Skip to main content
NCBI home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2022 Aug 29;88(18):e01100-22. doi: 10.1128/aem.01100-22

A Novel Carrageenan Metabolic Pathway in Flavobacterium algicola

Chengcheng Jiang a, Tianyu Zhang a, Qiuyang Li a, Hong Jiang a, Xiangzhao Mao a,b,✉
Editor: Jennifer B Glassc
PMCID: PMC9499021  PMID: 36036580

ABSTRACT

Carbohydrate-active enzymes are important components of the polysaccharide metabolism system in marine bacteria. Carrageenase is indispensable for forming carrageenan catalytic pathways. Here, two GH16_13 carrageenases showed likely hydrolysis activities toward different types of carrageenans (e.g., κ-, hybrid β/κ, hybrid α/ι, and hybrid λ), which indicates that a novel pathway is present in the marine bacterium Flavobacterium algicola to use κ-carrageenan (KC), ι-carrageenan (IC), and λ-carrageenan (LC). A comparative study described the different features with another reported pathway based on the specific carrageenans (κ, ι, and λ) and expanded the carrageenan metabolic versatility in F. algicola. A further comparative genomic analysis of carrageenan-degrading bacteria indicated different distributions of carrageenan metabolism-related genes in marine bacteria. The crucial core genes encoding the GH127 α-3,6-anhydro-d-galactosidase (ADAG) and 3,6-anhydro-d-galactose (d-AHG)-utilized cluster have been conserved during evolution. This analysis further revealed the horizontal gene transfer (HGT) phenomenon of the carrageenan polysaccharide utilization loci (CarPUL) from Bacteroidetes to other bacterial phyla, as well as the versatility of carrageenan catalytic activities in marine bacteria through different metabolic pathways.

IMPORTANCE Based on the premise that the specific carrageenan-based pathway involved in carrageenan use by Flavobacterium algicola has been identified, another pathway was further analyzed, and it involved two GH16_13 carrageenases. Among all the characterized carrageenases, the members of GH16_13 accounted for only a small portion. Here, the functional analysis of two GH16_13 carrageenases suggested their hydrolysis effects on different types of carrageenans (e.g., κ, hybrid β/κ, hybrid α/ι-, and hybrid λ-), which led to the identification of another pathway. Further exploration enabled us to elucidate the novel pathway that metabolizes KC and IC in F. algicola successfully. The coexistence of these two pathways may provide improved survivability by F. algicola in the marine environment.

KEYWORDS: red algae, polysaccharides, GH16_13, carrageenan degradation, Flavobacterium algicola

INTRODUCTION

Oceans occupy more than 70% of the Earth’s surface and play an important role in maintaining the stability of Earth’s ecosystems (1). In particular, the abundant algae contents are indispensable for this purpose (2). During the past few decades, a considerable number of marine bacteria have been demonstrated to be able to use the carbon sources contained in seaweed polysaccharides via polysaccharide hydrolases and lyases, which are often encoded in polysaccharide utilization loci (PUL). For example, Flavobacterium sp. strain UM1-01 and Vibrio splendidus 12B01 can metabolize alginate (3, 4); Vibrio sp. strain EJY3, Zobellia galactanivorans DsijT, and Colwellia echini strain A3T can metabolize agarose (5–7); Z. galactanivorans DsijT, Paraglaciecola hydrolytica S66T, and Pseudoalteromonas fuliginea PS47 can metabolize carrageenan (8–10). Analyzing the seaweed polysaccharide metabolism pathways in these marine microorganisms can help researchers to obtain efficient polysaccharide hydrolases or lyases for the biopreparation of functional oligosaccharides (11). More importantly, this research can also help us to understand the vital roles of macroalgae and marine heterotrophic bacteria in marine carbon cycle systems (12). Due to the large amount of research that has been performed (13), the diversity of marine microbial polysaccharide utilization systems has been revealed.

Among the algal polysaccharides, carrageenan, which originates from the cell walls of red algae, possesses a long chain of linear macromolecules that consist of repeated carrabiose units, which are composed of d-β-galactose (d-Gal, G) and 3,6-anhydro-α-d-galactose (d-AHG, DA) (14). Moreover, carrageenans are present in nature in the form of sulfated polysaccharides and can be divided into different types based on the numbers and positions of the sulfate groups in their carrabiose (G-β-1,4-DA) units (15, 16). The main members are κ-carrageenan (KC), ι-carrageenan (IC), and λ-carrageenan (LC), while their disaccharide units are G4S-β-1,4-DA, G4S-β-1,4-DA2S, and G2S-β-1,4-DA2,6-2S, respectively (11, 17, 18). In addition, hybrid carrageenans are also widely present in nature. For example, furcellaran is a hybrid κ/β-carrageenan (K/BC) that contains two types of carrabiose units, G4S-β-1,4-DA and G-β-1,4-DA, in its polysaccharide chain (19, 20).

To date, complete carrageenan catalytic pathways have been revealed in several marine microbes, including Z. galactanivorans DsijT, P. hydrolytica S66T, P. fuliginea PS47, C. echini, and Flavobacterium algicola (8–10, 21, 22). Previously, a metabolic pathway based on specific carrageenases (pathway I) (e.g., κ and ι) was proposed in Z. galactanivorans DsijT (8). In Z. galactanivorans DsijT, two completely different routes were committed to transforming KC and IC into β-neocarrageenan oligosaccharides (NβCOSs). The transformation route of KC contained a glycoside hydrolase family 16 (GH16) κ-carrageenase, CgkA, and an S1_7 (https://sulfatlas.sb-roscoff.fr/sulfatlas/subfamily.html?execution=e3s1) κ-neocarrageenan oligosaccharide (NκCOS) G4S-sulfatase, ZGAL_3146 (23). Three GH82 ι-carrageenases (i.e., CgiA1, CgiA2, and CgiA3) (24, 25), an S1_19 ι-neocarrageenan oligosaccharide (NιCOS) G4S-sulfatase, ZGAL_3145, and an S1_17 DA2S-sulfatase, ZGAL_3151, were successively devoted to NβCOS production from IC. Then, the furcellaran hydrolytic pathway was described in P. hydrolytica S66T, and two GH16s, Ph1656 and Ph1663, belonging to new subfamily 13 (http://www.cazy.org/GH16_13.html), were found to exhibit hydrolysis activities toward the BC motif in furcellaran (9). Thus, Ph1656 and Ph1663 were designated β-carrageenases in this study (9). In 2019, Hettle et al. revealed the KC and IC metabolic pathways in P. fuliginea PS47 (10). Here, KC can not only be decomposed by a specific κ-carrageenase (GH16A/C) but can also be transformed into oligosaccharides under the sequential action of G4S-sulfatases S1_19A and GH16B (GenPept accession no. KAA1157114) (10). Additionally, S1_19A can also remove the G4S sulfate groups in IC to produce a hybrid ι/α-carrageenan (I/AC), which is further decomposed into oligosaccharides by GH16B. Therefore, two different catalytic pathways were present in P. fuliginea PS47. The κ-carrageenase-based pathway I is committed to the degradation of KC, while the multifunctional G4S-sulfatase S1_19A- and GH16B-based novel pathways (pathway II) are devoted to the simultaneous degradation of KC and IC. Upon combining these research findings, carrageenan catalytic pathways can be divided into two types, pathways I and II.

In our recent study, the KC, IC, and partial LC metabolic pathways were described in the marine bacterium F. algicola (21). Here, the multifunctional G4S-sulfatase OUC-S1_19B has been revealed to play a crucial role in the removal of the G4S sulfate groups from NκCOS and NιCOS as well as the G2S sulfate groups from λ-neocarrageenan oligosaccharide (NλCOS). Thus, the metabolic pathways in F. algicola were considered to consist of a specific polysaccharide degradation process and a nonspecific sulfate group removal process. Interestingly, OUC-S1_19B also exhibited a desulfating effect toward KC, IC, and LC polysaccharides in our further experiments. This result provides new insight into the carrageenan utilization pathways in F. algicola. Is there a pathway II consisting of a nonspecific sulfate group removal process and a nonspecific polysaccharide degradation process for completely utilizing KC, IC, and LC in F. algicola? The present research reported here aims to reveal another carrageenan metabolic pathway based on nonspecific GH16_13 in F. algicola. Two nonspecific GH16_13s were identified and characterized to investigate their key roles in the metabolic pathways of the KC, IC, and LC. A comparative analysis of other microbes that contained related enzymes for using carrageenans clearly revealed the diversity of carrageenan catalytic pathways in different marine bacteria.

RESULTS AND DISCUSSION

Identification and sequence analysis of nonspecific GH16s.

Considering that the sequence identity of OUC-S1_19B with the KC/IC G4S-sulfatase S1_19A (GenPept accession no. KAA1157105) from marine bacteria P. fuliginea PS47 (10) reached 53%, we speculated that OUC-S1_19B may have the same ability to remove the G4S groups from KC and IC polysaccharides. This conjecture was supported by our experimental data (see Fig. S1a in the supplemental material). Another G4S-sulfatase, OUC-S1_19C, showed desulfated activities toward KC and IC but was weaker than OUC-S1_19B (Fig. S1b). In addition, OUC-S1_19B could also act on the LC, while OUC-S1_19C had no such effect (Fig. S1). Based on this result, it is further inferred that multifunctional polysaccharide hydrolases may be present in F. algicola to form a novel hydrolytic pathway to metabolize KC and IC. A polysaccharide hydrolase (GH16B) with the same function has been reported in another marine bacterium, P. fuliginea PS47, which can hydrolyze both hybrid K/BC and I/AC (10). Thus, we used GH16B as the template for sequence alignment in the F. algicola proteome. Then, two proteins with high sequence similarity were found, which included gene 2999 coding OUC-FaGH16A and gene 3002 coding OUC-FaGH16B, which showed ~47% and ~62% shared amino acid (AA) sequence identities, respectively, with GH16B. The shared sequence identity of OUC-FaGH16A and OUC-FaGH16B was ~53%. These two encoding genes are similar to the carrageenan-PUL (CarPUL) of F. algicola, which further suggests the possibility of another metabolic pathway (Fig. 1a).

FIG 1.

FIG 1

Open in a new tab

(a) The locations of genes 2999, 3002, 2959, and 2991 in genome of F. algicola. (b) Sequence-based relationship of genes 2999- and 3002-encoded carrageenase OUC-FaGH16A and OUC-FaGH16b, respectively, from F. algicola with other GH16 hydrolases. Accession number and taxonomy are noted for each protein.

Phylogenetic analysis indicated that OUC-FaGH16A and OUC-FaGH16B belong to GH16 subfamily 13 (GH16_13) (Fig. 1b). This subfamily contains several characterized enzymes, and four of them originate from the marine bacterium P. hydrolytica S66T (9). Among them, Ph1656 (GenPept accession no. WP_082768866.1) and Ph1663 (GenPept accession no. WP_082768820.1) exhibited hydrolysis activity against hybrid K/BC, which was designated β-carrageenase. Furthermore, the BLASTP results suggested that OUC-FaGH16A and OUC-FaGH16B have ~51% and ~63% shared AA sequence identity, respectively, with Ph1656. Moreover, another GH16_13, Cgbk16A_Wf (GenPept accession no. WP_083194645.1) from Wenyingzhuangia fucanilytica CZ1127T, could also hydrolyze hybrid K/BC to produce the oligosaccharide of (DAG-G4S)2(DA-G) as the main product (26). Thus, it was indicated that GH16_13s OUC-FaGH16A and OUC-FaGH16B may also possess the hydrolytic abilities of hybrid K/BC to form pathway II in F. algicola.

Molecular characterization of GH16s OUC-FaGH16A and OUC-FaGH16B.

We tested the hydrolytic activities of OUC-FaGH16A and OUC-FaGH16B. The 2999 and 3002 genes were successfully cloned and expressed in Escherichia coli RTS(DE3) and were further purified in a Ni2+-nitrilotriacetic acid (NTA) column (Fig. S2). Then, pure OUC-FaGH16A and OUC-FaGH16B were used to hydrolyze KC and furcellaran (hybrid K/BC). The results suggested that both had hydrolytic activities toward KC and furcellaran that showed a better effect in hydrolyzing furcellaran (Fig. 2a and d). Furthermore, their optimum reaction temperatures and pH values were determined by using furcellaran as a hydrolytic substrate. Both OUC-FaGH16A and OUC-FaGH16B exhibited their highest activities at 40°C (Fig. 2b and e) but at different pH values, which were 7.0 and 6.0 (Fig. 2c and f), respectively.

FIG 2.

FIG 2

Open in a new tab

Functional characterization of GH16 carrageenases OUC-FaGH16A and OUC-FaGH16B from F. algicola. (a) Substrate specificity results of OUC-FaGH16A for hydrolyzing KC and furcellaran. (b) The optimum temperature of OUC-FaGH16A for hydrolyzing furcellaran. (c) The optimum reaction pH of OUC-FaGH16A for hydrolyzing furcellaran. (d) Substrate specificity results of OUC-FaGH16B for hydrolyzing KC and furcellaran. (e) The optimum temperature of OUC-FaGH16B for hydrolyzing furcellaran. (f) The optimum reaction pH of OUC-FaGH16B for hydrolyzing furcellaran. KC, κ-carrageenan.

The previously characterized GH16_13s, including Ph1656 and Ph1663 from P. hydrolytica S66T, GH16B from P. fuliginea PS47, Ce385 (GenPept accession no. WP_148747727.1) and Ce387 (GenPept accession no. WP_148747729.1) from C. echini, and Cgbk16A_Wf from W. fucanilytica CZ1127T, exhibited no hydrolytic abilities toward KC (9, 10, 22, 26). Thus, it is inferred here that the reason why OUC-FaGH16A and OUC-FaGH16B hydrolyzed KC may be due to the impure KC that may contain small quantities of BC motifs. However, the high-performance liquid chromatography (HPLC) results showed that their 24-h products from the hydrolysis of KC were primarily composed of NκCOSs (Fig. 3a and b) rather than desulfated NκCOSs. The main products of OUC-FaGH16A were κ-neocarrabiose (Nκ2), κ-neocarratetrose (Nκ4), κ-neocarrahexaose (Nκ6), and κ-neocarraoctaose (Nκ8), while those of OUC-FaGH16B were Nκ2 and other NκCOSs with degree of polymerization (DP) greater than 4. These results suggested the hydrolytic abilities of OUC-FaGH16A and OUC-FaGH16B toward KC motifs. This finding was different from the results for the previously reported GH16_13s, which revealed the distinctive degradation modes of OUC-FaGH16A and OUC-FaGH16B. Considering their high shared sequence identities with Ph1656, the hydrolytic effects of Ph1656 toward KC and furcellaran were determined using HPLC. The results showed that Ph1656 could produce NCOSs from hydrolyzing furcellaran, but without product generation when it acted on KC (Fig. S3b). This result is consistent with the results reported in the previous literature (9).

FIG 3.

FIG 3

Open in a new tab

Hydrolysis products of GH16 carrageenases OUC-FaGH16A and OUC-FaGH16B from hydrolyzing KC and OUC-S1_19B-treated KC. (a) HPLC for analyzing the products of OUC-FaGH16A from hydrolyzing KC. (b) HPLC for analyzing the products of OUC-FaGH16B from hydrolyzing KC. (c) HPLC for analyzing the products of OUC-FaGH16A and OUC-FaGH16B from hydrolyzing OUC-S1_19B-treated KC. KC, κ-carrageenan; Nκ2, κ-neocarrabiose; Nκ4, κ-neocarratetrose; Nκ6, κ-neocarrahexaose; Nκ8, κ-neocarraoctaose; Nκ14, κ-neocarratetradecaose.

Although OUC-FaGH16A and OUC-FaGH16B can decompose KC, their hydrolysis efficiencies were significantly lower than those when furcellaran was used as a substrate. Therefore, it was preliminarily concluded that the first step in pathway II was the nonspecific polysaccharide desulfurization process. To demonstrate this observation further, OUC-S1_19B-treated KCs were used as hydrolysis substrates of OUC-FaGH16A and OUC-FaGH16B. The HPLC results showed that OUC-FaGH16A produced Nκ2, Nκ4, desulfated Nκ4, and desulfated Nκ6, while OUC-FaGH16B produced Nκ4, desulfated Nκ4, and desulfated Nκ6 from the hydrolysis of OUC-S1_19B-treated KC (Fig. 3c). These products had lower DPs than the hydrolysates obtained from the decomposition of KC. Therefore, the first step in using KC was to remove the sulfate groups in metabolic pathway II of F. algicola. This result is consistent with that described in previous studies, including the catalytic pathways in P. hydrolytica S66T (9) and P. fuliginea PS47 (10). Moreover, the liquid chromatography coupled with mass spectrometry (LC-MS) method was applied to explore the end products resulting from furcellaran hydrolysis. The analysis data suggested that their products consisted of neocarrageenan oligosaccharides (NCOSs) with DPs from 2 to 12, while the main products of OUC-FaGH16A were DP4 and DP6, and that of OUC-FaGH16B was DP4 (Fig. 4a and b and Fig. 5a and b). Moreover, DP4 and DP6 were primarily composed of Nκ4 and Nκ6, respectively, with one sulfate group removed. To determine their specific structures, GH129 exo-α-3,6-anhydro-d-galactosidase (ADAG) OUC-FaBC129A was used to verify its hydrolytic abilities toward desulfated Nκ4 and Nκ6 products. The mass spectrometry (MS) results showed that DP3 (G-DA-G4S) and DP5 (G-DA-G4S-DA-G4S) were produced after hydrolysis, which indicated that the DP4 and DP6 products should be DA-G-DA-G4S and DA-G-(DA-G4S)2, respectively (Fig. 4c and Fig. 5c). ADAG can only release the d-AHG unit from the nonreducing end of the NCOSs with an Nβ2 motif nonreducing end, which has been demonstrated in previous studies (8). Intriguingly, the G4S-sulfatase, OUC-S1_19B, acts only on the G4S sulfate group from the nonreducing end of NκCOSs to produce DA-G-(DA-G4S)n. This observation indicates that desulfated NκCOSs with the same structure would be produced in either pathway I or II.

FIG 4.

FIG 4

Open in a new tab

Hydrolysis products of GH16 carrageenases OUC-FaGH16A from hydrolyzing furcellaran. (a) Total ion peak diagram of LC-MS for analyzing the products of OUC-FaGH16A from hydrolyzing furcellaran. (b) MS results of each LC peak in Fig. 4a. (c) MS for analyzing the reaction products from hydrolyzing OUC-FaGH16A’s degradation product using OUC-FaBC129A. KC, κ-carrageenan; Nκ2, κ-neocarrabiose; Nκ4, κ-neocarratetrose; Nκ6: κ-neocarrahexaose; Nκ8, κ-neocarraoctaose; Nκ10, κ-neocarradecaose; Nκ12, κ-neocarradodecaose.

FIG 5.

FIG 5

Open in a new tab

Hydrolysis products of GH16 carrageenases OUC-FaGH16B from hydrolyzing furcellaran. (a) Total ion peak diagram of LC-MS for analyzing the products of OUC-FaGH16B from hydrolyzing furcellaran. (b) MS results of each LC peak in Fig. 5a. (c) MS for analyzing the reaction products from hydrolyzing OUC-FaGH16B’s degradation product using OUC-FaBC129A. KC, κ-carrageenan; Nκ2, κ-neocarrabiose; Nκ4, κ-neocarratetrose; Nκ6, κ-neocarrahexaose; Nκ8, κ-neocarraoctaose; Nκ10, κ-neocarradecaose; Nκ12, κ-neocarradodecaose.

Further experiments to explore the capabilities of OUC-FaGH16A and OUC-FaGH16B to hydrolyze IC and OUC-S1_19B-treated IC (hybrid I/AC) were performed under their optimum reaction conditions. Our results suggested that they exhibited no obvious hydrolytic activity for IC but exhibited hydrolytic activity for OUC-S1_19B-treated IC (Fig. 6a). Then, MS was used to analyze the products that resulted from degrading OUC-S1_19B-treated IC (Fig. 6b). This result indicated that their main product was DP4, but it could not be confirmed whether this one was the desulfated products. LC-MS was further used to compare the DP4 products of OUC-FaGH16B with ι-neocarratetrose (Nι4) produced from the hydrolysis of IC by ι-carrageenase OUC-FaLC82C (Fig. 6c). As shown in Fig. 6c, the retention time of the DP4 product was longer than that of Nι4, which indicated that it had a smaller molecular weight (MW) as well as a desulfated G4S group.

FIG 6.

FIG 6

Open in a new tab

Hydrolysis effects of GH16 carrageenases OUC-FaGH16A and OUC-FaGH16B to IC and OUC-S1_19B-treated IC. (a) Substrate specificity results of OUC-FaGH16A and OUC-FaGH16B for hydrolyzing IC and OUC-S1_19B-treated IC. (b) MS results of products from hydrolyzing OUC-S1_19B-treated IC using OUC-FaGH16A and OUC-FaGH16B. (c) LC-MS for comparison the Nι4 and the DP4 product from hydrolyzing OUC-S1_19B-treated IC using OUC-FaGH16B. IC, ι-carrageenan; Nι2, ι-neocarrabiose; Nι4, ι-neocarratetrose.

Apart from KC and IC, the catalytic effects of OUC-FaGH16A and OUC-FaGH16B on LC and OUC-S1_19B-treated LC were also determined. The hydrolysis experiments showed that only OUC-FaGH16B exhibited obvious hydrolytic activity against OUC-S1_19B-treated LC (Fig. 7a). Then, its products, which were composed of DP2 and DP4, were detected by LC-MS (Fig. 7b). To the best of our knowledge, this is the first study to reveal that GH16_13 is involved in the LC metabolic pathway in carrageenan-degrading bacteria. Through this finding, we know that GH16_13s (OUC-FaGH16A and OUC-FaGH16B) indeed participate in forming pathway II for metabolizing KC, IC, and LC in F. algicola. Moreover, the first step in pathway II consisted of the polysaccharide desulfation process that involved G4S sulfatase OUC-S1_19B, which was identified from the experimental results of substrate specificity.

FIG 7.

FIG 7

Open in a new tab

Hydrolysis effects of GH16 carrageenase OUC-FaGH16B to LC and OUC-S1_19B-treated LC. (a) Substrate specificity result of OUC-FaGH16B for hydrolyzing LC and OUC-S1_19B-treated LC. (b) LC-MS results of products from hydrolyzing OUC-S1_19B-treated LC using OUC-FaGH16B. LC, λ-carrageenan; Nλ2, λ-neocarrabiose; Nλ4, λ-neocarratetrose.

Molecular characterization of GH167s OUC-FaGH167A and OUC-FaGH167B.

In pathway II of P. fuliginea PS47, GH167 (GenPept accession no. KAA1157102.1) played a key role in fully using KC and IC. Its function was to act on the first β-1,4-linkage from the NCOS nonreducing end without sulfate groups to release the β-neocarrabiose (Nβ2) unit, so it was designated Nβ2 releasing exo-carrageenase (10). GH167 (Ph1657, GenPept accession no. WP_068375692.1) with the same function was also found in another marine bacterium, P. hydrolytica S66T (9). This finding may indicate that GH167 is present in pathway II. Unsurprisingly, two putative GH167s (OUC-FaGH167A and OUC-FaGH167B) that were encoded by genes 2959 and 2991 were found in F. algicola, which showed ~40% and ~37% AA sequence identities, respectively, with Ph1657. The shared sequence identity of OUC-FaGH167A and OUC-FaGH167B was ~47%. Phylogenetic analysis indicated that they belong to the GH167 family (Fig. S4). To explore their hydrolysis modes, the 2959 and 2991 genes were cloned and expressed in E. coli RTS(DE3) to produce the recombinant enzymes OUC-FaGH167A and OUC-FaGH167B, respectively. Polyacrylamide gel electrophoresis (PAGE) was conducted to obtain pure OUC-FaGH167A and OUC-FaGH167B (Fig. S2).

Pure OUC-FaGH167A and OUC-FaGH167B were incubated with the products produced by the OUC-FaGH16B hydrolysis of KC. The HPLC results suggested that the main product of OUC-FaGH167A was Nκ4 (Fig. 8a), while that of OUC-FaGH167B was Nκ2 (Fig. 8b). Additionally, Nκ10 was further used as a substrate to determine its degradation mode. The results suggested that OUC-FaGH167A could produce Nκ6 and Nκ4, and OUC-FaGH167B could produce Nκ2, Nκ4, and Nκ6, in which Nκ2 was the major component (Fig. 8c). These results revealed that the minimum cutting units of OUC-FaGH167A and OUC-FaGH167B were DP4 and DP2, respectively. To date, only four GH167s, Ph1657 (9), BovGH167 (GenPept accession no. WP_004320039.1) (10), GH167 from P. fuliginea PS47 (10), and Ce390 from C. echini (GenPept accession no. WP_148747731.1) (22) have been characterized. All of these individuals exhibit the same hydrolysis mode toward NCOSs without sulfate groups at the nonreducing end, and their cutting units were Nβ2. Their hydrolytic mode was different from that of the OUC-FaGH167A and OUC-FaGH167B described in this study. The action substrates of OUC-FaGH167A and OUC-FaGH167B were not limited to NCOSs with an Nβ2 motif’s nonreducing end but were also present in NκCOSs. In particular, OUC-FaGH167A was quite different from the others in that its minimum action unit was DP4. To explain this phenomenon, the three-dimensional structure of OUC-FaGH167A was predicted with SWISS-MODEL (https://swissmodel.expasy.org/) by using the tertiary structure of BovGH167 (Protein Data Bank [PDB] no. 6PTM, with a 46% shared AA sequence identity) as the template. The global model quality estimation (GMQE) score of the predicted three-dimensional structure reached 0.72, and VERIFY3D showed that 97.67% of the residues had an average 3D-1D score ≥0.2, indicating its reliability (Fig. S5). A comparison of structural overlaps showed that OUC-FaGH167A formed a larger pocket for binding NCOSs with larger DPs as well as the G4S residue at the nonreducing end (Fig. S6a and b). Molecular docking of OUC-FaGH167A with Nκ8 was conducted to reveal that the sulfated Nκ4 unit could properly dock into the substrate-binding pocket (Fig. S6d).

FIG 8.

FIG 8

Open in a new tab

Main product analyses of the GH167s OUC-FaGH167A and OUC-FaGH167B. (a) HPLC for analyzing the main product of OUC-FaGH167A from hydrolyzing OUC-FaGH16B-hydrolyzed KC. (b) HPLC for analyzing the main product of OUC-FaGH167B from hydrolyzing OUC-FaGH16A-hydrolyzed KC. (c) HPLC for analyzing the products of OUC-FaGH167A and OUC-FaGH167B from hydrolyzing Nκ10. KC, κ-carrageenan; Nκ2, κ-neocarrabiose; Nκ4, κ-neocarratetrose; Nκ6, κ-neocarrahexaose; Nκ10, κ-neocarradecaose; Nκ12, κ-neocarradodecaose.

The main products of OUC-FaGH16A and OUC-FaGH16B from hydrolyzing hybrid K/BC were DP4 and DP6. OUC-FaGH167B should participate in the next degradation process for transforming oligosaccharides to produce Nκ2 and Nβ2. The OUC-FaGH16A product obtained from hydrolyzing furcellaran was used as a substrate to test the hydrolytic ability of OUC-FaGH167B. The MS results suggested that the end product was primarily composed of a large amount of DP2 and a trace amount of DP4 (Fig. S7a), while DP2 was also the major product obtained from OUC-S1_19B-treated Nκ10 (Fig. S7b), which revealed that OUC-FaGH167B was involved in pathway II. Although there were similar degradation behaviors involving GH167 in P. hydrolytica S66T and P. fuliginea PS47, their GH167s could act only on NCOSs without sulfate groups at the nonreducing ends (9, 10). The OUC-FaGH167A and OUC-FaGH167B studied here could also act on the NκCOSs. This finding indicated the transformation of NκCOSs into Nκ2 without an additional desulfation step.

Elucidation of pathway II for metabolizing KC and IC in F. algicola.

The oligosaccharide desulfation, NβCOS hydrolysis, and d-AHG utilization processes in F. algicola have been described in our previous research. By combining this information with the above-mentioned findings, another pathway (pathway II) for metabolizing carrageenan polysaccharides in F. algicola can be identified (Fig. 9). In this catalytic pathway, the first stage consisted of the polysaccharide desulfation process involving G4S sulfatase OUC-S1_19B to remove the sulfate groups in the d-Gal residues of KC, IC, and LC. The desulfated polysaccharides were then hydrolyzed into various types of oligosaccharides under the action of GH16_13s OUC-FaGH16A and OUC-FaGH16B. There, the NκCOSs and hybrid βκ-NCOSs could release their Nκ2 and Nβ2 units, respectively, at the nonreducing ends under the action of OUC-FaGH167B. The sulfatase OUC-S1_19B further removed the sulfate groups of Nκ2’s G4S to produce Nβ2. Nβ2 was immediately completely transformed into two monomers, d-Gal and d-AHG, via the hydrolytic effects of the exo-a-3,6-anhydro-d-galactosidases (ADAGs) OUC-FaBC127A and OUC-FaBC129A.

FIG 9.

FIG 9

Open in a new tab

Schematic model of novel pathway II for transforming KC and IC into two monomers (d-Gal and d-AHG) in F. algicola. In the first process, the KC, IC, and LC were lost their d-Gal residues’ sulfates by sulfatase OUC-S1_19B. Then the desulfated polysaccharides were further decomposing into different types of oligosaccharides using GH16s_13 OUC-FaGH16A and OUC-FaGH16B. Then the different types of NCOSs were converted into d-Gal and l-AHG via different routes, which were described on the right side of Fig. 9. KC, κ-carrageenan; IC, ι-carrageenan; LC, λ-carrageenan; Nκ4, κ-neocarratetrose; NCOSs, neocarrageenan oligosaccharides; d-Gal, d-galactose; d-AHG, 3,6-anhydro-d-galactose.

For Nι4 and hybrid DP4 (DA2S-G-DA2S-G4S), another reported DA2S exosulfatase, OUC-S1_17A, was required to remove their DA2S sulfate groups (21). Under the action of OUC-S1_17A, DA2S-G-DA2S-G4S was converted into DA-G-DA2S-G4S. Nι4 required an additional G4S sulfate group involving the G4S sulfatase OUC-S1_19B before removing the DA2S sulfate group. Then, the resulting DA-G-DA2S-G4S released its Nβ2 motif at the nonreducing end via the hydrolytic effect of OUC-FaGH167B. The retained Nι2 was further transformed into Nβ2 under the sequential actions of OUC-S1_19B and OUC-S1_17A. ADAG, OUC-FaBC127A, or OUC-FaBC129A entirely hydrolyzed Nβ2 to produce d-AHG and d-Gal. Lastly, d-Gal was used by the Leloir pathway. d-AHG was transformed into d-glyceraldehyde-3-phosphate (d-Gly-3-P) and pyruvate for further metabolism via a four-step enzymatic pathway, which was composed of d-AHG dehydrogenase (d-AHGD) (named FaDAD, GenPept accession no. MCG9793716.1), 3,6-anhydro-d-galactonate cycloisomerase (d-AHGAC) (named FaDAAC, GenPept accession no. MCG9793715.1), 2-keto-3-deoxy-d-galactonate kinase (KDGK) (named FaKDGK, GenPept accession no. MCG9793717.1), and 2-keto-3-deoxygluconate-specific aldolase (KDGA) (named FaKDPGA, GenPept accession no. MCG9793718.1) (21).

For the transport process of oligosaccharides, the carrageenan-specific transporters SusD-like lipoprotein ZGAL_3580 (GenPept accession no. CAZ97718.1) and SusC-like TonB-dependent receptor ZGAL_3581 (GenPept accession no. CAZ97719.1) from Z. galactanivorans DsijT (8) were used as probes to judge whether there were similar coding sequences in F. algicola. From the results of the sequence alignment, there are no sequences that were obviously similar to that of ZGAL_3580. The protein sequences encoded by genes 2938 (GenPept coding protein accession no. WP_239867451.1) and 1527 (GenPept coding protein accession no. WP_239864178.1) showed similarities to ZGAL_3581, but their shared identities were only ~31%. Thus, the existence of carrageenan-specific SusCD-like proteins in F. algicola cannot be determined here and must be further explored in our future work. In addition, the cellular locations of OUC-S1_19B, OUC-FaGH16A, OUC-FaGH16B, OUC-FaGH167A, and OUC-FaGH167B were predicted using the TOPCONS web server (https://topcons.cbr.su.se/) (27). The results suggested that all of them were located outside the cell’s inner membrane. However, more reliable results will be obtained from the secretome analysis of F. algicola grown on KC, IC, or LC as the sole carbon source, which is our future work direction.

Compared with pathway I in F. algicola (21), pathway II is initiated by the polysaccharide desulfation process instead of the polysaccharide-specific hydrolysis process. The formation of different types of NCOSs involved the same polysaccharide hydrolases (e.g., two GH16_13s, OUC-FaGH16A and OUC-FaGH16B). Specific polysaccharide hydrolases (e.g., three types of carrageenases) were dedicated to the three types of carrageenan transformation processes in pathway I. Another difference was that the oligosaccharide glycosidases that produced the two monomers obtained from degrading NCOSs were different. In pathway I, the ADAGs (OUC-FaBC127A and OUC-FaBC129A) and β-galactosidase (BG) (OUC-FaGH2A) worked together in the processes of converting NCOSs. However, OUC-FaGH2A was replaced by OUC-FaGH167B in pathway II. Additionally, although sulfatase OUC-S1_19B was present in the pathways I and II, it produced desulfating effects on different substrates. This result further underlined its significant role in the carrageenan metabolic pathways of F. algicola.

Comparative analysis of carrageenan metabolic pathway-related genes in different microorganisms.

We further investigated the versatility of the carrageenan catalytic system in a variety of marine bacteria. The genomes of 26 bacteria possessing 31 CarPULs were collected. The CarPULs of most of the collected bacteria could not be found in the PUL database (PULDB) (28). The essential gene encoding d-AHGD was used as the core of each CarPUL, and approximately 20 kbp around the d-AHGD coding gene were considered to be located in the CarPUL. Consequently, the CarPUL-related genes in different bacteria could be divided into three categories, those conserved in CarPULs, those conserved elsewhere in the genome, and those absent from the genome. According to these results, a cluster analysis of the genes related to carrageenan metabolism in 31 CarPULs was performed. The results suggested that the CarPULs could be clustered into three clades (Fig. 10). From the perspective of bacterial species, the members of clade 2 and clade 3 all belong to the phylum Bacteroidetes, including the classes Flavobacteriia and Cytophagia. Nearly all the members of clade 1 belong to the phylum Proteobacteria. In addition, the feature that can be used to distinguish whether there is a pathway II is the presence of GH16_13; additionally, GH16_KC, GH82, and GH150 were the key components used to determine the presence of pathway I. From this standpoint, the members of clades 2_II and 2_III tend to have only pathway I, while all the other members tend to have both pathways I and II.

FIG 10.

FIG 10

Open in a new tab

Comparative genomic analysis of the crucial genes within the CarPUL carrageenan-degrading bacteria. The essential gene encoding d-AHG dehydrogenase (d-AHGD) was used as the core of each CarPUL, and about 20 kbp around the d-AHGD coding gene were considered to be located in the CarPUL. Consequently, the CarPUL-related genes in different bacteria could be divided into three conditions, conserved in CarPUL, conserved elsewhere in the genome, and absent in genome. Bacterial species were clustered into three clades based on the conservation profile. The taxonomy of the bacterial species and predicted metabolic pathways (pathways I or II) used by each marine bacterium are listed. Pr, Proteobacteria; Ba, Bacteroidetes; Gp, Gammaproteobacteria; Fl, Flavobacteriia; Cy, Cytophagia.

GH127 ADAG is highly conserved among the compared CarPULs, which indicates its important role in both pathways I and II. GH127 ADAG was not found in P. fuliginea PS47, but it is plausible that hydrolases (e.g., EU509_08830, EU509_08835, and/or EU509_08875) with the same function were present (10). Another type of ADAG (GH129) was found only in the members of clade 2. Moreover, the sulfatases S1_19 and S1_17 are also highly conserved within these CarPULs. This result suggested that the KC and IC metabolic pathways were present in most of the bacteria studied here. Although GH16_KC and GH82 are missing in some CarPULs, GH16_13, which is involved in pathway I for using both KC and IC, is always present to compensate for the absence of GH16_KC or GH82. In addition, GH150 λ-carrageenase has rarely been found in these CarPULs, while in nearly all λ-carrageenase-encoding bacteria (except for Flammeovirga pacifica WPAGA1), GH150 coding genes were found outside CarPULs.

Apart from GH127, d-AHG metabolism-related enzymes are also highly conserved among these marine bacteria. d-AHGD has been found in all microorganisms. P. fuliginea PS47 was the only one that did not possess d-AHGAC in its CarPUL. KDGK was absent from several microorganisms, which suggested that these species may transform 2-keto-3-deoxy-d-galactonate (KDGal) via a nonphosphorylative Entner-Doudoroff pathway, which was discovered in Picrophilus torridus (29). This pathway involved a KDGA to convert KDGal into pyruvate and glyceraldehyde. We further investigated whether the gene encoding this enzyme was present in similar microorganisms without the gene encoding KDGK. As expected, similar coding genes were found in the genomes of Saccharicrinis fermentans DSM 9555, Aureibaculum flavum A20, Rhodopirellula sp. strain SWK7, and P. hydrolytica S66T, and their GenPept numbers are WP_044213354.1, WP_198842174.1, WP_009102167.1, and WP_068375816.1, respectively. Overall, GH127 ADAG and d-AHG metabolism are the core systems in bacterial CarPULs.

The F. algicola described here has a rich gene coding system to form carrageenan catalytic pathways. We observed that the bacteria in the same clade (clade 2) of F. algicola all have relatively greater numbers of gene components in their carrageenan pathways than the bacteria in clades 1 and 3. This result likely implies the occurrence of horizontal gene transfer (HGT) from the bacteria in clade 2 to the bacteria in other clades, which is consistent with the reported conclusion of an HGT event from Bacteroidetes to other phyla described in previous research (8).

In conclusion, the KC and IC GH16_13-based novel pathways in the marine bacterium F. algicola were determined. These pathways were composed of a nonspecific desulfating process of polysaccharides and a hybrid nonspecific degradation process of polysaccharides, which were achieved by a multifunctional G4S sulfatase, OUC-S1_19B, and two multifunctional GH16_13 carrageenases, OUC-FaGH16A and OUC-FaGH16B. Moreover, the different types of oligosaccharide transformation routes involving GH167 OUC-FaGH167B were further investigated. Comparative genomic analysis suggested the different distribution characteristics of carrageenan-related genes in different bacterial phyla. In general, the carrageenan metabolic pathway based on GH16_13 and GH167 described here deepens our understanding of carrageenan degradation by marine bacteria.

MATERIALS AND METHODS

Materials.

The F. algicola (strain number: 1.12076) was ordered from the China General Microbiological Culture Collection Center (CGMCC). The vector pCold-SUMO for soluble protein expression (because the target enzymes studied here cannot be expressed in plasmids with a T7 protomer to form soluble proteins) has been kept in our lab. The E. coli DH5α for protein cloning was purchased from Tsingke Biotechnology Co., Ltd. (Beijing, China). The E. coli RTS BL21(DE3) for protein expression was obtained commercially from HaiGene (Qingdao, China). The KC and IC used for enzyme activity and hydrolytic product identification were purchased from Sigma-Aldrich. Furcellaran was ordered from Carbosynth (Oxford, England), and LC was ordered from TCI (Shanghai, China). NκCOSs with DPs of 2, 4, 8, and 10 were purchased from BZ Oligo Biotech (Qingdao, China).

Sequence analyses.

Glycoside hydrolases in the proteome of F. algicola were identified using DIAMOND (30) with the Carbohydrate-Active enZYmes database (CAZy). The sequence alignment of the predicted hydrolases, which belong to GH16_13 and GH167, was performed with BLASTp (https://blast.ncbi.nlm.nih.gov/) searches against the nonredundant (nr) databases. To illustrate their glycoside hydrolase (GH) families, phylogenetic analyses were performed with MEGA 6.0.

Sulfatase activity assay.

The sulfatases OUC-S1_19B and OUC-S1_19C were expressed and purified according to previous research (21). Here, para-nitrophenol (pNP) was used to detect sulfate production during the desulfation process catalyzed by OUC-S1_19B and OUC-S1_19C (31). The 200-μL reaction system contained 0.3% (wt/vol) KC, IC, or LC, 30 μL of pure OUC-S1_19B or OUC-S1_19C, and 0.8 mM pNP (added from a 500-mM solution dissolved in dimethyl sulfoxide [DMSO]) and was incubated at 35°C and pH 7.0 for 24 h. The absorbance changes at 405 nm were determined with a spectrophotometer (Thermo Fisher Scientific), and an inactive enzyme was used as a control.

Gene cloning, expression, and purification of OUC-FaGH16A, OUC-FaGH16B, OUC-FaGH167A, and OUC-FaGH167B.

The F. algicola genome was extracted from the 48-h bacterial solution using a TIANamp bacterial DNA kit (Tiangen Biotech, Beijing, China). The OUC-FaGH16A, OUC-FaGH16B, OUC-FaGH167A, OUC-FaGH167B, and Ph1656 genes were then cloned from the genomic template via a PCR by using 2× Phanta Max master mix (Vazyme, China) DNA polymerase, and the primers used here are shown in Table 1. Additionally, pCold-SUMO was used to insert the target genes and was also linearized via PCR. The PCR products of the target genes and linearized vectors were linked using a ClonExpress Ultra one-step cloning kit (Vazyme) and were then imported into E. coli DH5α to obtain recombinant expression plasmids harboring the target genes. The recombinant plasmids were immediately transformed into E. coli RTS BL21(DE3) to obtain the engineered strains.

TABLE 1.

The primers used in this study

Primer Sequence (5′–3′) Usage
2999ColdF gcggtggcggtagcggtATGTGCACTAAATCCAAAG Cloning gene 2999 to ligate into linearized pCold-SUMO
2999ColdR GGTGGTGGTGGTGCTCGAGTGCGGCCGCAAGCTTTTTTTATGCCAAACTCTTAAATATTC
3002ColdF gcggtggcggtagcggtATGCAGAAGGAGAAGGC Cloning gene 3002 to ligate into linearized pCold-SUMO
3002ColdR GTGGTGGTGGTGCTCGAGTGCGGCCGCAAGCTTATATTATTCTTTTGCCAAACGC
ph1656F ggcggtggcggtagcggtGAAGTTCTGCCGCTGAGCG Cloning gene ph1656 to ligate into linearized pCold-SUMO
Ph1656R GGTGGTGCTCGAGTGCGGCTTTCTGCCACACACGC
SUMO-2999/3002F CCGCACTCGAGCACCACCACCACCACCACTGAaagcttgtcgacctgcag To linearize the plasmid pCold-SUMO without SUMO domain for linking 2999 and 3002
SUMO-2999/3002R aatgggtcgcggatccGCAAATGGAACTCCACC
2959ColdF cggtaccctcgagggatccATGTATGCGATCTTGACATC Cloning gene 2959 to ligate into linearized pCold-SUMO
2959ColdR agtgcggccgcaagcttTTTTTTTATGATTTTTATAGCATATTTTTTTTC
2991ColdF gtaccctcgagggatccATGATAGGGACAAGCTTC Cloning gene 2991 to ligate into linearized pCold-SUMO
2991ColdR ctgcaggtcgacaagcttCTTTTTATCCTTTAACTCCAC
ColdF aagcttgtcgacctgcagt To linearize the plasmid pCold-SUMO for linking 2959 and 2991
ColdR ggatccctcgagggtaccg
Open in a new tab

Afterward, each engineered strain was first cultured overnight in LB (0.5% [wt/vol] yeast extract, 1% [wt/vol] tryptone, and 1% [wt/vol] NaCl) liquid medium. Then, 1 mL of bacterial solution was transferred into 100 mL of LB medium (containing 100 μg/mL ampicillin, 17 μg/mL chloramphenicol, and 0.5 mg/mL l-arabinose) and then grown at 37°C with agitation at 220 rpm. Tetracycline (2 ng/mL) was added to the medium to induce chaperone production when the optical density at 600 nm (OD600) reached 0.3. The cells continued to grow at 37°C to achieve an OD600 of 0.6. Then, 0.1 mM IPTG (isopropyl-β-d-thiogalactopyranoside) was added, and the culture temperature was decreased to 16°C to induce protein expression.

After a 24-h induction, the cells were harvested by centrifugation at 8,000 × g for 15 min, resuspended in ultrapure water, and subsequently disrupted by an ultrasonic cell wall breaking instrument obtained from Xinzhi Biotechnology Co., Ltd. (Ningbo, China). Afterward, the soluble supernatants were obtained by centrifugation (4°C, 8,000 × g) for 15 min. Affinity chromatography with an Ni2+-nitrilotriacetic acid (NTA) column was used to obtain pure enzymes. Each eluent obtained from the different imidazole concentrations was assessed by SDS-PAGE. The pure components were collected, and ultrafiltration tubes with specific sizes (e.g., 30 and 50 kDa) were used for concentration and buffer replacement. The concentrated enzymes were kept at −20°C for enzyme activity measurements, and their concentrations were determined using a bicinchoninic acid (BCA) protein assay kit (Thermo Scientific, USA) with bovine serum albumin (BSA) as the standard.

Hydrolytic activities of OUC-FaGH16A and OUC-FaGH16B toward KC, furcellaran, IC, and LC.

The activities of OUC-FaGH16A and OUC-FaGH16B to hydrolyze KC, furcellaran, LC, and OUC-S1_19B-treated LC were detected using the 3,5-dinitrosalicylic acid (DNS) method (32). In brief, 200 μL of reaction solution was composed of 0.3% (wt/vol) of different types of polysaccharides and 20 μL of pure enzyme (OUC-FaGH16A and OUC-FaGH16B). The reaction mixture was incubated at 40°C and pH 7.0 for 30 min and then boiled for 5 min for enzyme inactivation. Afterward, 300 μL of DNS reagent (Solarbio, China) was added to the solution, boiled immediately for 5 min for color rendering, and then cooled in a cold-water bath. The absorbance was determined at 540 nm, and the inactivated enzyme was used as the control. One unit of enzymatic activity (U) was defined as the amount of enzyme required to obtain 1 μmol of reducing sugar per min.

In addition, the hydrolyses of IC and OUC-S1_19B-treated IC were detected by using the para-hydroxybenzoic acid hydrazide (pHBAH) method (33). A 200-μL reaction solution was composed of 0.3% (wt/vol) IC or OUC-S1_19B-treated IC and 20 μL of pure enzyme (e.g., OUC-FaGH16A and OUC-FaGH16B). The samples were incubated at 40°C and pH 7.0 for 60 min and were then boiled for 5 min for enzyme inactivation. After the reaction, 600 μL of pHBAH (prepared based on our previous research [21]) was added to the 200-μL solution, boiled immediately for 5 min for color rendering, and then cooled in a cold-water bath. The absorbances were determined at 405 nm, and the inactivated enzyme was used as the control.

Determination of the optimum reaction conditions for OUC-FaGH16A and OUC-FaGH16B.

To determine the optimal temperatures for OUC-FaGH16A and OUC-FaGH16B, a 200-μL reaction system containing 0.3% (wt/vol) furcellaran and 20 μL of pure enzyme (e.g., OUC-FaGH16A or OUC-FaGH16B) was used. The reaction solutions were incubated at different temperatures (e.g., 30, 35, 40, 45, 50, and 60°C) at pH 7.0 for 30 min. The same reaction system was used to determine the optimal pH, but the reaction solutions were incubated at 40°C at different pH values (e.g., from 3.0 to 10.0) for 30 min. The concentrations of the released reducing sugars were determined by the DNS method, as described above. Each reaction was performed in triplicate.

Qualitative analysis of the reaction oligosaccharide products was conducted by using HPLC, MS, and LC-MS.

HPLC was performed with a Superdex 30 10/300 gel filtration column (GE Health, Marlborough, MA, USA) equipped with a refractive index detector. The analyses were performed at room temperature using 0.2 M ammonia bicarbonate as the mobile phase at a flow rate of 0.4 mL/min.

MS spectra were obtained using a micrOTOF-Q II instrument (Agilent, USA) in negative mode with an ion spray voltage of 4 kV and a source temperature of 350°C.

LC-MS spectra were obtained using an ultraperformance LC unit (Dionex Ultimate 3000, Thermo Fisher Scientific, USA.) connected to a Q-Exactive Orbitrap MS device (Thermo Fisher Scientific) equipped with an Acquity UPSEC BEH 125 SEC column (4.6 × 150 mm; Waters, Milford, MA, USA). Analysis was conducted at room temperature using 20% (vol/vol) methanol containing 10 mM ammonium acetate as the mobile phase at a flow rate of 0.2 mL/min (34).

Homology modeling and molecular docking.

The three-dimensional structure of OUC-FaGH167A was simulated using SWISS-MODEL (35) by using the crystal structure of BovGH167 (PDB: 6PTM) as a template. The OUC-FaGH167A PDB file was treated with AutoDockTools (36) to output a PDBQT file as the docking receptor. AutoDock Vina (37) was used for docking, and the results with the lowest binding energy were selected out for further analysis and processing by using PyMOL (http://www.pymol.org). VERIFY3D was applied to assess the predicted structure of OUC-FaGH167A (38).

Bioinformatic analysis of CarPULs.

In total, 26 bacteria with CarPUL found in previous research were selected for genomic investigation. The amino acid sequences related to the carrageenan metabolism in F. algicola were used as the alignment templates to find similar proteins, which had at least 30% shared amino acid identity and a 70% coverage threshold from those 26 bacteria. The output results are listed in Table S1. The key gene encoding d-AHGD was used as the core of each CarPUL, and approximately 20 kbp around the d-AHGD coding gene were considered to be located in the CarPUL. Consequently, the CarPUL-related genes in different bacteria could be divided into three conditions, conservation in CarPUL (value 2), conservation elsewhere in the genome (value 1), and absence from the genome (value 0). From the matrix (Table S1), a heat map and a hierarchical cluster analysis of the different CarPULs were performed using OriginPro 2018 with plug-in Heat Map Dendrogram.

Data availability.

The sequence numbers of OUC-FaGH16A, OUC-FaGH16B, OUC-FaGH167A, and OUC-FaGH167B are available in the NCBI database under the accession numbers MCG9793741.1, MCG9793744.1, MCG9793703.1, and MCG9793733.1, respectively.

ACKNOWLEDGMENTS

This work was supported by the National Natural Science Foundation of China (31922072), the Natural Science Foundation of Shandong Province (ZR2020JQ15), the Taishan Scholar Project of Shandong Province (tsqn201812020), and the Fundamental Research Funds for the Central Universities (201941002).

Footnotes

Supplemental material is available online only.

Supplemental file 1
Supplemental material. Download aem.01100-22-s0001.pdf, PDF file, 0.9 MB (918.7KB, pdf)

Contributor Information

Xiangzhao Mao, Email: xzhmao@ouc.edu.cn.

Jennifer B. Glass, Georgia Institute of Technology

REFERENCES

  • 1.Jiao N, Cai R, Zheng Q, Tang K, Liu J, Jiao F, Wallace D, Chen F, Li C, Amann R, Benner R, Azam F. 2018. Unveiling the enigma of refractory carbon in the ocean. Natl Sci Rev 5:459–463. 10.1093/nsr/nwy020. [DOI] [Google Scholar]
  • 2.Smith SV. 1981. Marine macrophytes as a global carbon sink. Science 211:838–840. 10.1126/science.211.4484.838. [DOI] [PubMed] [Google Scholar]
  • 3.Inoue A, Nishiyama R, Ojima T. 2016. The alginate lyases FlAlyA, FlAlyB, FlAlyC, and FlAlex from Flavobacterium sp. UMI-01 have distinct roles in the complete degradation of alginate. Algal Res 19:355–362. 10.1016/j.algal.2016.03.008. [DOI] [Google Scholar]
  • 4.Jagtap SS, Hehemann JH, Polz MF, Lee JK, Zhao H. 2014. Comparative biochemical characterization of three exolytic oligoalginate lyases from Vibrio splendidus reveals complementary substrate scope, temperature, and pH adaptations. Appl Environ Microbiol 80:4207–4214. 10.1128/AEM.01285-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yu S, Yun EJ, Kim DH, Park SY, Kim KH. 2020. Dual agarolytic pathways in a marine bacterium, Vibrio sp. Strain EJY3: molecular and enzymatic verification. Appl Environ Microbiol 86:e02724. 10.1128/AEM.02724-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chi WJ, Chang YK, Hong SK. 2012. Agar degradation by microorganisms and agar-degrading enzymes. Appl Microbiol Biotechnol 94:917–930. 10.1007/s00253-012-4023-2. [DOI] [PubMed] [Google Scholar]
  • 7.Pathiraja D, Christiansen L, Park B, Schultz-Johansen M, Bang G, Stougaard P, Choi IG. 2021. A novel auxiliary agarolytic pathway expands metabolic versatility in the agar-degrading marine bacterium Colwellia echini A3T. Appl Environ Microbiol 87:e0023021. 10.1128/AEM.00230-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ficko-Blean E, Prechoux A, Thomas F, Rochat T, Larocque R, Zhu Y, Stam M, Genicot S, Jam M, Calteau A, Viart B, Ropartz D, Perez-Pascual D, Correc G, Matard-Mann M, Stubbs KA, Rogniaux H, Jeudy A, Barbeyron T, Medigue C, Czjzek M, Vallenet D, McBride MJ, Duchaud E, Michel G. 2017. Carrageenan catabolism is encoded by a complex regulon in marine heterotrophic bacteria. Nat Commun 8:1685. 10.1038/s41467-017-01832-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Schultz-Johansen M, Bech PK, Hennessy RC, Glaring MA, Barbeyron T, Czjzek M, Stougaard P. 2018. A novel enzyme portfolio for red algal polysaccharide degradation in the marine bacterium Paraglaciecola hydrolytica S66T encoded in a sizeable polysaccharide utilization locus. Front Microbiol 9:839–853. 10.3389/fmicb.2018.00839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hettle AG, Hobbs JK, Pluvinage B, Vickers C, Abe KT, Salama-Alber O, McGuire BE, Hehemann JH, Hui JPM, Berrue F, Banskota A, Zhang J, Bottos EM, Van Hamme J, Boraston AB. 2019. Insights into the κ/ι-carrageenan metabolism pathway of some marine Pseudoalteromonas species. Commun Biology 2:474. 10.1038/s42003-019-0721-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Li J, He Z, Liang Y, Peng T, Hu Z. 2022. Insights into algal polysaccharides: a review of their structure, depolymerases, and metabolic pathways. J Agric Food Chem 70:1749–1765. 10.1021/acs.jafc.1c05365. [DOI] [PubMed] [Google Scholar]
  • 12.Azam F, Malfatti F. 2007. Microbial structuring of marine ecosystems. Nat Rev Microbiol 5:782–791. 10.1038/nrmicro1747. [DOI] [PubMed] [Google Scholar]
  • 13.Jiang C, Liu Z, Cheng D, Mao X. 2020. Agarose degradation for utilization: enzymes, pathways, metabolic engineering methods and products. Biotechnol Adv 45:107641. 10.1016/j.biotechadv.2020.107641. [DOI] [PubMed] [Google Scholar]
  • 14.Anderson NS, Dolan TC, Rees DA. 1965. Evidence for a common structural pattern in the polysaccharide sulphates of the Rhodophyceae. Nature 205:1060–1062. 10.1038/2051060a0. [DOI] [PubMed] [Google Scholar]
  • 15.Usov A. 2011. Polysaccharides of the red algae. Adv Carbohydr Chem Biochem 65:115–179. 10.1016/B978-0-12-385520-6.00004-2. [DOI] [PubMed] [Google Scholar]
  • 16.Usov UI. 1998. Structural analysis of red seaweed galactans of agar and carrageenan groups. Food Hydrocolloids 12:301–308. 10.1016/S0268-005X(98)00018-6. [DOI] [Google Scholar]
  • 17.Zhu B, Ni F, Sun Y, Zhu X, Yin H, Yao Z, Du Y. 2018. Insight into carrageenases: major review of sources, category, property, purification method, structure, and applications. Crit Rev Biotechnol 38:1261–1276. [DOI] [PubMed] [Google Scholar]
  • 18.Kalitnik AA, Nedashkovskaya OI, Stenkova AM, Yermak IM, Kukhlevskiy AD. 2018. Carrageenanolytic enzymes from marine bacteria associated with the red alga Tichocarpus crinitus. J Appl Phycol 30:2071–2081. 10.1007/s10811-017-1355-4. [DOI] [Google Scholar]
  • 19.Anastyuk SD, Barabanova AO, Correc G, Nazarenko EL, Davydova VN, Helbert W, Dmitrenok PS, Yermak IM. 2011. Analysis of structural heterogeneity of κ/β-carrageenan oligosaccharides from Tichocarpus crinitus by negative-ion ESI and tandem MALDI mass spectrometry. Carbohydr Polymers 86:546–554. 10.1016/j.carbpol.2011.04.081. [DOI] [Google Scholar]
  • 20.Yang B, Yu G, Zhao X, Ren W, Jiao G, Fang L, Wang Y, Du G, Tiller C, Girouard G, Barrow CJ, Ewart HS, Zhang J. 2011. Structural characterisation and bioactivities of hybrid carrageenan-like sulphated galactan from red alga Furcellaria lumbricalis. Food Chem 124:50–57. 10.1016/j.foodchem.2010.05.102. [DOI] [Google Scholar]
  • 21.Jiang C, Jiang H, Zhang T, Lu Z, Mao X. 2022. Enzymatic verification and comparative analysis of carrageenan metabolism pathways in marine bacterium Flavobacterium algicola. Appl Environ Microbiol 88:e00256-22. 10.1128/aem.00256-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Christiansen L, Pathiraja D, Bech PK, Schultz-Johansen M, Hennessy R, Teze D, Choi I-G, Stougaard P. 2020. A multifunctional polysaccharide utilization gene cluster in Colwellia echini encodes enzymes for the complete degradation of κ-carrageenan, ι-carrageenan, and hybrid β/κ-carrageenan. mSphere 5:e00792-19. 10.1128/mSphere.00792-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lombard V, Golaconda Ramulu H, Drula E, Coutinho PM, Henrissat B. 2014. The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res 42:D490–D495. 10.1093/nar/gkt1178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Barbeyron T, Michel G, Potin P, Henrissat B, Kloareg B. 2000. iota-Carrageenases constitute a novel family of glycoside hydrolases, unrelated to that of kappa-carrageenases. J Biol Chem 275:35499–35505. 10.1074/jbc.M003404200. [DOI] [PubMed] [Google Scholar]
  • 25.Rebuffet E, Barbeyron T, Jeudy A, Jam M, Czjzek M, Michel G. 2010. Identification of catalytic residues and mechanistic analysis of family GH82 iota-carrageenases. Biochemistry 49:7590–7599. 10.1021/bi1003475. [DOI] [PubMed] [Google Scholar]
  • 26.Cao S, Zhang Y, Chen G, Shen J, Han J, Chang Y, Xiao H, Xue C. 2021. Cloning, heterologous expression, and characterization of a βκ-carrageenase from marine bacterium Wenyingzhuangia funcanilytica: a specific enzyme for the hybrid carrageenan-furcellaran. Front Microbiol 12:697218. 10.3389/fmicb.2021.697218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Tsirigos KD, Peters C, Shu N, Kall L, Elofsson A. 2015. The TOPCONS web server for consensus prediction of membrane protein topology and signal peptides. Nucleic Acids Res 43:W401–W407. 10.1093/nar/gkv485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Terrapon N, Lombard V, Drula E, Lapebie P, Al-Masaudi S, Gilbert HJ, Henrissat B. 2018. PULDB: the expanded database of Polysaccharide Utilization Loci. Nucleic Acids Res 46:D677–D683. 10.1093/nar/gkx1022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Reher M, Fuhrer T, Bott M, Schönheit P. 2010. The nonphosphorylative Entner-Doudoroff pathway in the thermoacidophilic euryarchaeon Picrophilus torridus involves a novel 2-keto-3-deoxygluconate- specific aldolase. J Bacteriol 192:964–974. 10.1128/JB.01281-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Buchfink B, Xie C, Huson DH. 2015. Fast and sensitive protein alignment using DIAMOND. Nat Methods 12:59–60. 10.1038/nmeth.3176. [DOI] [PubMed] [Google Scholar]
  • 31.Hettle AG, Vickers C, Robb CS, Liu F, Withers SG, Hehemann JH, Boraston AB. 2018. The molecular basis of polysaccharide sulfatase activity and a nomenclature for catalytic subsites in this class of enzyme. Structure 26:747–758.e4. 10.1016/j.str.2018.03.012. [DOI] [PubMed] [Google Scholar]
  • 32.Miller GL. 1959. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 31:426–428. 10.1021/ac60147a030. [DOI] [Google Scholar]
  • 33.Shen J, Chang Y, Dong S, Chen F. 2017. Cloning, expression and characterization of a ι-carrageenase from marine bacterium Wenyingzhuangia fucanilytica: a biocatalyst for producing ι-carrageenan oligosaccharides. J Biotechnol 259:103–109. 10.1016/j.jbiotec.2017.07.034. [DOI] [PubMed] [Google Scholar]
  • 34.Zhang Y, Chang Y, Shen J, Mei X, Xue C. 2020. Characterization of a novel porphyranase accommodating methyl-galactoses at its subsites. J Agric Food Chem 68:7032–7039. 10.1021/acs.jafc.0c02404. [DOI] [PubMed] [Google Scholar]
  • 35.Arnold K, Bordoli L, Kopp J, Schwede T. 2006. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22:195–201. 10.1093/bioinformatics/bti770. [DOI] [PubMed] [Google Scholar]
  • 36.Morris GM, Huey R, Lindstrom W, Sanner MF, Belew RK, Goodsell DS, Olson AJ. 2009. AutoDock4 and AutoDockTools4: automated docking with selective receptor flexibility. J Comput Chem 30:2785–2791. 10.1002/jcc.21256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Trott O, Olson AJ. 2010. AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem 31:455–461. 10.1002/jcc.21334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.David E, Roland L, Bowie JU. 1997. VERIFY3D: assessment of protein models with three-dimensional profiles. Methods Enzymol 277:396–404. 10.1016/S0076-6879(97)77022-8. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

Supplemental material. Download aem.01100-22-s0001.pdf, PDF file, 0.9 MB (918.7KB, pdf)

Data Availability Statement

The sequence numbers of OUC-FaGH16A, OUC-FaGH16B, OUC-FaGH167A, and OUC-FaGH167B are available in the NCBI database under the accession numbers MCG9793741.1, MCG9793744.1, MCG9793703.1, and MCG9793733.1, respectively.

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES