High-Throughput Detection of Ligand-Protein Binding using a SplitLuc Cellular Thermal Shift Assay

Abstract

The confirmation of a small molecule binding to a protein target can be challenging when switching from biochemical assays to physiologically relevant cellular models. The cellular thermal shift assay (CETSA) is one approach to validate ligand-protein binding in a cellular environment by examining a protein’s melting profile which can shift to a higher or lower temperature when bound by a small molecule. Traditional CETSA uses SDS-PAGE and Western blotting to quantify protein levels, a process that is both time consuming and low throughput when screening multiple compounds and concentrations. Herein, we outline the reagents and methods to implement split Nano Luciferase (SplitLuc) CETSA, a reporter-based target engagement assay designed for high-throughput screening in 384- or 1536-well plate formats.

1. Introduction

Drug discovery often relies on the confirmed interaction between small molecules and their proposed target protein. However, the failure of many lead compounds relates to poor physicochemical and pharmacokinetic properties that are associated with the native cellular environment (1). Ligand-target engagement in a cellular environment can be confirmed using a cellular thermal shift assay (CETSA) that reports quantifiable changes in the thermal stability of a target protein when bound by a small molecule (2). In a conventional CETSA, cells are incubated with a vehicle control or test compound (putative ligand) and heated at different temperatures, followed by Western blotting to examine thermal stability of the protein of interest (3). The premise is that high affinity compounds that access and bind to the target protein in a cellular environment can alter protein folding thermodynamics resulting in a shift in thermal stability (Fig. 1).

Figure 1:

Traditional CETSA using Western blot. HEK293T cells were treated for 1 hour with 10 μM LDHA inhibitor (530) and soluble protein was detected by immunoblot. SOD1 was used as a thermally stable loading control. (B) Densitometry of immunoblots (mean, N=2 per condition).

Although a standardized CETSA protocol using monoclonal antibodies to the target protein can show ligand-target engagement, the Western blotting procedure is laborious and slow. Pre-clinical drug discovery efforts would greatly benefit from high throughput CETSA screening platforms to identify lead molecules or evaluate structure-activity relationships between hundreds of analogues during lead optimization (4). Towards this goal, we have developed a split Nano luciferase (SplitLuc) CETSA platform to directly assess target engagement in a cellular environment (5,6), a method that can be utilized to rapidly interrogate the binding of thousands of compounds to a target protein (Fig. 2). SplitLuc CETSA employs a transient expression of the target of interest (TOI) fused to a 15 amino acid NanoLuc fragment, referred to as 86b (Gly-Ser-HiBiT-Gly-Ser). After 24 hours, cells incubated with small molecule ligands are heated, lysed, and analyzed for luminescence using a complementary NanoLuc enzyme fragment to detect binding-induced thermal shifts.

Figure 2:

(A) Schematic depicting LDHA-SplitLuc CETSA approach. 86b (HiBiT colored in red, with Gly-Ser amino acids on both ends) is appended to TOI and luminescence is detected after the addition of 11S and furimazine. (B) At high temperatures, complementation does not occur as protein unfolds and the peptide tag becomes buried within aggregates (composed of many cellular proteins). Centrifugation is not required. (C) Example of temperature-response profile for SplitLuc CETSA. LDHA-86b transfected cells were treated with DMSO or 10 μM LDHA inhibitor for 1 hour. Cells were heated for 3.5 minutes to the indicated temperatures and soluble protein assessed using the SplitLuc CETSA approach (mean, N=4). (D) Example of an isothermal 1536-well SplitLuc CETSA assay. Unheated (top) and heated (bottom) plates are shown. Cells were treated with small molecule inhibitors in a dose-response for 1 hour before performing the SplitLuc CETSA. (E) Example of dose-dependent stabilization for TOI, as depicted in panel D.

Newer trends in small molecule drug discovery are moving beyond traditional targeting of protein active sites to also pursue allosteric binding sites or degradation-targeting strategies (7-9). The high-throughput CETSA protocol outlined below provides a unique and widely applicable approach to identify small molecule binders that have a high affinity for their target protein regardless of whether the binding event alters enzymatic activity. Small molecules identified in SplitLuc CETSA could provide starting points for developing proteolysis targeting chimeras (PROTACs) that degrade a protein target and contribute to unlocking a new set of “druggable” features of proteins (10). We expect the growing field of protein degradation strategies, which also includes lysosomal (LYTAC), autophagy (AUTAC) and endosomal (ENDTAC) targeting chimeras, will greatly benefit from high throughput CETSA platforms, and these technologies will expand the druggable genome and offer new opportunities for drug discovery (11-13).

2. Materials

Store materials at room temperature unless otherwise specified.

2.1. SDS PAGE and Western Blotting

1. 4-12% Bis-Tris polyacrylamide gel: store at 4 °C

2. 20X SDS-PAGE buffer: 50 mM MOPS, 50 mM Tris Base, 0.1% SDS, 1 mM EDTA, pH 7.7

3. Electrophoresis apparatus

4. 4X loading buffer: 240 mM Tris-HCl, pH 6.8, 8% SDS, 40% Glycerol, 5% beta-mercaptoethanol, 0.04% bromophenol blue

5. Molecular weight protein ladder

6. PVDF membrane (e.g. iBlot stack)

7. Transfer apparatus (e.g. iBlot2)

8. Tris Buffered Saline (TBS): 50 mM Tris-Cl, pH 7.5, 150 mM NaCl

9. Wash buffer: TBS with 0.05% tween- 20 (TBS-T)

10. Blocking Buffer: 5% milk in TBS-T, store at 4 °C

11. Monoclonal primary antibody: store according to manufacturer’s instructions (e.g. −20 °C)

12. Secondary antibody: store according to manufacturer’s instructions (e.g. at −20 °C)

13. Enhanced Chemiluminescence (ECL)

14. Western blot imager (e.g. ChemiDoc, Typhoon, LiCor)

2.2. Compounds

1. DMSO

2. Small molecules: compounds dissolved in DMSO at 10 mM, store stock solutions at −20 °C

2.3. Constructing the SplitLuc CETSA Acceptor Plasmids

1. pcDNA3.1(+) acceptor plasmid

2. 86b (Gly-Ser-HiBiT-Gly-Ser) insert sequence to create N-terminal acceptor plasmid, with overlap to NheI/EcoRI linearized pcDNA3.1 (See Fig. 3): ACCCAAGCTGGCTAGCCACCATGGGCAGCGTGAGTGGCTGGCGACTGTTCAAGAAG ATCAGCGGATCCAACTAACAATAGCGTTATCGAATTCTGCAGATAT. Use complementary oligonucleotides to create double-stranded DNA.

Figure 3:

Schematic for SplitLuc Acceptor plasmid design. This plasmid facilitates cloning of TOIs, with N- or C-terminal reporter tag.

3. 86b (Gly-Ser-HiBiT-Gly-Ser) insert sequence to create C-terminal acceptor plasmid, with overlap to NheI/EcoRI linearized pcDNA3.1 (See Fig. 3): ACCCAAGCTGGCTAGCAACTAACGGATCCGTGAGTGGCTGGCGACTGTTCAAGAAG ATCAGCGGCAGCTAAGGCGCGCCGAATTCTGCAGATAT. Use complementary oligonucleotides to create double-stranded DNA.

4. NheI: store at −20 °C

5. EcoRI: store at −20 °C

6. 1% agarose gel with SYBR-Safe stain (or other DNA stain)

7. Agarose gel electrophoresis apparatus

8. Gel extraction spin columns (e.g. Qiagen, Machery-Nagel)

9. 10X Annealing buffer for oligonucleotides: 10 mM Tris HCl, pH 8, 500 mM NaCl, 10 mM EDTA, store at −20 °C

10. In-Fusion HD EcoDry Cloning reaction kit: once package is opened, store in desiccator

11. Stellar competent cells: store at −80 °C and do not allow to thaw prior to use

12. SOC medium: 0.5% yeast extract, 2% tryptone, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl₂, 10 mM MgSO₄. Autoclave the solution then add 20 mM glucose when cool. Filter the solution to sterilize

13. Transformation enhancing buffer: 5 mM Tris-HCl, pH 8.5

14. LB agar plates: Autoclave LB agar (1% tryptone, 0.5% yeast extract, 1% sodium chloride, 1.5% agar), once cool, add 100 μg/mL carbenicillin, pour plates, store at 4 °C

15. Round bottom culture tubes with loose fitting caps

16. LB broth: 1% tryptone, 0.5% yeast extract, 1% sodium chloride

17. Sterile spreaders or loops

18. Miniprep kit

19. Spectrophotometer for DNA quantification (e.g. NanoDrop)

20. pcDNA3.1 forward sequencing primer: GGCTAACTAGAGAACCCACTG

21. pcDNA3.1 reverse sequencing primer: GGCAACTAGAAGGCACAGTC

2.4. Cloning TOI into the SplitLuc CETSA Plasmid

1. BamHI: store at −20 °C

2. Linearized SplitLuc CETSA acceptor plasmid

3. PCR primers for TOI (with N-terminal 86b tag)

Forward: 5’-GAAGATCAGCGGATCC [sequence of TOI, starting with ATG]-3’

Reverse: 5’-ATATCTGCAGAATTC [reverse complement to TOI end, include STOP codon]-3’

4. PCR primers for TOI (with C-terminal 86b tag)

Forward: 5’-ACCCAAGCTGGCTAGCACC [sequence TOI, starting with ATG]-3’

Reverse: 5’-AGCCACTCACGGATCC [reverse complement to TOI end, NO STOP codon]-3’

5. High Fidelity Taq polymerase

6. Sequencing primers for TOI (internal to gene for large genes)

2.5. Cell Culture and Transfection

1. HEK293T cells (ATCC #CRL3216)

2. Culture medium: DMEM, 4.5 g/L glucose, 6 mM L-glutamine, 1 mM sodium pyruvate. 10% fetal bovine serum (FBS), 100 units/mL penicillin, 100 μg/mL streptomycin, store at 4°C

3. 0.25% Trypsin/EDTA: store at 4°C

4. Tissue culture-treated flasks and 6-well plates

5. Tissue culture incubator: 37 °C, 95% humidity, 5% CO₂

6. Transfection culture medium: phenol red-free DMEM, 4.5 g/L glucose, 6 mM L-glutamine, 10% FBS, store at 4°C

7. OptiMEM

8. Lipofectamine 2000: store at 4 °C

9. 0.3 μg of plasmid DNA per cm² of tissue culture container, store at 4 °C

10. 1X Phosphate Buffer Saline without magnesium chloride and calcium chloride (PBS)

11. 0.25% phenol red-free trypsin/EDTA: store at 4 °C

2.6. CETSA and SplitLuc CETSA

1. Gradient capable 96-well or 384-well thermocycler

2. PCR tubes

3. Refrigerated centrifuge with PCR tube rotor

4. CETSA assay buffer: phenol red-free DMEM, 4.5 g/L glucose, 6 mM L-glutamine, store at 4 °C

5. 6X lysis buffer: NP-40 diluted in deionized water to 6%, 6X protease inhibitor

6. Furimazine, store stock at −20 °C

7. Recombinant 11S Nano luciferase fragment: store at −80 °C

8. 2X complementation reagent: 2X furimazine, 200 nM recombinant 11S Nano luciferase fragment diluted in CETSA assay buffer

9. White cyclic olefin polymer 1536-well plates

10. Plate reader equipped for luminescence detection (e.g. ViewLux, Envision, PHERAstar)

2.7. Metal Blocks and Heating Platform for Conductive Heat Transfer (Fig. S1)

1. Copper heat block (110 purity level copper sheet and rod) machined to fit the bottom of a standard 1536-well assay plate

2. Adhesive-back polyamide film sheet heater

3. Adhesive-back silicone foam bumpers

4. Stainless steel threaded rod and threaded knobs

5. High temperature silicone foam sheet with smooth texture cut to the dimensions of heat block

6. Copper or aluminum clamping plate cover with same dimensions as heat block

7. Thermocouple probe

8. Programmable temperature controller and medium current relay

9. Polycarbonate washdown enclosure with knockouts

10. Adapter cord and power cord

2.8. Counterscreens

1. 86b peptide (GSVSGWRLFKKISGS) dissolved in ultrapure water to 1 mM. Store at −80 °C

2. HEK293T cell lysate

3. Methods

Carry out all procedures at room temperature unless otherwise specified.

3.1. Traditional CETSA using Western Blot Electrophoresis to Assess the Melting Profile of the TOI

1. Seed 5 million HEK293T cells in a T75 flask using prewarmed tissue culture medium and grow for 48 hours at 37 °C, 5% CO₂, 95% RH. Harvest by aspirating the medium, rinse with 5 mL of 1X PBS, and incubate with 1 – 3 mL of 0.25% Trypsin/EDTA for 5 minutes in a 37 °C tissue culture incubator. Quench trypsinized cells with 2 – 6 mL of warm tissue culture medium and spin for 5 minutes at 500 x g. Remove supernatant and resuspend the pellet in DMEM (no serum) final concentration of 10 million cells/mL (see Note 1).

2. Add 1 – 3 μL of DMSO to 1 mL of cell suspension and incubate at 37 °C for 1 hour. For TOIs where a positive control compound is available, add 1 – 3 μL of 10 mM compound to 1 mL the cell suspension (10 - 30 μM final concentration) and incubate at 37 °C for 1 hour (see Note 2).

3. Aliquot 50 μL of cells into 12 (DMSO) or 24 (DMSO + positive control) PCR tubes to match the different heating temperatures. Mount the PCR tubes in a gradient capable thermocycler and heat for 3 minutes – in pairs if incubated with compound – at temperatures ranging from 37 – 81 °C in 4 °C increments (see Notes 3 - 5).

4. After heating, allow the PCR tubes to cool to room temperature for 3 minutes. Add lysis buffer to each tube (6% NP40 and 6X protease inhibitor cocktail, to a final concentration of 1% and 1X, respectively). Mix well by pipetting up and down and incubate for 30 minutes. Spin samples for 10 minutes at 15,000 x g in a refrigerated centrifuge set at 4 °C. Place the centrifuged tubes on ice and transfer the clarified lysate into separate tubes for loading onto a PAGE gel.

5. To 15 μL of the clarified lysate, add 5 μL of 4X loading buffer and mix by pipetting up and down. Load a molecular weight protein ladder and 20 μL of the samples onto a 15-well 4-12% Bis-Tris PAGE gel. Fill the electrophoresis chamber with SDS-PAGE running buffer and run until proteins are separated (see Note 6).

6. Transfer the gel to a PVDF or nitrocellulose membrane (e.g. for 7 minutes at 25 Volts using an iBlot dry transfer system). Next, block the membrane with blocking buffer for 1 hour. The membrane is then incubated with a monoclonal antibody specific to your TOI according to manufacturer’s recommendations (Note 7).

7. The next day, the membrane is washed 3 times by rocking with TBS-T for 10 minutes. After washing, incubate the membrane with a secondary antibody for 1 hour on a rocking platform. The membrane is subsequently washed 3 more times by rocking with TBS-T for 10 minutes each wash (Note 8).

8. After washing, the TOI expression is visualized using chemiluminescence or fluorescence readers, depending on the secondary antibody selected. The resulting image is analyzed for a thermal melt profile. Plot the temperature response profile for DMSO and control-treated samples, combining technical replicates (mean +/− SD), and calculate the T_agg, which is defined as the temperature at which a reduction of 50% signal (soluble protein) is observed.

3.2. Creating a SplitLuc “Acceptor” Plasmid for Rapid Cloning of SplitLuc Fusion Proteins

1. “Acceptor” plasmids can be constructed to facilitate the cloning of multiple and different TOIs with the SplitLuc 86b fragment appended to the N- or C-terminus (see Fig. 3, Note 9).

2. Anneal two complementary oligonucleotides to construct a double stranded 86b DNA fragment for insertion into the backbone pcDNA3.1 plasmid (N-terminal or C-terminal versions). Combine 5 μL of 100 μM forward oligonucleotide (Fig. 3), 5 μL of 100 μM reverse complement oligonucleotide, 5 μL of 10X annealing buffer and 35 μL of sterile water.

3. Bring 400 mL of water to a boil in a beaker on a hot plate. Place the tube of annealing oligonucleotide mix in the boiling water and incubate for 2 minutes, then turn off the hot plate and allow everything to equilibrate to room temperature. Move tubes to an ice bucket and store at −20 °C until ready for use.

4. Cut 2 μg of pcDNA3.1(+) plasmid by incubating 10U of NheI and 10U of EcoRI in a 50 μL reaction volume for 1 hour at 37 °C. Load the digested plasmid product, across multiple wells, and an uncut plasmid control onto a 1% agarose gel and separate by electrophoresis. Cut out the band of the large linearized plasmid (5.3 kb) and perform a gel extraction using a spin column, according to the manufacturer’s protocol (see Note 10).

5. Combine 30 fmol of the 86b-containing DNA fragments from step 3 (N-terminal or C-terminal) and 15 fmol of the linearized backbone plasmid from step 4 in a total volume of 10 μL in water. Also prepare a control reaction with 15 fmol of linearized backbone alone in a total volume of 10 μL in water. Add the mixtures to separate In-Fusion EcoDry lyophilized enzyme pellets for ligation. Incubate the mixture at 37 °C for 15 minutes and then at 50 °C for 15 minutes. Place on ice.

6. Add 35 μL of transformation enhancing buffer to the sample and pipet up and down on ice. Next, transform 50 μL of Stellar Competent bacterial cells by adding 1 – 4 μL of the mixture and incubate for 30 minutes on ice (see Note 11).

7. Heat shock the sample in a 1.5 mL microcentrifuge tube for exactly 60 seconds at 42 °C in a water bath and then place the tube on ice for 2 minutes. Add 450 μL of SOC medium and shake the bacterial sample at 300 rpm for 1 hour at 37 °C in a mini shaker.

8. During the 1-hour incubation, prewarm LB agar plates that have 100 μg/mL carbenicillin antibiotic in a 37 °C incubator. Spread 100 μL of bacteria on a pre-warmed LB agar plate with carbenicillin using a sterile cell spreader. Incubate for 1 minute to allow agar to soak up bacteria and incubate plate upside-down in a 37 °C incubator overnight (see Note 12).

9. On the next day, ensure the transformed negative control has substantially fewer colonies compared to the In-Fused 86b-containing backbone. Select single colonies with a sterile pipet tip and inoculate 2 mL of LB broth with carbenicillin at 100 μg/mL final concentration) in a mini culture tube. Grow the mini cultures overnight at 200 rpm in a 37 °C incubator (see Note 13).

10. Perform a mini prep according to the manufacturer’s protocol to isolate the plasmid DNA. Calculate the concentration of the isolated DNA plasmid using a spectrophotometer. Sequence the sample using pcDNA3.1 forward and reverse sequencing primers to identify the correct acceptor plasmid clones.

11. Prepare a larger scale DNA preparation (e.g. midi or maxi) of the confirmed acceptor clones.

3.3. Cloning the TOI into a SplitLuc “Acceptor” Plasmid

1. The TOI gene to be inserted into the SplitLuc “acceptor” plasmid can be produced by DNA synthesis (e.g. gene strand) or PCR amplification (see Fig. 4, Note 14).

Figure 4:

Schematic for cloning TOIs into SplitLuc acceptor plasmid. (A) N-terminal design. (B) C-terminal design.

2. To linearize the N-terminal SplitLuc acceptor plasmid (from step 3.2.11), add 10U of BamHI and 10U of EcoRI to 2 μg of plasmid in 50 μl of total volume and incubate for 1 hour at 37 °C. To linearize the C-terminal SplitLuc acceptor plasmid (from step 3.2.11), add 10U of NheI and 10U of BamHI to 2 μg of plasmid and incubate for 1 hour at 37 °C (Fig. 3).

3. Load the digested plasmid products and an uncut plasmid control onto a 1% agarose gel and separate by electrophoresis. Cut out the band of the large linearized plasmid and perform a gel extraction and DNA purification according to the manufacturer’s protocol (see Note 10).

4. Mix 30 fmol of the target gene insert (gene strand or PCR amplicon) and 15 fmol of the linearized SplitLuc backbone plasmid from steps 1 and 3 in a total volume of 10 μL in water. Add the 10 μL to an EcoDry pellet of lyophilized enzyme for ligation. Incubate at 37 °C for 15 minutes and then at 50 °C for 15 minutes. Place on ice (see Notes 15).

5. Add 35 μL of transformation enhancing buffer to the sample and pipet up and down on ice. Next, perform a bacterial transformation, colony selection and mini prep of the new TOI-SplitLuc DNA plasmid as described above in 3.2 steps 4 – 10.

6. Calculate the concentration of the isolated DNA using a spectrophotometer. Send the sample for sequencing using forward and reverse sequencing primers to identify the correct clones (see Note 16).

7. Perform a larger scale endotoxin-free DNA purification (e.g. midi or maxi) of sequence verified clones.

3.4. Transfection of HEK293T Cells for Validation of TOI-SplitLuc Expression

1. After confirming the correct sequence of the TOI and SplitLuc tag, transfect HEK293T cells with the newly constructed plasmid. For transfections done in a 6-well plate format, pre-incubate 3 μg of plasmid DNA in 150 μL of OptiMEM media in a 1.5 mL microcentrifuge tube and 6 μl of Lipofectamine 2000 with 150 μL of OptiMEM in a separate 1.5 mL tube for 5 minutes. Combine the two tubes and incubate for 20 minutes (see Note 17).

2. Seed 1 mL of 1 – 2 million HEK293T cells per well in a 6-well plate with transfection culture media. Carefully add ~300 μL of Lipofectamine-DNA complex in OptiMEM from step 1 to each well. Incubate the 6-well plate in a 37 °C incubator for 24 – 48 hours (see Note 18).

3. After transfection, remove supernatant and add 1 mL of 0.25% phenol red-free trypsin per well and incubate for 5 minutes in the 37 °C incubator. Quench the trypsin in each well by adding 2 mL of transfection culture media and spin at 500 x g for 5 minutes. Discard the supernatant and homogeneously resuspend the cell pellet to 1 million cells/mL in CETSA assay buffer (see Notes 19 and 20).

4. Transfer 30 μL of the resuspended cell sample to a PCR tube and add 6 μL of 6X lysis buffer. Incubate for 30 minutes.

5. Samples can be transferred to a new plate before performing a luciferase complementation assay. For example, aliquot 10 μL of each sample into a 384-well low volume white plate in triplicate. Add 10 μl of the complementation reagent (100 nM 11S luciferase fragment and 1X furimazine final concentration, diluted in CETSA assay buffer). Spin the plate at 300 x g for 5 seconds and read on a plate reader equipped with luminescence detection (see Note 21, 22).

3.5. Low-Throughput SplitLuc CETSA (PCR tube or 96-well plate)

1. Into a 1.5 mL microcentrifuge tube, incubate 1 mL of resuspended cells from 3.4.2 with a control compound ligand or matching vehicle control for 1 hour at 37 °C (see Note 4).

2. After 1 hour, aliquot 30 μL of transfected cells from each 1.5 mL tube into PCR tubes or plates compatible with a 96 well block. Mount the PCR tubes from each condition (compound or DMSO control) onto a PCR thermocycler and heat tube separately for 3 minutes using a linear gradient from 37 – 88 °C in 3 °C increments. (see Notes 5, 23).

3. After heating, let the PCR tubes cool to room temperature for 3 minutes. Add 6 μL of 6X lysis buffer, mix well by pipetting up and down and incubate for 30 minutes. If heating is performed in a white PCR plate, add 36 μL of 2X complementation reagent directly to plate. Alternatively, transfer equivalent volume of samples from PCR tubes to white 96- or 384- well plates. For example, transfer 10 μL of the supernatant into a white 384-well plate (technical replicates of 10 μL each from each sample can be added).

4. Spin the plate gently at 300 x g for 5 seconds. Add 10 μL of 2X complementation reagent. Spin the plate again at 300 x g for 5 seconds. Read on a plate reader equipped with luminescence detection (see Note 21).

5. Plot the temperature response profile of DMSO and control-treated samples, combining technical replicates (mean +/− SD), and calculate T_agg. A temperature response profile describing 70 – 80% decrease in luminescent signal is also calculated (see Note 24).

3.6. High-Throughput SplitLuc CETSA (384-Well Format)

1. Following the same protocol in 3.4, transfect 10 – 20 million HEK293T cells in 10 mL of transfection culture media in a T75 flask using 45 μL lipofectamine in 500 μL of OptiMEM complexed with 22.5 μg of plasmid DNA (SplitLuc TOI) in 500 μL of OptiMEM. Scale accordingly if more cells are needed.

2. After 24 – 48 hours, aliquot 10 μL of transfected cells resuspended in CETSA assay buffer into each well of a white 384-well PCR plate (see Notes 25 and 26). Then add DMSO controls or desired compound concentrations and incubate for 1 hour at 37 °C.

3. Seal plate with optical film and heat in a PCR block for 3 minutes at a temperature that corresponds to 70 – 80% decrease of signal observed in 3.5. (see Notes 23, 27 - 30).

4. Let the plate cool to room temperature for 10 minutes. Add 2 μL of 6X lysis buffer to the 384-well plate. Spin the plate at 300 x g for 5 seconds and incubate for 30 minutes. Next, add 12 μL / well of 2X complementation reagent to the 384-well plate.

5. Spin the plate at 300 x g for 5 seconds and read on a plate reader equipped for luminescence (see Note 23).

3.7. High-Throughput SplitLuc CETSA (1536-Well Format)

1. Assay can be performed using adherent or suspension cells. For suspension, aliquot 5 μL/well of transfected cells (2x10⁵ – 1x10⁶ cells per mL) resuspended in CETSA assay buffer from protocol in 3.4 into a white, 1536-well plate using a Multidrop Combi Reagent dispenser. Immediately proceed with step 2. For adherent cells, add 5 μL of cells (1000 – 2000 cells) into a white, 1536-well plate and incubate overnight.

2. Optimize the melting conditions for 1536-well format (see Note 31). For optimization, cells can be scattered across the plate (e.g. plate cells in one out of every four columns) to confirm even melting across the plate, while saving reagents. Optimize temperature by incubating the 1536-well plates on a copper block set to temperatures that bracket the previously observed melting T_agg of the TOI (see Note 27). Incubation time (e.g. 6, 9, or 12 minutes) should also be optimized for each TOI. When available, include a positive control compound in the optimization experiments to track thermal stabilization under the different conditions and guide selection of assay conditions for subsequent experiments. Target a temperature and time that corresponds to 50 – 75% melt and decrease of luminescent signal. Calculate Z’ factors using heated and unheated samples (or compound treated if available). Select conditions that provide the most robust assay performance.

3. Before heating plates, seal with optical film or foil seal, place plate on a copper heat block and immediately apply even top pressure. Alternatively, float the plate in a water bath set to the desired temperature (see Notes 27 - 32).

4. Let the plate cool to room temperature for 10 minutes. Add 1 μL/well of 6X lysis buffer to the 1536-well plate using a Multidrop Combi dispenser. Spin the plate at 300 x g for 5 seconds and incubate for 30 minutes at room temperature. Next add 3 μL of complementation reagent (300 nM 11S and 3X furimazine, for a final concentration of 100 nM and 1X, respectively).

5. Spin the plate at 300 x g for 5 seconds and read on a plate reader equipped for luminescence (see Note 21).

6. High-throughput CETSA experiments with hundreds or thousands of compounds can be performed as described in steps 3.7.1 – 3.7.5, by adding compounds for 1 – 2 hours before heating samples.

3.8. Counterscreens, Data Analysis, and Confirmation

1. For screening, include an unheated (37 °C) control plate treated with compounds (under identical conditions used for the heated plate) to identify assay artifacts, including compounds that affect SplitLuc activity or complementation (see Note 29).

2. A decrease/increase in signal observed for samples in the unheated plate, however, should be interpreted with caution, as small molecule induced stabilization/destabilization of protein under physiologic temperature (and corresponding increase/decrease in luminescent signal) is consequence of bona fide target engagement in some circumstances.

3. For compounds that show activity in the unheated plate, potential spurious effects on SplitLuc can be confirmed by testing SplitLuc components independent of the TOI. To perform this assay, first create HEK293T lysate (untransfected) using cell density that matches the high-throughput CETSA conditions. Then, spike in 86b peptide at 200 nM final concentration, add compounds at the desired concentration and incubate for 30 minutes. Next, add complementation reagent and measure luminescence. Activity in this assay indicates the compound is altering the reporter components, rather than the TOI.

4. To analyze the high-throughput CETSA data, first normalize every well from the heated plate using the corresponding well from the unheated plate (Value[heated]/Value[unheated]). The normalized data for the DMSO control wells will represent the percent melting that was achieved in the experiment, and this should match expectations before proceeding with further analysis. Calculate the mean and standard deviation for the DMSO samples. Compare the treated samples with DMSO to identify compound-induced stabilization or destabilization. Compounds that pass a threshold (mean melting for vehicle +/− 3SD) are selected for follow-up confirmation (see Note 29).

5. Cherry pick compounds and re-test (replicates or dose-response), following steps outlined above, to confirm TOI stabilization.

4. Notes

1. HEK293T cells are used as the default cell line because of their ease of growth and high transfection efficiency. Cells are used between passage 10 – 20, for consistency in transfection and cell growth. Other transfectable cell lines can be substituted. For some targets, melt profiles and target engagement will not be identical between cell lines (post-translational modification, protein-protein interactions, etc.). Cell lines that are relevant to the biology under investigation should be considered.

2. For TOIs where a positive control compound is available, use a concentration where maximal activity was observed in a cellular environment. If only biochemical data is available, then begin with a concentration around 30 μM if solubility and cytotoxicity are not an issue.

3. The rationale for making a SplitLuc construct is to show target engagement and thermal stabilization. Thus, before constructing a SplitLuc plasmid, its ideal to first identify the melting profile of the endogenous target protein and confirm compound-induced thermal shift with a control compound known to engage the target. Compound binding to a target does not always translate to thermal shift, and therefore all CETSA formats are prone to false negatives.

4. When incubating compounds and DMSO vehicle control with cells, use matched concentrations of < 1% final volume of DMSO to avoid cytotoxicity.

5. The incremental 4 °C temperatures spanning from 37 – 81 °C will capture the T_agg for most of the proteome (Fig. 5). After identifying the initial melting profile, a follow-up experiment should be done with 1 – 3 °C changes in temperature near the anticipated T_agg.

Figure 5:

Thermal melt of the proteome in HEK293T cells. Total soluble proteins were separated on a polyacrylamide gel and stained using Coomassie blue after 3 minutes of heating to the indicated temperatures.

6. When using a compound for a traditional Western blotting CETSA experiment, run DMSO- and compound-incubated samples for each temperature side-by-side. This layout will maintain identical experimental conditions and reduce the likelihood of confounding data interpretation due to position-related variation in the immunoblot.

7. Antibody specificity is important for assessing target engagement using CETSA. Confirm antibody specificity for the TOI in the cell line and compare side-by-side with an siRNA transient knockdown or knockout cell line.

8. Excess washing will remove your primary antibody and decrease final signal, while reducing the washing runs the risk of having “dirty” blots.

9. Placement of the SplitLuc tag on the N- or C-terminus depends on the target protein. For instance, appending an N-terminal tag onto proteins that enter the secretory pathway will mask the signal peptide. When structural information is available, tags should be placed to minimize the potential of interference with the target protein’s active site or allosteric compound binding site of interest. Testing both N- and C-terminal constructs and an empirical determination of optimal placement is typically warranted.

10. When visualizing and cutting agarose band of plasmid DNA, minimize exposure to UV light to avoid DNA damage that reduces successful subcloning; use blue light if possible. If using UV transilluminator, wear appropriate personal protective equipment.

11. We have observed improved transformation efficiency by diluting the In-Fusion reaction with 5 mM Tris-HCl, pH 8.5 (transformation enhancing buffer). Include a negative control by performing an In-Fusion reaction with 15 fmol of linearized acceptor plasmid without the 86b insert and transforming Stellar competent bacterial cells. Other high-efficiency chemically or electrically competent cells could be substituted for the transformation.

12. Carbenicillin is a more stable analogue to ampicillin that can be used in place of ampicillin. Spreading of the bacteria on LB agar plates should be done in a sterile environment near a flame.

13. Mini culture tubes should have a loose snap top that allows gas exchange.

14. In the case of PCR amplification, the design of primers is essential for the In-Fusion reaction. The 5’- end of the primers must have 15 bases of the pcDNA3.1 backbone plasmid, and the 3’- end must include 18 – 28 bases of the target gene insert with 40 – 60% GC content and a melting temperature between 58 – 65 °C. For the N-terminal SplitLuc-TOI, include a TGA or TAA STOP codon in the reverse complement primer. For the C-terminal SplitLuc TOI, include a Kozak Start CACC-ATG in the forward primer (Fig. 4). Separate the PCR product on an agarose gel, confirm expected size, and perform gel extraction.

15. For PCR amplification of TOI to be cloned into the N-terminal acceptor, order primers: Forward: 5’-GAAGATCAGCGGATCC [TOI sequence, starting with ATG]-3’

Reverse: 5’-GATATCTGCAGAATTC [TOI sequence starting with STOP codon in reverse]-3’ For PCR amplification of TOI to be cloned into the C-terminal acceptor, order primers:

Reverse: 5’- AGCCACTCACGGATCC [TOI sequence, after the STOP codon]-3’

Forward: 5’- ACCCAAGCTGGCTAGCCACC [TOI sequence starting with ATG]-3’

16. Given that the backbone acceptor plasmid is reused for different gene insertions, forward and reverse pcDNA3.1 sequencing primers can be used to sequence resulting SplitLuc clones. A sequencing oligonucleotide at the center of the TOI may also be required if the gene is too long and the resulting sequences from the forward and reverse primers alone to do not span the entire gene. The entire coding region should be confirmed by Sanger sequencing.

17. Make one tube per well. Do not mix after incubation as this will disrupt the lipid-DNA complex.

18. Allow newly seeded cells to settle for 10 minutes before moving them to the incubator, this will assure uniformity of seeding. Transfection is dependent on target gene of interest. Abundant proteins only require 24 hours for high luciferase signal whereas less abundant proteins may require 48 – 72 hours to provide sufficient signal.

19. Resuspending the cell pellet in CETSA assay buffer (DMEM media without FBS and antibiotics) will reduce the binding of compounds to serum. The assay can be run, however, in serum containing medium or with adherent cells. We have observed that resuspending the cells in PBS can give rise to cell aggregation leading to an altered melting profile.

20. If your target protein is secreted from the cell, then collect the supernatant and cells in separate tubes.

21. Ensure the luminescence is not at signal saturation, otherwise alter exposure time and gain as signal saturation will raise signal-to-noise ratio and may mask the melting profile from the subsequent SplitLuc CETSA experiments.

22. Validation of normal protein function and/or localization with the addition of an N-terminal or C-terminal SplitLuc tag should be conducted in relevant phenotypic and biochemical assays.

23. The incremental 3 °C temperatures spanning from 37 – 88 °C will provide a broad melting profile for the TOI as well as a thermal shift for compound engagement by a representative control or lead compound (for example, LDHA inhibitor 530 in Fig. 1). This melting profile will be useful for generating a melting curve and determining the 70 – 80% melting temperature that will be used in the high-throughput SplitLuc CETSA (isothermal format).

24. Normalize each condition (treated with DMSO vehicle or control compound) to 37 °C to calculate percentage melt. In some cases, the compound may stabilize the protein and increase protein levels during the 1-hour incubation, which could be indicative of bona fide target engagement. Increased luminescence that is attributable to increased protein expression will be accounted for when normalizing the data (each compound is normalized to its own 37 °C value), allowing for accurate determination of T_agg.

25. High-throughput SplitLuc CETSA is quicker and more efficiently done when using automated dispensers. For instance, a Multidrop Combi Reagent dispenser can be used to transfer cells more quickly and uniformly, and an arrayed pinning tool or acoustic dispenser can be used for compound transfer; however, other methods such as electronic multichannel pipets are compatible with the SplitLuc CETSA methodology.

26. Standard 384-well PCR plates are not compatible with Multidrop Combi dispensers. A plate holder/adaptor can be 3-D printed (see Fig. S2 and supplementary 3D design file).

27. Heating can be done in a white 384-well PCR plate mounted on a compatible thermocycler. Alternatively, metal heating blocks (aluminum or copper, with copper having increased conductivity and quicker heating) can also be used for a standard white 1536-well plate. A copper/aluminum plate block can be set directly in a digital heat block apparatus, with the tube blocks removed, and allow the block to equilibrate to the desired temperature (Fig. S1). Plates can also be heated by floating them in a warm water bath set to the desired temperature.

28. A self-contained temperature-controlled block can be created by bolting a type-T thermocouple in the center of a copper block at a machined recess in the face of the block with its braided stainless-steel armored lead exiting the end of the heater block plate below the skirt of the plate. A copper rod plug serves as an interference fit in the thermocouple recess. A milling machine is used to create a smooth surface on the block. A 120V AC self-adhesive polyamide film sheet heater is adhered to the bottom of the copper block to heat the block. Self-adhesive silicone foam bumpers are attached to the underside of the block to insulate the heat block from a benchtop. The temperature of the heat block is regulated by a programmable controller which uses a 24V DC powered relay to switch the 120V to the film heater. The plate is held in intimate contact with the heat block using a similarly sized sheet of 3/8” closed cell silicone foam and a 1/8” aluminum clamping plate that fits onto thread studs on each corner of the heat block. The aluminum clamping plate is secured with threaded knobs on each of four studs (Fig. S1).

29. A matching “unheated” control is useful for the high throughput 384- and 1536-well CETSA experiments. In this control, cells are treated with compounds (or DMSO control), incubated at 37 °C for 1 hour, lysed, and processed as described for the heated plate.

30. Heating duration affects melting profiles, where longer heating times cause a left shift in the T_agg and right shift in potency for compound-induced stabilization.

31. A white cyclic olefin polymer plate is used because it is resistant to high temperatures. Importantly, heating 1536-well plate on a copper heating block may not mimic the melting profile observed in a PCR thermocycler, and conditions should be optimized independently for the 1536-well assay.

32. An even amount of top pressure must be applied to avoid plate effects and reduced melting around the edges. This can be achieved by placing a heavy item on top of the plate. Alternatively, a setup can be created in which a silicone rubber foam sheet and metal lid are screwed down at all four corners (Fig. S1).

Supplementary Material

Suppl Info

Figure S1: Heating platform for high-throughput SplitLuc CETSA equipped with temperature control and metal blocks. (A) Temperature-controlled copper block and heating platform: 1, 110 level copper sheet (e.g. McMaster-Carr #8995K56) and 110 copper rod plug (e.g. McMaster-Carr #8966K11); 2, silicone foam sheet (e.g. McMaster-Carr #8785K85); 3, clamping plate cover; 4, threaded rod (e.g. McMaster-Carr #90575A430); 5, threaded knobs (e.g. McMaster-Carr #57715K22); 6, thermocouple probe (e.g. McMaster-Carr #3648K26); 7, temperature controller (e.g. McMaster-Carr #4314K2); 8, medium current relay (e.g. McMaster Carr #7456K21); 9, polycarbonate enclosure (McMaster-Carr #7360K631). Components not shown: adhesive-back heater fit to size on the bottom of copper block (e.g. McMaster-Carr #35475K52), adhesive-back silicone foam bumpers on bottom of all four corners of heat block and polycarbonate enclosure (e.g. McMaster-Carr #3592K2), adapter cord (e.g. McMaster-Carr #70235K85), and power cord (e.g. McMaster-Carr #9570T2). (B) Aluminum plate block seated in a digital heat block apparatus. (C) Graphical sketch and measurements, in inches, for constructing the copper heating block. (D) Graphical sketch for the thermocouple drilled hole and plug, in inches.

Figure S2: Graphical representation of 3D-printed adapter for using 384-well PCR plates with a Multidrop Combi dispenser. (A) Plate holder. (B) Plate holder with 384-well PCR plate (Roche #04729749001).