Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2022 Sep 22;17(9):e0274841. doi: 10.1371/journal.pone.0274841

Interleukin-17, a salivary biomarker for COVID-19 severity

Fatemeh Saheb Sharif-Askari 1, Narjes Saheb Sharif-Askari 1, Shirin Hafezi 1, Bushra Mdkhana 1, Hawra Ali Hussain Alsayed 2, Abdul Wahid Ansari 3, Bassam Mahboub 4, Adel M Zakeri 5, Mohamad-Hani Temsah 6, Walid Zahir 7,8, Qutayba Hamid 1,9,10, Rabih Halwani 1,9,11,*
Editor: Esaki M Shankar12
PMCID: PMC9498944  PMID: 36136963

Abstract

Objectives

T-helper 17 cell-mediated response and their effector IL-17 cytokine induced by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection is a major cause of COVID-19 disease severity and death. Therefore, the study aimed to determine if IL-17 level in saliva mirrors its circulatory level and hence can be used as a non-invasive biomarker for disease severity.

Methods

Interleukin-17 (IL-17) level was evaluated by ELISA in saliva and blood of 201 adult COVID-19 patients with different levels of severity. The IL-17 saliva level was also associated with COVID-19 disease severity, and need for mechanical ventilation and/or death within 29 days after admission of severe COVID-19 patients.

Results

We found that IL-17 level in saliva of COVID-19 patients reflected its circulatory level. High IL-17 level in saliva was associated with COVID-19 severity (P<0.001), need for mechanical ventilation (P = 0.002), and/or death by 29 days (P = 0.002), after adjusting for patients’ demographics, comorbidity, and COVID-19 serum severity markers such as D-Dimer, C-reactive protein, and ferritin.

Conclusion

We propose that saliva IL-17 level could be used as a biomarker to identify patients at risk of developing severe COVID-19.

Introduction

The number of cases and deaths due to coronavirus disease 2019 (COVID-19) are still continuing to increase [1]. COVID-19 pneumonia can progress to acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) secondary to overwhelming inflammatory responses [2–4]. The current management of COVID-19 is supportive, and therefore, it is suggested that all patients with severe COVID-19 should be screened for hyper-inflammation or “cytokine storm” in order to identify those who would benefit from targeted immunosuppression or immunomodulation to prevent ALI/ARDS [5]. Currently, there is no specific marker to distinguish, at an early stage COVID-19, patients who are prone to progression of COVID-19 disease from others.

Among the many cytokines involved in the cytokine storm, interleukin-17 (IL-17) is a notable and predominant mediator of pulmonary inflammation [6]. Dysregulation of T helper 17 (Th-17) cells and enhanced expression of IL-17 in the lungs promote the production of downstream pro-inflammatory molecules such as interleukin-1beta (IL-1β), TNF alpha (TNFα), interleukin-6 (IL-6), neutrophil chemoattractants such as interleukin-8 (IL-8), and monocyte chemoattractant protein-1 (MCP-1/CCL2). Recruited neutrophils then induce reactive oxygen species, leading to ALI and protein-rich inflammatory lung infiltration, the hallmark features of ARDS [6, 7]. Consistently, increased IL-17 level in mice with lipopolysaccharides (LPS)-induce acute lung injury was associated with greater infiltration of inflammatory cells to the lung and decreased overall survival [8]. Furthermore, addition of exogenous IL-17 further exacerbated LPS-induced production of TNFα, IL-1β, and IL-6, revealing the pathogenic role of IL-17 as a key upstream modulator of the inflammatory pathway. In the same study, mice genetically deficient in IL-17 or those that received anti-IL-17 antibodies had a better survival, less lung infiltration and better lung pathology scores following LPS challenge [8]. IL-17 was also shown to synergy TNFα and IL-1β via the mitogen-activated protein kinase (MAPK) pathways [9], which is known to be activated by different groups of viruses [10] and by SARS-CoV-2 [11].

Following SARS-CoV-2 infection, the severity of disease was shown to positively correlate with plasma levels of IL-1β, IL-6, TNFα, interferon gamma (IFNγ), and IL-17A proinflammatory cytokines [2, 11–15]. Several reports have also associated the increased IL-17A levels and Th17 response in upper and lower respiratory tracts of COVID-19 patients with COVID-19 severity. In addition, we and others have shown that the level of several plasma biomarkers can be successfully reflected in saliva [16, 17]. Therefore, we hypothesized that salivary IL-17A level may mirror its plasma level and hence can be used as a non-invasive biomarker for disease severity. We evaluated IL-17A, TNFα, IL-1β protein levels in saliva of COVID-19 patients with different severities, and found that among these cytokines, IL-17A was associated with COVID-19 severity and poor patient survival outcomes.

Materials and methods

Ethics statement

Ethical approval was obtained from the Dubai Scientific Research Ethics Committee (DSREC-08/2021_14). Written, informed consents were obtained from all study participants prior to inclusion.

COVID-19 patients’ cohort

The cohort consisted of 201 adult patients with PCR-confirmed SARS-CoV-2 infection who were referred to Rashid Hospital in Dubai between May 28 and June 30, 2020. Out of 201 COVID-19 patients, 67 patients were asymptomatic, 81 patients had mild to moderate symptoms, and 53 patients had severe disease. Samples were collected on diagnosis of COVID-19 from non-hospitalized asymptomatic or those with mild symptoms, and at admission to hospital from hospitalized patients. Clinical and laboratory data were all collected from these patients at the time of samples collection (Table 1). The COVID-19 severity status was defined as COVID-19 pneumonia requiring high-flow oxygen therapy [18]. Patients with severe COVID-19 were followed up for 29 days after the date of hospital admission. In the samples collected from 201 patients, ELISA (enzyme-linked immunosorbent assay) were used to measure level of IL-17A and two other inflammatory cytokines known to contribute to COVID-19 related pathogenic inflammation—TNFα and IL-1β—and assessed their level with severity and patient survival [19, 20]. IL-17A will be referred to as IL-17 in the rest of this study. As references, and to serve as controls, the level of these cytokines were measured in saliva of 50 healthy controls. The precautions recommended by CDC for safe collecting, handling and testing of biological fluids were strictly followed [21].

Table 1. Clinical parameters of COVID-19 patients in according to disease severity.

COVID-19 Patients
Variables Healthy controls (n = 50) Asymptomatic (n = 67) Mild/moderate (n = 81) Severe (n = 53) P-value
Age (years, median, range) 29 (24–32) 33 (28–36) 48 (40–56) 57 (48–65) <0.001
Male sex 31 47 66 44 0.030
BMI (median, range) 24 (22–26) 25 (22–28) 27 (24–31) 28 (26–31) 0.019
Salivary flow rate 0.44 ± 0.10 0.42 ± 0.18 0.39 ± 0.21 0.37 ± 0.19 0.318
Comorbidity
DM (n,%) - 2 (3) 39 (48) 27 (54) <0.001
Serum severity markers
D-dimer (0–0.5 μ/mL) - 0.27 (0.18–1.29) 0.71 (0.38–1.65) 1.35 (1.04–6.74) <0.001
CRP (1.0–3.0 mg/L) - 1.25 (0.40–7.9) 18.8 (3–98.3) 81.3 (23.2–141.6) 0.003
Ferritin (10–204 ng/mL) - 45.2 (37–75) 535 (234–1197) 886 (465.8–1612.4) 0.002
Cytokines values *
Plasma IL-17, pg.mL-1 20.8 (19–22) 28 (25–30) 28.8 (26–31) 63.4 (51–75) <0.001
Saliva IL-17, pg.mL-1 50 (48–51) 71.9 (66–77) 78.8 (73–84) 138.8 (128–149) <0.001
Saliva TNFα, pg.mL-1 170.3 (158–182) 463.9 (402–525) 506.9 (454–558) 568 (507–628) <0.001
Saliva IL-1β, pg.mL-1 30 (26–34) 44.8 (39–50) 61.4 (55–68) 71.6 (64–79) <0.001
Open in a new tab

Abbreviation: BMI, body mass index; CRP, C-reactive protein. Detection limits for ELISA assay of IL-17 is 15.6 pg.mL-1, TNFα is 15.63 pg.mL-1, and IL-1β is 3.91 pg.mL-1.

*Unadjusted P-values.

Collection of saliva

As previously reported [22], we followed the unstimulated whole saliva collection method. Before saliva collection we asked participants to sit upright with their head slightly titled downward allowing saliva to collect on the floor of the mouth. The first sample was discarded to eliminate the unwanted debris. The subsequent saliva sample (around 2 mL) was then dribbled into a pre-labeled polypropylene sterile tube. For each participant, salivary flow rate was calculated by dividing the total saliva volume (mL) by the time of collection (min) [23]. The volume of saliva was determined by weighing, considering a density of 1 g/mL for saliva. All samples were then stored at –20°C until immediately before use.

ELISA assays of IL-17, IL-1β, and TNFα cytokines

IL-17, IL-1β and TNFα cytokine concentrations were determined in saliva and/or plasma samples using commercially available human ELISA kits (Human IL-17, DY317-05, R&D; Human IL-1β, DY201-05, R&D; and human TNFα ELISA KIT, ab181421, Abcam). For the assays, saliva samples were centrifuged at 700g for 15 minutes at 4°C, and the supernatant was used. Diluent optimization was performed for the saliva samples. We performed assays following the manufacturers’ instructions. All samples were measured in duplicates.

Gene expression data sets

The gene expression data sets of COVID-19 nasopharyngeal swabs (GSE152075) [24], including 430 patients with SARS-CoV-2 infection and 54 uninfected individuals, and COVID-19 lung autopsies (GSE150316) [25], including 52 COVID-19 fatal cases and 5 SARS-CoV-2-uninfected individuals, were all publicly available at the National Center for Biotechnology Information Gene Expression Omnibus (NCBI GEO, http://www.ncbi.nlm.nih.gov/geo) or the European Bioinformatics Institute (EMBL-EBI, https://www.ebi.ac.uk).

Analysis procedures

Association of IL-17, IL-1β, or TNFα saliva concentrations and COVID-19 severity were evaluated using regression models adjusted for patients’ demographic factors including age, male gender, and body mass index (BMI); comorbidities such as diabetes mellitus (DM); and serum markers of COVID-19 severity such as D-dimer, C-reactive protein (CRP), and ferritin. Association of IL-17, IL-1β, or TNFα saliva concentrations of severe COVID-19 patients and the need for mechanical ventilation and/or death within 29 days from admission was evaluated using Cox proportional hazards regression models adjusted for all the above-mentioned patient demographics, comorbidities, and markers of COVID-19 severity. Kaplan–Meier survival curves were then constructed to show cumulative survival over the 29 days period. All selected variables in the models were tested for the presence of collinearity by evaluating variance inflation factors and magnitude of standard errors. Furthermore, the discriminatory power of models was assessed using the area under the curve (AUC). Discrimination refers to the ability of a model to clearly distinguish between 2 groups of outcomes (discriminate between severe and non-severe patients with COVID-19) and can range from 0.5 (no discrimination) to 1.0 (perfect discrimination) [26].

Moreover, for the bioinformatic analysis, the data was pre-processed using the Bioconductor package limma-voom [27]. The fold change of differential expressed genes were carried out using Limma Bioconductor package [28, 29].

For evaluating IL-17 mRNA levels in whole blood of COVID-19 patients we have used the following primers: human IL-17A, forward, 5’-3’: CGGACTGTGATGGTCAACCTGA, and reverse, 5’-3’: GCACTTTGCCTCCCAGATCACA; human 18s, forward, 5’-3’: TGACTCAACACGGGAAACC, and reverse, 5’-3’: TCGCTCCACCAACTAAGAAC. Gene expression was analyzed using the Comparative Ct (ΔΔCt) method after normalization to the housekeeping gene 18 s rRNA. Analysis was performed using R software (v 3.0.2), SPSS Version 26 (IBM Corporation, Chicago, USA), and Graphpad Prism 8 (GraphPad Software Inc., San Diego, USA). All tests were two-tailed and a P value of less than 0.05 was considered statistically significant. A file consisting of all patient’s parameters used in the analysis is provided in S1 File.

Results

Cohort characteristics

Out of 201 patients with PCR confirmed SARS-CoV-2 infection, 53 patients were those with severe acute COVID-19 pneumonia and elevated serum markers of COVID-19 severity such as D-Dimer, CRP, and ferritin. Severe patients were predominantly male (n = 44; 83%) and were on average 15 years older than patients with milder COVID-19 (57 years in severe COVID-19 vs. 48 years in mild/moderate COVID-19; P<0.001). Around half of the severe patients (n = 27; 54%) had diabetic mellitus comorbidity. Patient characteristics are listed in Table 1.

Saliva IL-17 level predicts COVID-19 severity

To assess the possibility of using IL-17 saliva level as a biomarker for COVID-19 severity. First, we measured the circulating IL-17 levels in peripheral blood of recruited COVID-19 patients with different severities. As expected, we found that IL-17 mRNA level in whole blood (Fig 1A, close to 1.5 log fold-change (FC) increase of IL-17 mRNA; P<0.001), and protein level in plasma were significantly elevated in severe COVID-19 cases compared to mild/moderate or asymptomatic COVID-19 cases (Fig 1B, mean 63.4 pg.ml-1 in severe vs 28.8 pg.ml-1 in mild/moderate COVID-19 cases; P<0.001). Next, we evaluated IL-17 level in saliva samples of these patients and found that, similar to the circulatory IL-17 level, its level was significantly elevated in saliva of severe COVID-19 cases (Fig 1C, mean 138.8 pg.ml-1 in severe vs 78.8 pg.ml-1 in mild/moderate COVID-19 cases; unadjusted P<0.001). Notably, when adjusting for age, male gender, BMI, DM, and serum markers of COVID-19 severity such as CRP, D-dimer, and ferritin, IL-17 saliva level remained significantly associated with disease severity (Fig 1C and 1D, adjusted P<0.001; and AUC of 0.94 [95% CI, 0.90–0.98]). There were also positive correlations with saliva IL-17 level and serum D-dimer, CRP, and ferritin levels of COVID-19 patients (Fig 1E–1G, P<0.001).

Fig 1. Higher IL-17 level in saliva of severe COVID-19 patients.

Fig 1

Open in a new tab

(A) IL-17 mRNA levels in whole blood of COVID-19 patients with different severities. (B) IL-17 protein levels in plasma of COVID-19 patients with different severities. (C and D) IL-17 protein levels in saliva of COVID-19 patients with different severities and the associated ROC (receiver operating characteristic curve). (E-G) Correlation of IL-17 saliva level with serum levels of D-dimer, CRP (C-reactive protein), and ferritin of these patients. (H-K) TNFα and IL-1β protein levels in saliva of COVID-19 patients with different severities, and the associated ROCs. Specimens were collected from the following patients with COVID-19 (asymptomatic (n = 67), mild/moderate (n = 81), and severe (n = 53), as well as healthy controls (n = 50). Statistical test: Regression models were adjusted for demographics (age, gender, body mass index), comorbidity (diabetes mellitus) and severity markers of COVID-19 (CRP, D-dimer, and ferritin). ns: Non-significant, * P<0.05, *** P<0.001.

Furthermore, clinical reports have associated COVID-19 severity with elevated blood cytokine levels of TNFα and IL-1β [19, 20]. Therefore, we have then evaluated the levels of TNFα and IL-1β in saliva of COVID-19 patients. Of note, salivary levels of TNFα and IL-1β were elevated in severe COVID-19 cases compared to asymptomatic or mild/moderate cases (unadjusted P<0.001); however, after adjusting for age, male gender, BMI, DM, and serum markers of COVID-19 severity such as CRP, D-dimer, and ferritin, TNFα and IL-1β saliva levels were no longer associated with disease severity. (Fig 1H and 1I for TNFα, adjusted P = 0.212; and AUC of 0.79 [95% CI, 0.70–0.88], and Fig 1J and 1K for IL-1β, adjusted P = 0.382; and AUC of 0.77 [95% CI, 0.68–0.86]).

Higher salivary IL-17 level associated with higher needs for mechanical ventilation and lower survival

Next, we have assessed the association between IL-17, TNFα and IL-1β levels in saliva of severe COVID-19 cases with the survival outcomes of these patients. Stratifying patients by cytokine levels of high versus low using the cutoffs identified in the severe COVID-19 cases, we found that IL-17, but not TNFα or IL-1β cytokine could predict the need for mechanical ventilation and/or overall survival of patients, based on the first available measurement level after hospital admission (Fig 2A–2F). IL-17 (≥138 pg.ml-1) was predictive of the need for mechanical ventilation and/or death by days 29 of admission, after adjusting for age, male gender, BMI, DM, and serum markers of COVID-19 severity such as CRP, D-dimer, and ferritin. (Fig 2A, adjusted hazard ratio (aHR) for mechanical ventilation, 6.13; 95% CI, 1.9 to 19.1; P = 0.002, and Fig 2D, aHR for death, 11.2; 95% CI, 2.3 to 53.6; P = 0.002).

Fig 2. Increased IL-17 level in saliva of severe COVID-19 patients associated with higher need for mechanical ventilation and/or death by days 29.

Fig 2

Open in a new tab

Kaplan–Meier survival curves of the need for mechanical ventilation (A-C) and/or death (D-F), based on the IL-17, TNFα, and IL-1β cytokine levels in saliva of patients with severe COVID-19 (n = 53). Statistical test: Cox proportional models adjusted for patient’s demographics factors (age, gender, and body mass index), comorbidities (diabetes mellitus), and COVID-19 related severity serum markers (D-dimer, CRP, and ferritin), with significance indicated by P value of less than 0.05.

Discussion

In the current study, we found that IL-17 level in saliva of COVID-19 patients reflected its circulatory level. Among TNFα or IL-1β saliva levels, higher IL-17 level in saliva of COVID-19 patients was associated with disease severity and worse clinical outcomes, defined as need for mechanical ventilation and/or death within 29 days of admission. This could suggest the potential use of IL-17 as a non-invasive salivary biomarker for COVID-19 severity.

Previously, saliva has been highlighted as a potential non-invasive biological sample for the detection of SARS-CoV-2 [30]. Saliva fluid is a good reservoir for different respiratory viruses. SARS-CoV-2 infects host cells through angiotensin-converting enzyme 2 (ACE2) receptor that is abundantly expressed in salivary gland and oral epithelial cells [31, 32]. In addition to release of viral particles from the infected salivary glands in the oral cavity, viral particles can also be transmitted to saliva from upper and lower respiratory tract [33]. Beside viral particles, important prognostic inflammatory markers including CRP and TNFα were also detected within saliva fluid [34]. Salivary glands are surrounded by rich vessels circulation which facilitate exchange of contents between blood and salivary fluid [35]. Saliva is hypotonic to plasma, and proteins from blood have been shown to enter saliva intracellularly through passive diffusion or active transport, and paracellularly through ultrafiltration at tight junctions between salivary gland cells [36]. Therefore, the elevated level of IL-17 observed in saliva of severe COVID-19 cases could be directly induced by active SARS-CoV-2 infection within the oral cavity and salivary gland, besides the possibly defused protein from blood circulation.

Notably, we found that IL-17 saliva level is a potential biomarker of COVID-19 severity and worse survival outcomes even after adjusting for other risk factors such as patient demographic factors and COVID-19 severity markers. We also measured saliva levels of TNFα and IL-1β, as known markers of inflammation and organ damage, and commonly reported to be elevated in blood of patients with COVID-19 [19, 20, 37]. However, when including additional patients and COVID-19 severity markers, these cytokines were no longer associated with COVID-19 severity and worse clinical outcomes.

Since respiratory tract is the place of SRAS-CoV-2 entry and injury in COVID-19, we evaluated the expression level of IL-17 in gene expression data sets in nasopharyngeal swabs (GSE152075), and lung autopsies from large cohort of patients with COVID-19 (GSE150316). As expected, level of IL-17 was significantly elevated in both nasal swabs as well as lung autopsies of COVID-19 patients compared to those of healthy controls (S1 Fig). IL-17 level during lung inflammation recruit neutrophils, monocytes, and induces production of other proinflammatory cytokines. Higher IL-17 levels in nasopharyngeal swabs and lung autopsies of COVID-19 patients were associated with higher levels of proinflammatory cytokines, including IL-1β, TNFα, IL-6, IL-8, and IL-23 (S2 and S3 Figs). In vitro, Th17 cells has the ability to induce the expression of proinflammatory cytokines, including IL-1β, IL-6, IL-8, and TNFα in cell types that are responsive to IL-17, including epithelial cells, fibroblasts, and macrophages [38]. Furthermore, the induction of IL-6, IL-23, IL-1β and TNFα by IL-17 constitutes a positive feedback loop that enhances their production by Th17 cells production and strengthens the effects of IL-17 which may form the basis of a self-sustaining process for IL-17 secretion during infection [39]. In addition, IL-17 signaling can converge with other signaling pathways such as mitogen‑activated protein kinase (MAPK), and it can also result in the sequestration of inhibitors of other pathways such as nuclear factor kappa B (NF-κB), and induce their activity [40, 41]. In SARS-CoV-2 infected lung, presence of IL-1β, TNFα, IL-6, and IL-8 indicate IL-17 induced MAPK and NF-κB mediate signaling [11]; MAPK was shown to be activated during the acute phase of SARS-CoV-2 infection in nasopharyngeal swabs of severe COVID-19 patients [42]. Thus, neutralizing IL-17 or its signaling in COVID-19, might constitute an effective strategy in controlling exaggerated uncontrolled lung inflammation following SARS-CoV-2 infection.

In summary, our data suggest a role for IL-17 as a reliable non-invasive salivary biomarker of COVID-19 severity. However, further validation in larger COVID-19 cohorts is needed. Moreover, since our data was drawn from unvaccinated cohort infected with ancestral variants of SARS-CoV-2, further research would be necessary to evaluate level of IL-17 in saliva of vaccinated patients infected with the newly emerged Omicron variants of SARS-CoV-2.

Supporting information

S1 Fig. Increased IL-17 gene expression levels in lung and nasopharyngeal swabs of COVID-19 patients.

(A) IL-17 mRNA levels in nasopharyngeal swabs of COVID-19 patients compared to healthy controls (n = 430 COVID-19 patients vs n = 54 healthy controls; GSE152075). (B) IL-17 mRNA levels in lung autopsies of COVID-19 patients compared to healthy controls (n = 17 SARS-CoV-2 infected lung vs. n = 5 healthy lung biopsies; GSE150316). Statistical test: Unpaired t-test or Mann-Whitney U test, depending on the skewness of the data, * P<0.05.

(PDF)

Click here for additional data file. (563.4KB, pdf)
S2 Fig. Correlation between IL-17 expression level and Th-17 signaling related cytokines/chemokines such as TNFα, IL-1β, IFNγ, IL-6, neutrophils chemoattractant IL-8, and monocytes chemoattractant, CCL2 in nasopharyngeal swabs of COVID-19 patients (n = 430 COVID-19 patients; GSE152075).

Data show that IL-17 in these COVID-19’s nasopharyngeal swabs positively correlate with levels of IL-1β, TNFα, IL-6, IL-8 and CCL2, but not IFNγ. Statistical test: Pearson’s coefficient test with two-tailed p-value <0.05 considered significant.

(PDF)

Click here for additional data file. (716KB, pdf)
S3 Fig. Correlation between IL-17 expression level and Th-17 signaling related cytokines/chemokines such as TNFα, IL-1β, IFNγ, IL-6, IL-8, and CCL2 in lung autopsies of COVID-19 patients (n = 17 SARS-CoV-2 infected lung tissues; GSE150316).

Data show that IL-17 level in COVID-19’ lung autopsies positively correlate with levels of TNFα, IL-1β, IFNγ, IL-6, IL-8 and CCL2, but not CCL2. Statistical test: Pearson’s coefficient test with two-tailed p-value <0.05 considered significant.

(PDF)

Click here for additional data file. (235.1KB, pdf)
S1 File. Study raw data.

(SAV)

Click here for additional data file. (18.7KB, sav)

Data Availability

If the data are all contained within the manuscript and/or Supporting information files, enter the following: All relevant data are within the manuscript and its Supporting information files.

Funding Statement

This research has been financially supported by Tissue Injury and Repair (TIR) group operational grant (Grant code: 150317); COVID-19 research grant (CoV19-0307); Seed grant (Grant code: 2001090275); and by collaborative research grant (Grant code: 2001090278) to RH, University of Sharjah, UAE; and by a Sandooq Al Watan Applied Research & Development grant to RH (SWARD-S20-007); and by Prince Abdullah Ben Khalid Celiac Disease Research Chair, under the Vice Deanship of Research Chairs, King Saud University, Riyadh, Kingdom of Saudi Arabia. Moreover, the funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.World Health Organization Coronavirus (COVID-19). https://covid19.who.int, accessed 10/8/2021.
  • 2.Salto-Tellez M, Tan E, Lim B. ARDS in SARS: cytokine mediators and treatment implications. Cytokine. 2005;29(2):92–4. doi: 10.1016/j.cyto.2004.09.002 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ksiazek TG, Erdman D, Goldsmith CS, Zaki SR, Peret T, Emery S, et al. A Novel Coronavirus Associated with Severe Acute Respiratory Syndrome. N Engl J Med. 2003;348(20):1953–66. doi: 10.1056/NEJMoa030781 [DOI] [PubMed] [Google Scholar]
  • 4.Yang X, Yu Y, Xu J, Shu H, Xia Ja, Liu H, et al. Clinical course and outcomes of critically ill patients with SARS-CoV-2 pneumonia in Wuhan, China: a single-centered, retrospective, observational study. The Lancet Respiratory Medicine. 2020;8(5):475–81. doi: 10.1016/S2213-2600(20)30079-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Mehta P, McAuley DF, Brown M, Sanchez E, Tattersall RS, Manson JJ. COVID-19: consider cytokine storm syndromes and immunosuppression. The Lancet. 2020;395(10229):1033–4. doi: 10.1016/S0140-6736(20)30628-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Veldhoen M. Interleukin 17 is a chief orchestrator of immunity. Nat Immunol. 2017;18(6):612–21. doi: 10.1038/ni.3742 [DOI] [PubMed] [Google Scholar]
  • 7.Pacha O, Sallman MA, Evans SE. COVID-19: a case for inhibiting IL-17? Nature Reviews Immunology. 2020;20(6):345–6. doi: 10.1038/s41577-020-0328-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Li Q, Gu Y, Tu Q, Wang K, Gu X, Ren T. Blockade of interleukin‐17 restrains the development of acute lung injury. Scand J Immunol. 2016;83(3):203–11. doi: 10.1111/sji.12408 [DOI] [PubMed] [Google Scholar]
  • 9.Iyoda M, Shibata T, Kawaguchi M, Hizawa N, Yamaoka T, Kokubu F, et al. IL-17A and IL-17F stimulate chemokines via MAPK pathways (ERK1/2 and p38 but not JNK) in mouse cultured mesangial cells: synergy with TNF-α and IL-1β. American Journal of Physiology-Renal Physiology. 2009;298(3):F779–F87. doi: 10.1152/ajprenal.00198.2009 [DOI] [PubMed] [Google Scholar]
  • 10.Kumar R, Khandelwal N, Thachamvally R, Tripathi BN, Barua S, Kashyap SK, et al. Role of MAPK/MNK1 signaling in virus replication. Virus Res. 2018;253:48–61. 10.1016/j.virusres.2018.05.028 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Goel S, Saheb Sharif-Askari F, Saheb Sharif Askari N, Madkhana B, Alwaa AM, Mahboub B, et al. SARS-CoV-2 Switches ‘on’ MAPK and NFκB Signaling via the Reduction of Nuclear DUSP1 and DUSP5 Expression. Front Pharmacol. 2021;12:404. doi: 10.3389/fphar.2021.631879 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Malhani AA., Enani MA., Saheb Sharif-Askari F, Alghareeb MR., Bin-Brikan RT., AlShahrani SA., et al. Combination of (interferon beta-1b, lopinavir/ritonavir and ribavirin) versus favipiravir in hospitalized patients with non-critical COVID-19: A cohort study. PLoS One. 2021;16(6):e0252984. doi: 10.1371/journal.pone.0252984 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ghazavi A, Ganji A, Keshavarzian N, Rabiemajd S, Mosayebi G. Cytokine profile and disease severity in patients with COVID-19. Cytokine. 2021;137:155323. 10.1016/j.cyto.2020.155323 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. The lancet. 2020;395(10223):497–506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gong J, Dong H, Xia Q-S, Huang Z-y, Wang D-k, Zhao Y, et al. Correlation analysis between disease severity and inflammation-related parameters in patients with COVID-19: a retrospective study. BMC Infect Dis. 2020;20(1):963. doi: 10.1186/s12879-020-05681-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Saheb Sharif-Askari F, Saheb Sharif Askari N, Goel S, Mahboub B, Ansari AW, Temsah M-H, et al. Upregulation of IL-19 cytokine during severe asthma: a potential saliva biomarker for asthma severity. ERJ Open Research. 2021:00984–2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Galhardo LF, Ruivo GF, de Oliveira LD, Parize G, Santos SSFD, Pallos D, et al. Inflammatory markers in saliva for diagnosis of sepsis of hospitalizes patients. Eur J Clin Invest. 2020;50(5):e13219. 10.1111/eci.13219 [DOI] [PubMed] [Google Scholar]
  • 18.Dubai Health Authority, https://services.dha.gov.ae/sheryan/wps/portal/home/circular-details?circularRefNo=CIR-2020-00000168&isPublicCircular=1&fromHome=rue, Access date: 13/5/2020.
  • 19.Del Valle DM, Kim-Schulze S, Huang H-H, Beckmann ND, Nirenberg S, Wang B, et al. An inflammatory cytokine signature predicts COVID-19 severity and survival. Nat Med. 2020;26(10):1636–43. doi: 10.1038/s41591-020-1051-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Cauchois R, Koubi M, Delarbre D, Manet C, Carvelli J, Blasco VB, et al. Early IL-1 receptor blockade in severe inflammatory respiratory failure complicating COVID-19. Proceedings of the National Academy of Sciences. 2020;117(32):18951. doi: 10.1073/pnas.2009017117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Interim Guidelines for Collecting and Handling of Clinical Specimens for COVID-19 Testing, https://www.cdc.gov/coronavirus/2019-ncov/lab/guidelines-clinical-specimens.html, Accessed 9 September 2020.
  • 22.Mohamed R, Campbell J-L, Cooper-White J, Dimeski G, Punyadeera C. The impact of saliva collection and processing methods on CRP, IgE, and Myoglobin immunoassays. Clinical and Translational Medicine. 2012;1(1):e19. 10.1186/2001-1326-1-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Gill SK, Price M, Costa RJS. Measurement of saliva flow rate in healthy young humans: influence of collection time and mouthrinse water temperature. Eur J Oral Sci. 2016;124(5):447–53. doi: 10.1111/eos.12294 [DOI] [PubMed] [Google Scholar]
  • 24.Lieberman NAP, Peddu V, Xie H, Shrestha L, Huang M-L, Mears MC, et al. In vivo antiviral host transcriptional response to SARS-CoV-2 by viral load, sex, and age. PLoS Biol. 2020;18(9):e3000849. doi: 10.1371/journal.pbio.3000849 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Desai N, Neyaz A, Szabolcs A, Shih AR, Chen JH, Thapar V, et al. Temporal and spatial heterogeneity of host response to SARS-CoV-2 pulmonary infection. Nature Communications. 2020;11(1):6319. doi: 10.1038/s41467-020-20139-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Pencina MJ, D’Agostino RB Sr, D’Agostino RB Jr, Vasan RS. Evaluating the added predictive ability of a new marker: from area under the ROC curve to reclassification and beyond. Stat Med. 2008;27(2):157–72. doi: 10.1002/sim.2929 [DOI] [PubMed] [Google Scholar]
  • 27.Ritchie ME, Phipson B, Wu DI, Hu Y, Law CW, Shi W, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43(7):e47–e. doi: 10.1093/nar/gkv007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Dudoit S, Yang YH, Callow MJ, Speed TP. Statistical methods for identifying differentially expressed genes in replicated cDNA microarray experiments. Statistica sinica. 2002:111–39.
  • 29.Smyth Gordon K. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol. 2004;3(1):1–25. doi: 10.2202/1544-6115.1027 [DOI] [PubMed] [Google Scholar]
  • 30.Wyllie AL, Fournier J, Casanovas-Massana A, Campbell M, Tokuyama M, Vijayakumar P, et al. Saliva or Nasopharyngeal Swab Specimens for Detection of SARS-CoV-2. N Engl J Med. 2020;383(13):1283–6. doi: 10.1056/NEJMc2016359 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Hoffmann M, Kleine-Weber H, Schroeder S, Krüger N, Herrler T, Erichsen S, et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell. 2020;181(2):271–80.e8. 10.1016/j.cell.2020.02.052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Xu H, Zhong L, Deng J, Peng J, Dan H, Zeng X, et al. High expression of ACE2 receptor of 2019-nCoV on the epithelial cells of oral mucosa. International Journal of Oral Science. 2020;12(1):8. doi: 10.1038/s41368-020-0074-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sapkota D, Søland TM, Galtung HK, Sand LP, Giannecchini S, To KKW, et al. COVID-19 salivary signature: diagnostic and research opportunities. J Clin Pathol. 2021;74(6):344. doi: 10.1136/jclinpath-2020-206834 [DOI] [PubMed] [Google Scholar]
  • 34.Desai GS, Mathews ST. Saliva as a non-invasive diagnostic tool for inflammation and insulin-resistance. World J Diabetes. 2014;5(6):730. doi: 10.4239/wjd.v5.i6.730 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zhang C-Z, Cheng X-Q, Li J-Y, Zhang P, Yi P, Xu X, et al. Saliva in the diagnosis of diseases. International journal of oral science. 2016;8(3):133–7. doi: 10.1038/ijos.2016.38 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kaufman E, Lamster IB. The diagnostic applications of saliva—a review. Crit Rev Oral Biol Med. 2002;13(2):197–212. doi: 10.1177/154411130201300209 [DOI] [PubMed] [Google Scholar]
  • 37.Liu J, Li S, Liu J, Liang B, Wang X, Wang H, et al. Longitudinal characteristics of lymphocyte responses and cytokine profiles in the peripheral blood of SARS-CoV-2 infected patients. EBioMedicine. 2020;55:102763. Epub 2020/05/04. doi: 10.1016/j.ebiom.2020.102763 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Korn T, Bettelli E, Oukka M, Kuchroo VK. IL-17 and Th17 Cells. Annu Rev Immunol. 2009;27:485–517. doi: 10.1146/annurev.immunol.021908.132710 [DOI] [PubMed] [Google Scholar]
  • 39.Ogura H, Murakami M, Okuyama Y, Tsuruoka M, Kitabayashi C, Kanamoto M, et al. Interleukin-17 promotes autoimmunity by triggering a positive-feedback loop via interleukin-6 induction. Immunity. 2008;29(4):628–36. doi: 10.1016/j.immuni.2008.07.018 [DOI] [PubMed] [Google Scholar]
  • 40.Shalom-Barak T, Quach J, Lotz M. Interleukin-17-induced Gene Expression in Articular Chondrocytes Is Associated with Activation of Mitogen-activated Protein Kinases and NF-κB *. J Biol Chem. 1998;273(42):27467–73. doi: 10.1074/jbc.273.42.27467 [DOI] [PubMed] [Google Scholar]
  • 41.Amatya N, Garg AV, Gaffen SL. IL-17 Signaling: The Yin and the Yang. Trends Immunol. 2017;38(5):310–22. doi: 10.1016/j.it.2017.01.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Saheb Sharif-Askari F, Saheb Sharif-Askari N, Goel S, Hafezi S, Assiri R, Al-Muhsen S, et al. SARS-CoV-2 attenuates corticosteroid sensitivity by suppressing DUSP1 expression and activating p38 MAPK pathway. Eur J Pharmacol. 2021;908:174374-. doi: 10.1016/j.ejphar.2021.174374 . [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Esaki M Shankar

13 Jul 2022

PONE-D-22-13510Interleukin-17, a salivary biomarker for COVID-19 severityPLOS ONE

Dear Dr. Halwani,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Aug 21 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Esaki M. Shankar, PhD, FRSB, FRCPath

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and 

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

Additional Editor Comments:

The Manuscript entitled 'Interleukin-17, a salivary biomarker for COVID-19 severity' has attempted to find out the suitable non invasive biomarker that could predict COVID-19 severity. The authors have selected the common cytokines that involve during inflammation "Cytokine storm" and screened in salivary specimen. The following comments can be answered.

Major

IL-17, IL-1β and TNFα were determined in Saliva by commercially available human ELISA kits from Abcam. Whether these kits are standardized for saliva specimen. Can the reviewers have the copy of the kit inserts.

Line 193-195:: "For the COVID-19 nasopharyngeal swabs dataset (GSE152075), the investigators extracted RNA from nasopharyngeal swabs in viral transport media from 430 individuals with SARS-CoV-2 and 54 negative controls. Whether these individuals are different from the 201 adult COVID-19 patients and 10 controls. Please rephrase the manuscript for the clarity of study subjects.

There are only 10 healthy control specimens were used. Whether this is sufficient given a minimum of n=50 individuals in each COVID-19 patients group. Is there a sample size justification to substantiate this.

This study was carried out couple of years ago, whether the outcome is still significant given the introduction of vaccines and reduced COVID-19 hospitalizations.

Minor:

The first paragraph in results (Line 244-247) is just describing the number of individuals in each group in table 1, that can be replaced with the important findings in the table 1 that the authors intend to communicate to the scientific community.

Some references are incomplete such as 1 and 9

The manuscript may need a revision to fix minor punctuation and spelling for Eg:

Line 179: comma before and

Line 194: This can be rephrased - instead of 'investigators extracted RNA', the RNA was extracted

Line 216: non-sever

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The Manuscript entitled 'Interleukin-17, a salivary biomarker for COVID-19 severity' has attempted to find out the suitable non invasive biomarker that could predict COVID-19 severity. The authors have selected the common cytokines that involve during inflammation "Cytokine storm" and screened in salivary specimen. The following comments can be answered.

Major

IL-17, IL-1β and TNFα were determined in Saliva by commercially available human ELISA kits from Abcam. Whether these kits are standardized for saliva specimen. Can the reviewers have the copy of the kit inserts.

Line 193-195:: "For the COVID-19 nasopharyngeal swabs dataset (GSE152075), the investigators extracted RNA from nasopharyngeal swabs in viral transport media from 430 individuals with SARS-CoV-2 and 54 negative controls. Whether these individuals are different from the 201 adult COVID-19 patients and 10 controls. Please rephrase the manuscript for the clarity of study subjects.

There are only 10 healthy control specimens were used. Whether this is sufficient given a minimum of n=50 individuals in each COVID-19 patients group. Is there a sample size justification to substantiate this.

This study was carried out couple of years ago, whether the outcome is still significant given the introduction of vaccines and reduced COVID-19 hospitalizations.

Minor:

The first paragraph in results (Line 244-247) is just describing the number of individuals in each group in table 1, that can be replaced with the important findings in the table 1 that the authors intend to communicate to the scientific community.

Some references are incomplete such as 1 and 9

The manuscript may need a revision to fix minor punctuation and spelling for Eg:

Line 179: comma before and

Line 194: This can be rephrased - instead of 'investigators extracted RNA', the RNA was extracted

Line 216: non-sever

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Sep 22;17(9):e0274841. doi: 10.1371/journal.pone.0274841.r002

Author response to Decision Letter 0

13 Aug 2022

Date: Jul 13 2022 10:23AM

To: "Rabih Halwani" rhalwani@sharjah.ac.ae

From: "PLOS ONE" plosone@plos.org

Subject: PLOS ONE Decision: Revision required [PONE-D-22-13510]

PONE-D-22-13510

Interleukin-17, a salivary biomarker for COVID-19 severity

PLOS ONE

Dear Dr. Halwani,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Aug 21 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

• A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

• A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

• An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Esaki M. Shankar, PhD, FRSB, FRCPath

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

Additional Editor Comments:

We warmly thank the editor, our replies to the below raised points can be found in the “Reviewer #1” section of this letter.

The Manuscript entitled 'Interleukin-17, a salivary biomarker for COVID-19 severity' has attempted to find out the suitable non invasive biomarker that could predict COVID-19 severity. The authors have selected the common cytokines that involve during inflammation "Cytokine storm" and screened in salivary specimen. The following comments can be answered.

Major

IL-17, IL-1β and TNFα were determined in Saliva by commercially available human ELISA kits from Abcam. Whether these kits are standardized for saliva specimen. Can the reviewers have the copy of the kit inserts.

Line 193-195:: "For the COVID-19 nasopharyngeal swabs dataset (GSE152075), the investigators extracted RNA from nasopharyngeal swabs in viral transport media from 430 individuals with SARS-CoV-2 and 54 negative controls. Whether these individuals are different from the 201 adult COVID-19 patients and 10 controls. Please rephrase the manuscript for the clarity of study subjects.

There are only 10 healthy control specimens were used. Whether this is sufficient given a minimum of n=50 individuals in each COVID-19 patients group. Is there a sample size justification to substantiate this.

This study was carried out couple of years ago, whether the outcome is still significant given the introduction of vaccines and reduced COVID-19 hospitalizations.

Minor:

The first paragraph in results (Line 244-247) is just describing the number of individuals in each group in table 1, that can be replaced with the important findings in the table 1 that the authors intend to communicate to the scientific community.

Some references are incomplete such as 1 and 9

The manuscript may need a revision to fix minor punctuation and spelling for Eg:

Line 179: comma before and

Line 194: This can be rephrased - instead of 'investigators extracted RNA', the RNA was extracted

Line 216: non-sever

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The Manuscript entitled 'Interleukin-17, a salivary biomarker for COVID-19 severity' has attempted to find out the suitable non invasive biomarker that could predict COVID-19 severity. The authors have selected the common cytokines that involve during inflammation "Cytokine storm" and screened in salivary specimen. The following comments can be answered.

Major

IL-17, IL-1β and TNFα were determined in Saliva by commercially available human ELISA kits from Abcam. Whether these kits are standardized for saliva specimen. Can the reviewers have the copy of the kit inserts.

We thank the reviewer for this important comment.

The following Elisa kits used to measure salivary levels of IL-17, IL-1β, and TNF� were obtained from either R&D systems (IL-17 and IL-1β) or Abcam (TNF�).

In general, the application of these kits is for measuring cytokines in the cell supernatants, serum, plasma, or other biological fluids with no specific mention of saliva sample. However, these kit advice for optimizing reagent diluent for samples with complex metrics such as plasma and other biologic fluids (see attached insetrs).

As far as we know there is no existence of Elisa kit (MERCK, Thermo Fisher Scientific, R&D systems, Abcam, and Diaclone) that is standardized for measurement of IL-17, IL-1β, and TNF� cytokines in a saliva specimen. Previously our group [1] and others [2-6] by using these kits have measured levels of different cytokines in saliva samples. However, in our case, to improve assay performance we optimized the diluent for the saliva samples.

Regarding this we have added the following line to the study method section (pg. 6, lines 240-242), and reads as follows;

“For the assays, saliva samples were centrifuged at 700g for 15 minutes at 4oC, and the supernatant was used. Diluent optimization was performed for the saliva samples. We performed the ELISA assays following the manufacturers' instructions. All samples were measured in duplicates.”

Line 193-195:: "For the COVID-19 nasopharyngeal swabs dataset (GSE152075), the investigators extracted RNA from nasopharyngeal swabs in viral transport media from 430 individuals with SARS-CoV-2 and 54 negative controls. Whether these individuals are different from the 201 adult COVID-19 patients and 10 controls. Please rephrase the manuscript for the clarity of study subjects.

We apologize for the lack of clarity. Cohort of COVID-19 nasopharyngeal swabs dataset (GSE152075) are different from our studied cohort of 201 adult COVID-19 patients. We thus, rephrased the part in the revised version (pg. 6 and 7, lines 325-351) as the following;

“The gene expression data sets of COVID-19 nasopharyngeal swabs (GSE152075) [7], including 430 patients with SARS-CoV-2 infection and 54 uninfected individuals, and COVID-19 lung autopsies (GSE150316) [8], including 52 COVID-19 fatal cases and 5 SARS-CoV-2-uninfected individuals, were all publicly available at the National Center for Biotechnology Information Gene Expression Omnibus (NCIB GEO, http://www.ncbi.nlm.nih.gov/geo) or the European Bioinformatics Institute (EMBL-EBI, https://www.ebi.ac.uk).

There are only 10 healthy control specimens were used. Whether this is sufficient given a minimum of n=50 individuals in each COVID-19 patients group. Is there a sample size justification to substantiate this.

We warmly thank the reviewer for this helpful suggestion. In the revised version, we have raised the number of healthy controls to 50 specimens and accordingly updated the manuscript text and Table 1.

This study was carried out couple of years ago, whether the outcome is still significant given the introduction of vaccines and reduced COVID-19 hospitalizations.

We warmly thank the reviewer for raising this important point. However, since there is no report of IL-17 level in saliva of vaccinated patients with the newly emerged Omicron variants of SARS-CoV-2, we have addressed the issue as future research needs.

In this regard the discussion parts (pg. 14, lines 627-632) were modified to the following;

“In summary, our data suggest a role for IL-17 as a reliable non-invasive salivary biomarker of COVID-19 severity. However, further validation in larger COVID-19 cohorts is needed. Moreover, since our data was drawn from unvaccinated cohort infected with ancestral variants of SARS-CoV-2, further research would be necessary to evaluate level of IL-17 in saliva of vaccinated patients infected with the newly emerged Omicron variants of SARS-CoV-2.”

Minor:

The first paragraph in results (Line 244-247) is just describing the number of individuals in each group in table 1, that can be replaced with the important findings in the table 1 that the authors intend to communicate to the scientific community.

We warmly thank the reviewer for this helpful suggestion. As suggested by the reviewer in the first paragraph of results we have replaced the number of patients in each COVID-19 group with the important patient characterizes mentioned in Table 1. It reads as follows (pg. 9, lines 432-439);

“Out of 201 patients with PCR confirmed SARS-COV-2 infection, 53 patients were those with severe acute COVID-19 pneumonia and elevated serum markers of COVID-19 severity such as D-Dimer, CRP, and ferritin. Severe patients were predominantly male (n=44; 83%) and were on average 15 years older than patients with milder COVID-19 (57 years in severe COVID-19 vs. 48 years in mild/moderate COVID-19; P<0.001). Around half of the severe patients (n=27; 54%) had diabetic mellitus comorbidity. Patient characteristics are listed in Table 1.”

Some references are incomplete such as 1 and 9

We warmly thank the reviewer for pointing this out. As suggested, we made sure that all the references are complete. Reference 1, for World Health Organization Coronavirus (COVID-19) was updated.

The manuscript may need a revision to fix minor punctuation and spelling for Eg:

Line 179: comma before and

Line 194: This can be rephrased - instead of 'investigators extracted RNA', the RNA was extracted

Line 216: non-sever

We warmly thank the reviewer for the above comments. As suggested, the manuscript has now been edited for spelling, and overall style. We have also addressed the above requested changes.

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

In compliance with data protection regulations, you may request that we remove your personal registration details at any time. (Remove my information/details). Please contact the publication office if you have any questions.

References

1. Saheb Sharif-Askari F, Saheb Sharif Askari N, Goel S, Mahboub B, Ansari AW, Temsah M-H, et al. Upregulation of IL-19 cytokine during severe asthma: a potential saliva biomarker for asthma severity. ERJ Open Research. 2021:00984-2020. doi: 10.1183/23120541.00984-2020.

2. van Leeuwen SJM, Proctor GB, Potting CMJ, ten Hoopen S, van Groningen LFJ, Bronkhorst EM, et al. Early salivary changes in multiple myeloma patients undergoing autologous HSCT. Oral Dis. 2018;24(6):972-82. doi: https://doi.org/10.1111/odi.12866.

3. Zielińska K, Karczmarek-Borowska B, Kwaśniak K, Czarnik-Kwaśniak J, Ludwin A, Lewandowski B, et al. Salivary IL-17A, IL-17F, and TNF-α Are Associated with Disease Advancement in Patients with Oral and Oropharyngeal Cancer. Journal of Immunology Research. 2020;2020:3928504. doi: 10.1155/2020/3928504.

4. Liukkonen J, Gürsoy UK, Pussinen PJ, Suominen AL, Könönen E. Salivary Concentrations of Interleukin (IL)-1β, IL-17A, and IL-23 Vary in Relation to Periodontal Status. J Periodontol. 2016;87(12):1484-91. doi: https://doi.org/10.1902/jop.2016.160146.

5. Xiao F, Du W, Zhu X, Tang Y, Liu L, Huang E, et al. IL-17 drives salivary gland dysfunction via inhibiting TRPC1-mediated calcium movement in Sjögren’s syndrome. Clinical & Translational Immunology. 2021;10(4):e1277. doi: https://doi.org/10.1002/cti2.1277.

6. Techatanawat S, Surarit R, Chairatvit K, Khovidhunkit W, Roytrakul S, Thanakun S, et al. Salivary and serum interleukin-17A and interleukin-18 levels in patients with type 2 diabetes mellitus with and without periodontitis. PLoS One. 2020;15(2):e0228921. doi: 10.1371/journal.pone.0228921.

7. Lieberman NAP, Peddu V, Xie H, Shrestha L, Huang M-L, Mears MC, et al. In vivo antiviral host transcriptional response to SARS-CoV-2 by viral load, sex, and age. PLoS Biol. 2020;18(9):e3000849. doi: 10.1371/journal.pbio.3000849.

8. Desai N, Neyaz A, Szabolcs A, Shih AR, Chen JH, Thapar V, et al. Temporal and spatial heterogeneity of host response to SARS-CoV-2 pulmonary infection. Nature Communications. 2020;11(1):6319. doi: 10.1038/s41467-020-20139-7.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file. (37.8KB, docx)

Decision Letter 1

Esaki M Shankar

6 Sep 2022

Interleukin-17, a salivary biomarker for COVID-19 severity

PONE-D-22-13510R1

Dear Dr. Halwani,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Esaki M. Shankar, PhD, FRCPath

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Esaki M Shankar

13 Sep 2022

PONE-D-22-13510R1

Interleukin-17, a salivary biomarker for COVID-19 severity

Dear Dr. Halwani:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Esaki M. Shankar

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Increased IL-17 gene expression levels in lung and nasopharyngeal swabs of COVID-19 patients.

    (A) IL-17 mRNA levels in nasopharyngeal swabs of COVID-19 patients compared to healthy controls (n = 430 COVID-19 patients vs n = 54 healthy controls; GSE152075). (B) IL-17 mRNA levels in lung autopsies of COVID-19 patients compared to healthy controls (n = 17 SARS-CoV-2 infected lung vs. n = 5 healthy lung biopsies; GSE150316). Statistical test: Unpaired t-test or Mann-Whitney U test, depending on the skewness of the data, * P<0.05.

    (PDF)

    Click here for additional data file. (563.4KB, pdf)
    S2 Fig. Correlation between IL-17 expression level and Th-17 signaling related cytokines/chemokines such as TNFα, IL-1β, IFNγ, IL-6, neutrophils chemoattractant IL-8, and monocytes chemoattractant, CCL2 in nasopharyngeal swabs of COVID-19 patients (n = 430 COVID-19 patients; GSE152075).

    Data show that IL-17 in these COVID-19’s nasopharyngeal swabs positively correlate with levels of IL-1β, TNFα, IL-6, IL-8 and CCL2, but not IFNγ. Statistical test: Pearson’s coefficient test with two-tailed p-value <0.05 considered significant.

    (PDF)

    Click here for additional data file. (716KB, pdf)
    S3 Fig. Correlation between IL-17 expression level and Th-17 signaling related cytokines/chemokines such as TNFα, IL-1β, IFNγ, IL-6, IL-8, and CCL2 in lung autopsies of COVID-19 patients (n = 17 SARS-CoV-2 infected lung tissues; GSE150316).

    Data show that IL-17 level in COVID-19’ lung autopsies positively correlate with levels of TNFα, IL-1β, IFNγ, IL-6, IL-8 and CCL2, but not CCL2. Statistical test: Pearson’s coefficient test with two-tailed p-value <0.05 considered significant.

    (PDF)

    Click here for additional data file. (235.1KB, pdf)
    S1 File. Study raw data.

    (SAV)

    Click here for additional data file. (18.7KB, sav)
    Attachment

    Submitted filename: Response to Reviewers.docx

    Click here for additional data file. (37.8KB, docx)

    Data Availability Statement

    If the data are all contained within the manuscript and/or Supporting information files, enter the following: All relevant data are within the manuscript and its Supporting information files.

    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES