 related inversions using 1% agarose gels. Genetic counseling and genetic studies are advised. Inversion of FVIII intron 22 is responsible for 45%-50% of severe HA. This test also represents the method of choice at the first line in severe HA patients.

Figure 1. Inversion of FVIII-intron 22 identified in FVIII gene of patients.

Figure 1

1 - Int.22 inversion type 1 (Inv22-1)    333bp

2 - Positive control Int.22 inversion type 1 Homozygous (Inv22-1)    333bp

3 - Positive control Int.22 inversion type 2 Homozygous (Inv22-1)    385bp

4 - Positive control Int.22 inversion type 1 heterozygous (Inv22-1)    487; 333bp

5 - Positive control Int.22 inversion type 2 heterozygous (Inv22-1)    487; 385bp

6 - Wild type (Negative control) 487bp

7-12 - Inversion 1 (Negative) 304bp

Discussion

Hemophilia is an X-linked inherited bleeding illness having a very high treatment cost, and developing-country governments do not place a high priority on technology-intensive therapy. A recent Pakistani study on Congenital Hemorrhagic Disorders Group by Sajid et al. [12] and other local studies have shown that HA is the most common bleeding disorder in the Pakistani population. Factor replacement therapy for the treatment of patients with hemophilia and other bleeding disorders is mainly based on fresh frozen plasma and its components. Our findings revealed that 58.1% of patients had a positive family history. These findings highlight the value of early screening of newborns whose families are at high risk of the disease. 40%-50% of individuals worldwide have the disease due to Inv22 mutation. According to Abu Arra et al., this is the first line of testing in present individuals [2]. The positive proportion of Inv22 in our study was 45.2%. This positive frequency is similar to previous studies from Egypt (46.1%), Iran (47%), and Iraq (36.3%) but lower than Jordan (52%) and Saudi Arabia (50%). It is higher than Albania (10.5%), Tunis (22.7%), Lebanon (29%), and the United Kingdom (17.6%) [13-18]. We detected inhibitors in 7.1% of Inv22 positive patients during our research.

According to statistics from the previously published study [19,20], the inhibitors' prevalence in people with inversions of intron 22 was different. Goodeve et al. and Astremark et al. [21,22] identified the changes in the FVIII gene, especially Inv22, as a significant component that increases the development of inhibitors in patients suffering from a severe form of the disease. According to the current study, inversion of intron 22 is our population's most common change in severe HA. Inv22 is the essential genetic component for inhibitors' development. However, our study did not show the association between Inv22 and inhibitors' development. 

In India, Ghosh et al. [23] found an inhibitor frequency of 8.2% in individuals with severe HA; however, 24% of Inv22 positive patients developed an inhibitor. Ghosh et al. proposed that treating patients regularly causes the inhibitors to withdraw from blood circulation during treatment sessions, which lowers the prevalence frequency, especially temporary inhibitors. Borhany et al. [24] did a study in Pakistan and found that 15% of hemophilia A patients had inhibitors. There is also a natural history or development of a temporary low-level inhibitor for hemophilia treated with factor VIII.

There are limited data on this topic in the Pakistani population, and the small sample size is a limitation of this study. The current study is a single-center study; therefore, multi-center longitudinal studies should be conducted in the future.

Conclusions

Inv22s are a major cause of severe HA in Pakistani individuals. Inv22s were found in 45.2% of severe hemophilia A patients in our study. Despite being linked to severe HA phenotypic instances, the Inv22 mutation was not a significant risk factor for inhibitor production. Additional research involving more patients is advised, along with testing for additional mutations.

The content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.

The authors have declared that no competing interests exist.

Human Ethics

Consent was obtained or waived by all participants in this study. TheInstitutional Review Board/Ethics Committee, Hematology, NIBD issued approval NIBD/RD-198/09-2019

Animal Ethics

Animal subjects: All authors have confirmed that this study did not involve animal subjects or tissue.

References

  • 1.Factor VIII inhibitor development in Egyptian hemophilia patients: does intron 22 inversion mutation play a role? Sherief LM, Gaber OA, Youssef HM, et al. Ital J Pediatr. 2020;46:129. doi: 10.1186/s13052-020-00878-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Factor VIII intron 22 inversion in severe hemophilia A patients in Palestine. Mahmoud Abu Arra C, Samarah F, Sudqi Abu Hasan N. Scientifica (Cairo) 2020;2020:3428648. doi: 10.1155/2020/3428648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.F8 inversions of introns 22 and 1 confer a moderate risk of inhibitors in Mexican patients with severe hemophilia A. Concordance analysis and literature review. Luna-Záizar H, González-Alcázar JÁ, Evangelista-Castro N, Aguilar-López LB, Ruiz-Quezada SL, Beltrán-Miranda CP, Jaloma-Cruz AR. Blood Cells Mol Dis. 2018;71:45–52. doi: 10.1016/j.bcmd.2018.02.003. [DOI] [PubMed] [Google Scholar]
  • 4.Prevalence of FVIII inhibitors in severe haemophilia A patients: effect of treatment and genetic factors in an Indian population. David S, Nair SC, Singh GS, et al. Haemophilia. 2019;25:67–74. doi: 10.1111/hae.13633. [DOI] [PubMed] [Google Scholar]
  • 5.Molecular genetic diagnosis by next-generation sequencing in a cohort of Mexican patients with haemophilia and report of novel variants. Villarreal-Martínez L, Ibarra-Ramirez M, Calvo-Anguiano G, et al. Blood Cells Mol Dis. 2020;83:102423. doi: 10.1016/j.bcmd.2020.102423. [DOI] [PubMed] [Google Scholar]
  • 6.Intron 1 Inversion among Hemophilia a Patients in Basrah at the South of Iraq. Hadi MA, Nazar W, Hassan M. https://www.annalsofrscb.ro/index.php/journal/article/view/7327 Annals Romanian Soc for Cell Biol. 2021;25:9937–9943. [Google Scholar]
  • 7.Novel severe hemophilia a mouse model with factor VIII intron 22 inversions. Han JP, Song DW, Lee JH, Lee GS, Yeom SC. Biology (Basel) 2021;10:704. doi: 10.3390/biology10080704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.A simple salting out procedure for extracting DNA from human nucleated cells. Miller SA, Dykes DD, Polesky HF. Nucleic Acids Res. 1988;16:1215. doi: 10.1093/nar/16.3.1215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Single-tube polymerase chain reaction for rapid diagnosis of the inversion hot spot of mutation in hemophilia A. Liu Q, Nozari G, Sommer SS. Blood. 1998;92:1458–1459. [PubMed] [Google Scholar]
  • 10.Unleashing the long-distance PCR for detection of the intron 22 inversion of the factor VIII gene in severe haemophilia A. Bowen DJ, Keeney S. ThrombHaemost. 2003;89:201–202. [PubMed] [Google Scholar]
  • 11.Developing a new generation of tests for genotyping hemophilia-causative rearrangements involving int22h and int1h hotspots in the factor VIII gene. Rossetti LC, Radic CP, Larripa IB, De Brasi CD. J Thromb Haemost. 2008;6:830–836. doi: 10.1111/j.1538-7836.2008.02926.x. [DOI] [PubMed] [Google Scholar]
  • 12.Clinical audit of inherited bleeding disorders in a developing country. Sajid R, Khalid S, Mazari N, Azhar WB, Khurshid M. Indian J Pathol Microbiol. 2010;53:50–53. doi: 10.4103/0377-4929.59183. [DOI] [PubMed] [Google Scholar]
  • 13.First report of molecular diagnosis of Tunisian hemophiliacs A: identification of 8 novel causative mutations. Elmahmoudi H, Khodjet-el-khil H, Wigren E, et al. Diagn Pathol. 2012;7:93. doi: 10.1186/1746-1596-7-93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Identification of the intron 22 and intron 1 inversions of the factor VIII gene in Iraqi Kurdish patients with hemophilia A. Abdulqader AMR, Mohammed AI, Rachid S, et al. Clin Appl Thrombosis/Hemostasis. 2020;26:1–7. doi: 10.1177/1076029619888293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Spectrum of factor VIII mutations in Arab patients with severe haemophilia A. Abu-Amero KK, Hellani A, Al-Mahed M, Al-Sheikh I. Haemophilia. 2008;14:484–488. doi: 10.1111/j.1365-2516.2008.01690.x. [DOI] [PubMed] [Google Scholar]
  • 16.Evaluation of intron 22 and intron 1 inversions of the factor 8 gene using an inverse shifting PCR method in severe haemophilia A patients. Roozafzay N, Kokabee L, Zeinali S, et al. ScienceAsia. 2013;39:174–178. [Google Scholar]
  • 17.Mutation analysis in 51 patients with haemophilia A: report of 10 novel mutations and correlations between genotype and clinical phenotype. Hill M, Deam S, Gordon B, Dolan G. Haemophilia. 2005;11:133–141. doi: 10.1111/j.1365-2516.2005.01069.x. [DOI] [PubMed] [Google Scholar]
  • 18.HLA genotype of patients with severe haemophilia A due to intron 22 inversion with and without inhibitors of factor VIII. Oldenburg J, Picard JK, Schwaab R, et al. Thrombosis Haemostasis. 1997;77:238–242. [PubMed] [Google Scholar]
  • 19.Inhibitor development in correlation to factor VIII genotypes. Oldenburg J, El-Maarri O, Schwaab R. Haemophilia. 2002;8 Suppl 2:23–29. doi: 10.1046/j.1351-8216.2001.00134.x. [DOI] [PubMed] [Google Scholar]
  • 20.Haemophilia A: mutation type determines the risk of inhibitor formation. Schwaab R, Brackmann HH, Meyer C, et al. Thrombosis Haemostasis. 1995;74:1402–1406. [PubMed] [Google Scholar]
  • 21.The Malmö International brother study (MIBs). Genetic defects and inhibitor development in siblings with severe hemophilia A. Astermark J, Oldenburg J, Escobar M, White GC 2nd, Berntorp E. https://pubmed.ncbi.nlm.nih.gov/15996930/ Haematologica. 2005;90:924–931. [PubMed] [Google Scholar]
  • 22.The molecular basis of hemophilia A: genotype-phenotype relationships and inhibitor development. Goodeve AC, Peake IR. Semin Thromb Hemost. 2003;29:23–30. doi: 10.1055/s-2003-37936. [DOI] [PubMed] [Google Scholar]
  • 23.Development of inhibitors in patients with haemophilia from India. Ghosh K, Shetty S, Kulkarni B, et al. Haemophilia. 2001;7:273–278. doi: 10.1046/j.1365-2516.2001.00505.x. [DOI] [PubMed] [Google Scholar]
  • 24.Frequency of factor VIII (FVIII) inhibitor in haemophilia A. Borhany M, Kumari M, Shamsi T, et al. https://jcpsp.pk/archive/2012/May2012/05.pdf. J Coll Physicians Surg Pak. 2012;22:289–293. [PubMed] [Google Scholar]

Articles from Cureus are provided here courtesy of Cureus Inc.

RESOURCES