Skip to main content
Insects logoLink to Insects
. 2022 Aug 29;13(9):780. doi: 10.3390/insects13090780

Sensitivity Differences and Biochemical Characteristics of Laodelphax striatellus (Fallén) to Seven Insecticides in Different Areas of Shandong, China

Yannan Xue 1, Chang Liu 1, Dongmei Liu 1, Wenjuan Ding 1, Zhaoge Li 1, Junli Cao 2, Xiaoming Xia 1,*
Editors: Qiang Xu, Fang (Rose) Zhu, Ting Li
PMCID: PMC9506532  PMID: 36135481

Abstract

Simple Summary

The sensitivity detection of pests to insecticides is useful to the strategies of integrated pest management (IPM) in the field. The sensitivities of six Laodelphax striatellus Fallén populations from different areas in Shandong, China to seven insecticides acting on the nicotinic acetylcholine receptor (nAChR) were investigated. The biochemical characteristics of different populations were also studied. The results showed that all the field populations are sensitive to clothianidin, nitenpyram, and triflumezopyrim, but some field populations have developed resistance to other insecticides. The populations showed different metabolic enzyme contents caused by the expression of related genes, and no known mutations in the target gene nAChR β1 subunit were found in any of the populations. These results provide valuable information for the management strategies of L. striatellus in field.

Abstract

Laodelphax striatellus Fallén is one of the main pests that can severely harm rice, corn, and wheat. Insecticides acting on the nicotinic acetylcholine receptor (nAChR) are the main type of pesticides used for the control of L. striatellus in Shandong Province, a major grain-producing region in China. In this study, the rice seedling dipping method was used to determine the sensitivities of six field L. striatellus populations in Shandong to seven insecticides acting on nAChR. The results showed that all the field populations were sensitive to clothianidin, nitenpyram, and triflumezopyrim, and the Jiaxiang population exhibited the lowest resistance ratio (RR) to imidacloprid, dinotefuran, sulfoxaflor, and thiamethoxam. The Donggang population showed a medium-level resistance to imidacloprid, with the highest RR of 17.48-fold. The Yutai population showed low-level resistance to imidacloprid and thiamethoxam, with RRs of 7.23- and 7.02-fold, respectively. The contents of cytochrome P450 monooxygenase (P450s), carboxylesterase (CarE), and glutathione S-transferase (GST) were the highest in the Donggang population and the lowest in the Jiaxiang population. The P450 gene CYP314A1 and the CarE gene LsCarE12 were highly up-regulated in all populations. No mutations of V62I, R81T, and K265E in the nAChR β1 subunit were found in any of the populations. These results provide valuable information for the strategies of resistance management of L. striatellus in the field.

Keywords: Laodelphax striatellus Fallén, nicotinic acetylcholine receptor, sensitivity, biochemical characteristics

1. Introduction

Laodelphax striatellus Fallén (Hemiptera: Delphacidae) is an important pest of rice, corn, and wheat [1]. It is mainly distributed in Asia and North Africa, and in warm temperate areas of Europe [2]. Both the adults and nymphs of L. striatellus can suck plant sap from the phloem, consuming plant nutrients [3]. In addition, L. striatellus can transmit rice stripe virus and maize rough dwarf virus, which damage crops and cause severe yield losses [4].

Neonicotinoids, sulfonimines, and mesoionic insecticides all act on the nicotinic acetylcholine receptor (nAChR), and are widely used in the control of L. striatellus [5]. However, due to the widespread and frequent use of insecticides, L. striatellus has developed resistance to these insecticides, including imidacloprid, nitenpyram, and thiamethoxam, leading to control difficulties [6,7,8]. In Shandong Province, the main maize-producing area in China, the sensitivity of L. striatellus in the field to insecticides acting on nAChR is not clear.

Studies have shown that the reduction of L. striatellus sensitivity to insecticides is mainly due to the enhanced activity of metabolic enzymes, including cytochrome P450 monooxygenase (P450s), carboxylesterase (CarE), and glutathione S-transferase (GST) [9,10]. This enhancement of enzyme activity is generally caused by the overexpression of related genes [11].

The overexpression of CYP425B1 and CYPDE1 leads to increased P450s activity, which is responsible for imidacloprid resistance in L. striatellus [12]. A previous study has reported that up-regulation of LsCarE1 and LsCarE2 mediates the resistance of L. striatellus to chlorpyrifos [13]. GST can prevent and repair oxidative damage caused by exogenous substances in Drosophila [14]. The NlGSTs1, NlGSTs2, NlGSTe1, and NlGSTm1 have been shown to play important roles in the resistance of Nilaparvata lugens Stål to imidacloprid [15].

Target resistance caused by the mutation of target genes is another important mechanism of insecticide resistance in pests [16]. Mutations sites at V62I, R81T, and K264E located in the nAChR β1 subunit are associated with resistance to imidacloprid and acetamiprid in insects [17,18,19].

In this study, the sensitivity of six L. striatellus populations, collected from different areas in Shandong, to seven insecticides (imidacloprid, nitenpyram, thiamethoxam, clothianidin, dinotefuran, sulfoxaflor, and triflumezopyrim) acting on the nAChR was detected. The contents of P450s, CarE, and GST, the related metabolic gene expression and target gene mutations were also determined. The results could be useful in the application of insecticides for the management of L. striatellus in the field.

2. Materials and Methods

2.1. Insects

L. striatellus populations were collected from six different locations: Donggang (119.35° E, 35.28° N), Tancheng (118.28° E, 34.52° N), Yutai (116.56° E, 34.97° N), Jiaxiang (116.304° E, 35.41° N), Daiyue (117.03° E, 35.97° N), and Jiyang (117.23° E, 37.04° N) in Shandong Province, China, during September to October 2020. The relatively susceptible strain (SS) was maintained in laboratory for more than five years without exposure to any chemicals [1]. All insects were fed with ‘Wuyujing 3’ rice seedlings under laboratory conditions of 25 ± 1 °C, 70–80% relative humidity, and a 16:8 h L:D photoperiod [20].

2.2. Chemicals

Imidacloprid (96%) was provided by Shandong Weifang Rainbow Chemical Co., Ltd. (Weifang, China). Nitenpyram (98%), thiamethoxam (98%), clothianidin (98%), and dinotefuran (99.1%) were supplied by Shandong United Pesticide Industry Co., Ltd. (Jinan, China). Triflumezopyrim (96%) was supplied by DuPont Company (Shanghai, China). Sulfoxaflor (95.9%) was supplied by Dow Agroforestry Corporation (Beijing, China).

2.3. Bioassays

The toxicities of the insecticides to L. striatellus were determined using the rice seedling dipping method [20]. The insecticides were dissolved in acetone and diluted with deionized water containing 0.1% Triton to a serial concentration. The serial concentrations of each tested pesticide are shown in Supplementary Materials S1. Control groups were treated with deionized water containing 0.1% Triton. Five rice seedlings were immersed in the solution for 30 s, and then removed and dried naturally in the shade. The roots of the rice seedlings were wrapped with wet absorbent cotton and placed into a 20 mm × 200 mm glass test tube. Thirty third-instar nymphs were transferred into each tube and then sealed with four layers of 20-mesh gauze. Ninety insects were treated for each concentration performed with three replicates. Finally, all treatments were placed in an incubator following the above feeding conditions, and the mortality was checked at 72 h [21].

2.4. Enzymes Contents Assays

The P450s, CarE, and GST contents were detected according to the kit’s instructions (Hengyuan Biotechnology Co., Ltd., Shanghai, China), using a double-antibody sandwich method based on immunoassay principles [22,23,24]. The kit numbers are HB905X-QT, HB863X-QT, and HB593X-QT, respectively. Third-instar nymphs per population were used for the preparation of the enzyme solution. Each population includes three replications (30 insects per replicate). The protein content of the enzyme solution was determined using the BCA protein kit (Beyotime Biotechnology Co., Ltd., Shanghai, China) [25].

The P450s, CarE, and GST contents were calculated according to the standard curve and protein content, and the results are expressed as μg/g prot. The specific determination steps of P450s, CarE, and GST contents are in Supplementary Materials S2.

2.5. Detection of Gene Expression Levels

According to the previous transcriptome sequencing results (no published), the expression of seven P450 genes, eight CarE genes, and eight GST genes in all seven populations was determined by the real-time quantitative PCR (RT-qPCR) [11], and the SS was used as a control group. The chemical reagents used in this section were purchased from Novizan Biotechnology Co., Ltd. (Nanjing, China).

Twenty-five third-instar nymphs were collected from each population to extract total RNA, and each population contained three biological repetitions. The total RNA was extracted using RNA-esayTM Isolation Reagent (Novizan Biotechnology Co., Ltd., Nanjing, China), and 1 μg of total RNA was reverse transcribed to cDNA synthesis by using reverse transcription kit (Novizan Biotechnology Co., Ltd., Nanjing, China).

The ChamQTM Universal SYBR® qPCR Master Mix was used to carry out the qRT-PCR reaction in a QuantStudioTM 3 system (Thermo ABI, Santa Clara, CA, USA). The reference gene (GAPDH) and primers are shown in Table 1. Relative quantifications were achieved based on using the 2−ΔΔCTmethod [26].

Table 1.

Primers used for RT-qPCR and the nAChR β1 subunit amplification.

Gene Accession Number Forward Primer (5′-3′) Reverse Primer (5′-3′)
CYP4C72 MG566048.1 GAAGACATTCGTGAGGAGG CCCAAAAGTAGTAAGAGCCAG
CYP4CE2 MG566046.1 GCTCTTTCACCTTTCACCCAC TTCATCACGTTCCAACTCCTC
CYP6CS2v1 JX876492.1 GAACAATCGCATCCAACAA GGCATCCAAGTACTCCAGA
CYP6CW1 JX462960.1 ACTTCCAGTTTCAGACGCC GACCGCTTCCCATCAGATC
CYP314A1 KC579461.1 CAAGGAGCGTCACAGAGTA TCCATCACCAGAAGGAATAG
CYP314A1v2 JX566821.1 CCTATTCCTTCTGGTAATG CGGCTTCTCTTCTATTATC
CYP425A1v2 JX876513.1 CCTACCAGAAAATATAAGCAAACGG CACATTCCACATCAAACCTTCTG
LsCarE5 HM600727.1 CTTGTGGCAGGATTCGTAGAG TCATGATTATCACCGAGAAGCC
LsCarE10 JQ990753.1 CAAAATGAGCAGGGAATCGC TTGGATTCAGAGGTGTGGC
LsCarE12 JQ990755.1 CCGCTTCCTGTCATTTTCT TGTTCTCAACGTAGGCCCA
LsCarE14 JQ990757.1 TCTGAGGACTGTCTCTATCTGG CCACGTCAGCCTCTTTACTATC
LsCarE16 MK238305.1 GGTGCGGAATTCGTTGAAAAC GGTGACTCGTTAATTGGTTTGC
LsCarE18 JQ990761.1 AAGCAAGCTGAGCAGATCG CTTCAACAAGTCGTAGGGA
LsCarE28 JQ990771.1 GCCTGACAAAATGCTCTCAAG GGCAATGTTCTGTTTCACCC
LsCarE35 JX566828.1 CTCTATGGGTTATGTCTTCGCG CTCAACTCTACAATCGGAGGC
LsGSTd1 JN628446.1 TTCCCAGTTGTAAGGCTTGG CAAGAGTCGATATAGATGCGGC
LsGSTe1 JN628441.1 GCCGGTGATCAGATGACTATC TGGCCGAATCGTAATCCTTC
LsGSTo1 JN628448.1 TCCCAAGTGCTTTATACTCATAGG CTAAAGGTGGGTCTGTGGAG
LsGSTs1 JN628440.1 TTCAATGCTAGAGGAAGAGCG TGCCATCCACTTCTAAAACAGG
LsGSTs2 JN628443.1 GCATCAAAATTCAGCTCAGTCG TCCAGATAAGACAGCAACCATC
LsGSTs3 JN628444.1 GCAATCAGTCGCCATTTCTAG GCTTCATCGCTTTCATAGAACC
LsGSTt1 JN628445.1 CCACCCAATCAAGAAACAGTTAAT ATCATAACCGGCCATTCTGG
LsGSTz1 JN628442.1 GGCTAAGGTGAGGGAGATTTG CCGACACAATATTTGCCAGC
GAPDH HQ385974.1 GTGTTGACTACATGGTCTACT GCTCACTGAATACCTGGATT
nAChR β1 MF612140.1 GTTCTGCTAGTCTTCGGAGTC TTCCCGAATCTGTATGTACTG

2.6. Detection of Gene Mutation Sites in nAChR β1 Subunit

Gene sites V62I, R81T, and K264E of the nAChR β1 subunit were selected for mutation detection based on the previously reported gene mutation of insecticide resistance [18,19]. Based on the complete mRNA sequence (GenBank: MF612140.1, NCBI) of nAChR β1 subunit of L. striatellus, the primer sequences were designed to amplify a length range of 31 bp–1381 bp fragments containing the above three mutation sites (Table 1).

A third-instar nymph was taken, and an ultra-trace total RNA extraction kit (Nobel Lai Biotechnology Co., Ltd., Beijing, China) was used to extract total RNA. Then, 1 μg of total RNA was taken for cDNA synthesis. Finally, 2×Phanta Flash Master Mix (Dye Plus) (Novizan Biotechnology Co., Ltd., Nanjing, China) was used to amplify the target gene in the PCR system (Thermo Fisher Scientific, Santa Clara, CA, USA). The PCR product was sent to a company (Sangon Biotechnology Co., Ltd., Shanghai, China) for sequencing.

2.7. Statistical Analysis

All the results of the sensitivity detection of L. striatellus to the pesticide were processed by the SPSS software (V. 20.0 for Windows, SPSS Inc., Chicago, IL, USA). The insecticide treatment mortality was corrected with control mortality using Abbott’s formula. The median lethal concentration (LC50), slope, 95% confidence interval (CI), χ2, and coefficient of determination (R2) were calculated using probit analysis and the chi-square test. R2 ranges from 0 to 1, with 1 indicating the highest goodness of fit of the toxicity data to the linear regression equation. The differences in metabolic enzyme activities and gene expression levels were analyzed by one-way ANOVA with Tukey’s test method at 0.05 levels. The target gene mutation sites were analyzed using DNAman software (V. 9.0, Lynnon Biosoft Inc., San Ramon, CA, USA).

The LC50 value of the susceptibility baseline of each insecticide to L. striatellus is shown in Table 2. The resistance ratio (RR) (LC50 of field populations/LC50 of SS or baseline) was calculated and used to clarify the resistance level: low (RR = 5–10-fold), medium (RR = 10–100-fold), and high (>100-fold) [27].

Table 2.

LC50 values of the susceptibility baseline of L. striatellus.

Insecticide LC50 (95% CI) (mg/L) Reference
Imidacloprid 9.3060 (7.1210–11.5550) [28]
Nitenpyram 1.2310 (0.9350–1.5310) [29]
Thiamethoxam 1.7920 (1.3390–2.2770) [29]
Dinotefuran 0.5280 (0.3690–0.6980) [28]
Sulfoxaflor 0.3980 (0.2880–0.5030) [21]
Clothianidin 2.5000 (1.6918–3.6945) Present study
Triflumezopyrim 0.4867 (0.3525–0.6672) Present study

3. Results

3.1. Insecticide Sensitivity in Different Populations of L. striatellus

The results showed that the Donggang and Yutai populations had medium- and low-level resistance to imidacloprid, with RRs of 17.48- and 7.23-fold, respectively. However, no imidacloprid resistance was determined in the other four populations (Table 3). The Donggang, Yutai, and Jiyang populations showed low-level resistance to dinotefuran, with RRs of 5.84-, 7.81-, and 5.04-fold, respectively (Table 4). A low level of sulfoxaflor resistance was also detected in the Tancheng and Jiyang populations, with RRs of 5.20- and 5.35-fold, respectively (Table 5). However, only the Yutai population had low-level resistance to thiamethoxam, with an RR of 7.02-fold (Table 6). However, all six field populations were sensitive to nitenpyram, clothianidin, and triflumezopyrim (Table 7, Table 8 and Table 9).

Table 3.

Sensitivity to imidacloprid in six L. striatellus populations in Shandong Province.

Population LC50 (mg/L) 95% CI (mg/L) Slope ± SE χ2 (df) R2 RR
Donggang 162.67 87.40–264.68 1.28 ± 0.32 2.26 (3) 0.89 17.48
Tancheng 29.49 21.03–46.97 1.57 ± 0.30 4.00 (3) 0.88 3.17
Yutai 67.26 46.95–115.03 1.41 ± 0.27 3.03 (3) 0.92 7.23
Jiaxiang 23.63 16.26–36.61 1.48 ± 0.30 1.77 (3) 0.94 2.54
Daiyue 42.14 24.19–71.27 1.14 ± 0.35 2.36 (3) 0.82 4.53
Jiyang 31.99 23.42–46.77 1.72 ± 0.31 1.98 (3) 0.94 3.44

Table 4.

Sensitivity to dinotefuran in six L. striatellus populations in Shandong Province.

Population LC50 (mg/L) 95% CI (mg/L) Slope ± SE χ2 (df) R2 RR
Donggang 3.08 2.14–4.77 1.45 ± 0.29 4.34 (3) 0.86 5.84
Tancheng 2.24 1.44–3.35 1.39 ± 0.29 3.28 (3) 0.89 4.25
Yutai 4.12 3.18–6.21 2.66 ± 0.49 4.50 (3) 0.89 7.81
Jiaxiang 1.93 1.35–2.58 1.84 ± 0.31 7.95 (3) 0.84 3.65
Daiyue 2.57 1.67–4.00 1.68 ± 0.37 2.40 (3) 0.89 4.86
Jiyang 2.66 2.10–3.42 2.55 ± 0.38 7.30 (3) 0.90 5.04

Table 5.

Sensitivity to sulfoxaflor in six L. striatellus populations in Shandong Province.

Population LC50 (mg/L) 95% CI (mg/L) Slope ± SE χ2 (df) R2 RR
Donggang 1.55 1.13–2.39 1.63 ± 0.28 1.29 (3) 0.96 3.90
Tancheng 2.07 1.42–2.85 1.57 ± 0.28 3.30 (3) 0.92 5.20
Yutai 1.62 1.12–2.13 1.95 ± 0.31 8.43 (3) 0.84 4.07
Jiaxiang 1.41 1.04–1.99 1.87 ± 0.33 6.84 (3) 0.85 3.54
Daiyue 1.79 1.18–2.48 1.54 ± 0.28 3.07 (3) 0.92 4.50
Jiyang 2.13 1.41–3.04 1.41 ± 0.27 0.81 (3) 0.98 5.35

Table 6.

Sensitivity to thiamethoxam in six L. striatellus populations in Shandong Province.

Population LC50 (mg/L) 95% CI (mg/L) Slope ± SE χ2 (df) R2 RR
Donggang 6.87 5.15–9.92 1.92 ± 0.33 5.84 (3) 0.87 3.83
Tancheng 6.37 4.32–8.44 2.10 ± 0.35 3.99 (3) 0.80 3.55
Yutai 12.58 8.75–19.73 1.52 ± 0.31 1.21 (3) 0.97 7.02
Jiaxiang 5.12 3.68–7.16 1.90 ± 0.35 7.52 (3) 0.81 2.86
Daiyue 7.77 5.63–12.24 1.70 ± 0.31 6.14 (3) 0.87 4.34
Jiyang 6.57 4.80–9.77 1.81 ± 0.34 3.56 (3) 0.90 3.66

Table 7.

Sensitivity to nitenpyram in six L. striatellus populations in Shandong Province.

Population LC50 (mg/L) 95% CI (mg/L) Slope ± SE χ2 (df) R2 RR
Donggang 1.33 0.98–1.93 1.67 ± 0.28 1.55 (3) 0.96 1.08
Tancheng 0.68 0.51–0.98 1.76 ± 0.29 1.52 (3) 0.97 0.55
Yutai 2.01 1.37–3.80 1.39 ± 0.28 5.09 (3) 0.86 1.63
Jiaxiang 0.78 0.51–1.49 1.15 ± 0.26 4.96 (3) 0.80 0.63
Daiyue 1.08 0.81–1.48 1.78 ± 0.29 0.47 (3) 0.99 0.88
Jiyang 0.95 0.66–1.70 1.43 ± 0.28 5.32 (3) 0.85 0.77

Table 8.

Sensitivity to clothianidin in six L. striatellus populations in Shandong Province.

Population LC50 (mg/L) 95% CI (mg/L) Slope ± SE χ2 (df) R2 RR
Donggang 3.97 2.67–5.54 1.51 ± 0.27 3.75 (3) 0.86 1.59
Tancheng 3.52 2.59–5.27 1.76 ± 0.31 2.76 (3) 0.89 1.41
Yutai 3.76 2.66–5.00 1.81 ± 0.29 1.42 (3) 0.89 1.51
Jiaxiang 3.50 2.46–5.62 1.48 ± 0.29 3.44 (3) 0.84 1.40
Daiyue 5.61 3.96–8.26 1.87 ± 0.36 2.09 (3) 0.89 2.24
Jiyang 3.56 2.16–5.17 1.32 ± 0.27 1.74 (3) 0.90 1.42

Table 9.

Sensitivity to triflumezopyrim in six L. striatellus populations in Shandong Province.

Population LC50 (mg/L) 95% CI (mg/L) Slope ± SE χ2 (df) R2 RR
Donggang 0.99 0.69–1.42 1.47 ± 0.27 5.99 (3) 0.85 2.03
Tancheng 0.69 0.47–0.93 1.8193 ± 0.31 6.97 (3) 0.87 1.42
Yutai 0.89 0.63–1.20 1.90 ± 0.33 6.69 (3) 0.86 1.82
Jiaxiang 0.61 0.45–0.88 1.63 ± 0.28 2.44 (3) 0.94 1.26
Daiyue 0.76 0.50–1.08 1.52 ± 0.29 1.94 (3) 0.94 1.57
Jiyang 0.67 0.47–0.89 1.97 ± 0.32 3.17 (3) 0.94 1.38

3.2. Metabolic Enzymes Contents in Different Populations of L. striatellus

The contents of P450s were the highest in the Donggang and Daiyue populations, followed by the Yutai population, and the lowest in the Tancheng and Jiaxiang populations, compared with the SS (Figure 1A). P450s contents in the Jiyang population showed no significant differences with SS.

Figure 1.

Figure 1

P450s (A), CarE (B), and GST (C) contents of six L. striatellus populations in Shandong Province. The data are the mean ± SE (n = 3), and different letters on the bars indicate significant differences (p < 0.05).

The Donggang population showed the highest CarE contents in all the tested populations, followed by the Daiyue and Yutai populations (Figure 1B). The Jiaxiang population exhibited the lowest CarE contents, and there was no significant difference with the SS. The contents of CarE in the Tancheng and Jiyang populations were significantly higher than in the SS.

The GST contents results (Figure 1C) showed that the Donggang, Yutai, and Jiyang populations had the highest contents. The Daiyue population had high GST content. The Tancheng and Jiaxiang populations exhibited the lowest GST contents, and showed no significant differences with SS.

3.3. Gene Expression Levels in Different Populations of L. striatellus

In order to explore the potential metabolic enzyme genes that might be associated with insecticide sensitivity, the relative expression levels were determined for seven P450 genes, eight CarE genes, and eight GST genes in different populations of L. striatellus. The P450 gene results showed that the relative expression levels of different P450 genes were significantly different in different populations (Figure 2). Compared with SS, the relative expression levels of CYP314A1 were significantly up-regulated more than 10-fold in all the field populations, with 12.89–21.53-fold, however, CYP314A1v2 was less than 2-fold in all the field populations. CYP4C72 was significantly up-regulated in the Tancheng, Daiyue, and Jiyang populations with 4.68-, 3.55-, and 2.75-fold, respectively. CYP6CW1 showed the highest expression level in the Donggang population (3.27-fold), followed by the Jiyang and Yutai populations (2.97- and 2.55-fold, respectively). CYP425A1v2 also showed the highest expression level in the Donggang population (3.67-fold), followed by the Jiyang and Daiyue populations (2.91- and 2.88-fold, respectively). CYP6CS2v1 was significantly over-expressed only in the Tancheng and Jiaxiang populations (3.82- and 2.83-fold). CYP4CE2 only showed a remarkably high expression level in the Jiyang population (3.11-fold).

Figure 2.

Figure 2

The relative expression levels of seven P450 genes in six L. striatellus populations from Shandong Province compared with SS (red dotted line means 2-fold overexpression level). The data are the mean ± SE (n = 3), and different letters on the bars indicate significant differences (p < 0.05).

As shown in Figure 3, compared to SS, the three CarE genes (LsCarE10, LsCarE12, and LsCarE35) were relatively over-expressed up to more than 2-fold in all six field populations, among which LsCarE12 showed a high expression level of more than 10-fold change (from 11.39- to 19.27-fold). However, two CarE genes (LsCarE5 and LsCarE16) were less than 2-fold in all the field populations. LsCarE18 was significantly up-regulated in the Jiyang, Daiyue, and Tancheng populations with 4.13-, 2.78-, and 2.69-fold, respectively. LsCarE14 also was significantly up-regulated in the Daiyue and Tancheng populations (3.56- and 2.65-fold, respectively). Only LsCarE28 was significantly up-regulated in the Yutai population (2.31-fold).

Figure 3.

Figure 3

The relative expression levels of eight CarE genes in six L. striatellus populations from Shandong Province compared with SS (red dotted line means 2-fold overexpression level). The data are the mean ± SE (n = 3), and different letters on the bars indicate significant differences (p < 0.05).

The relative expression levels of eight GST genes in all the field populations did not change much (Figure 4). Compared with SS, only two GST genes (LsGSTd1 and LsGSTo1) in the Daiyue population, and other two GST genes (LsGSTt1 and LsGSTz1) in the Donggang population were over-expressed up to more than 2-fold.

Figure 4.

Figure 4

The relative expression levels of eight GST genes in six L. striatellus populations from Shandong Province compared with SS (red dotted line means 2-fold overexpression level). The data are the mean ± SE (n = 3), and different letters on the bars indicate significant differences (p < 0.05).

3.4. Gene Site Mutation in nAChR β1 Subunit in Different Populations of L. striatellus

According to the reported mutation sites that affect the sensitivity of A. gossypii to neonicotinoid insecticides, three sites V62I, R81T, and K264E of the nAChR β1 subunit in L. striatellus were tested for mutations. After comparing the partial amino acid sequences of the two species, it was found that the 62nd valine (V) and the 81st arginine (R) are in the same position of the nAChR β1 subunit sequence in the two species. However, the 264th lysine (K) site in A. gossypii should correspond to the 265th lysine (K) site of L. striatellus, because the latter has one more amino acid at the 218th position (aspartic) than the former.

The results of gene mutation detection showed that none of the three mutation sites (V62I, R81T, and K265E) were reported in the nAChR β1 subunit in any of the six field populations of L. striatellus in Shandong Province, and there were no mutations in SS either (Table 10).

Table 10.

The nAChR β1 subunit gene mutation sites and frequency in six L. striatellus populations from Shandong Province.

Population Insects Frequency of Mutation Site
V62I R81T K265E
Donggang 30 0 0 0
Tancheng 30 0 0 0
Yutai 30 0 0 0
Jiaxiang 30 0 0 0
Daiyue 30 0 0 0
Jiyang 30 0 0 0
SS 30 0 0 0

4. Discussion

Currently, L. striatellus are mainly controlled by applying insecticides acting on nAChR, and had developed resistance to many insecticides, leading to control problems in the field [7,30]. The sensitivity determination results showed that three field populations exhibited multi-resistance to three tested insecticides (imidacloprid, dinotefuran, thiamethoxam), among which most showed low-level resistance, but the Donggang population had a medium-level resistance to imidacloprid. Low level resistance to sulfoxaflor was found only in the Tancheng population. However, all the field populations still showed sensitivity to nitenpyram, clothianidin, and triflumezopyrim, and the Daiyue and Jiaxiang populations did not develop resistance to all the tested insecticides. The insecticide multi-resistance of L. striatellus in the field had also been reported in many previous studies, which may be due to the history of pesticide application, and particular application habits and application levels in various regions [6,31,32]. In terms of geographical distribution, the four resistant populations (the Donggang, Tancheng, Jiaxiang, and Yutai populations) were all located in areas with abundant water resources, the climate was warm and humid, and the occurrence of L. striatellus was more serious [33]. Persistent excessive chemical control may be another important reason for insecticide resistance [34]. Therefore, a combination of imidacloprid with dinotefuran, sulfoxaflor, and thiamethoxam used in the field to control L. striatellus should be cautiously applied.

P450s, CarE, and GST are the three major metabolic enzymes in insects. Previous studies have confirmed that the enhanced activity of these three metabolic enzymes mediates insect resistance to insecticides acting on nAChR [5,35,36]. In this study, the contents of P450s, CarE, and GST in the Donggang, Yutai, and Daiyue were significantly higher than those in the Tancheng and Jiaxiang populations, and the enzyme contents were related to the sensitivity of the populations to imidacloprid, thiamethoxam, and dinotefuran. However, the enzyme activity cannot be directly inferred from enzyme contents, and the activities of these three enzymes still need to be detected in the future.

The overexpression of multiple P450 genes can jointly regulate the sensitivity of insects to insecticides [37,38]. Many previous studies have confirmed that CYP314A1 contributes to the development of insecticide resistance in N. lugens and other insects [39,40]. Li et al. also found that the CYP314A1 gene could affect the development, and increased the mortality of L. striatellus [41]. In this study, CYP314A1 had the highest overexpression level in all tested populations of L. striatellus, but there were no significant correlations between the CYP314A1 gene and insecticide sensitivity.

CYP4C72 and CYP6CW1 are associated with imidacloprid resistance in L. striatellus [42,43]. Similarly, our results showed that these two P450 genes were significantly up-regulated in some field populations. The above P450 genes may play an important role in insecticides resistance in L. striatellus populations in Shandong Province. In addition, CYP6CS2v1, CYP425A1v2, and CYP4CE2 were significantly up-regulated at more than two-fold in some populations. However, a previous study found that the expression levels of these three genes were not different in the deltamethrin-resistant populations of L. striatellus [44].

Previous studies have found that CarE12 and CarE28 were significantly induced in N. lugens after treatment with sublethal concentrations of chlorpyrifos [45]. CarE10 and CarE18 were involved in the detoxification of fenfluthrin in Tetranychus cinnabarinus [46]. In this study, LsCarE10 and LsCarE12 were over-expressed in all tested field populations of L. striatellus, among which LsCarE12 had the highest overexpression level. LsCarE18 and LsCarE28 were also up-regulated in some populations. A previous study showed that CarE14 was significantly up-regulated in T. cinnabarinus after exposure to cyflumetofen [46]. The overexpression of CarE14 was also observed in two field populations in our study. A previous study proved that CarE5 and CarE16 were induced to be up-regulated in N. lugens after treatment with nitenpyram [45], but the expression levels of these two genes were less than 2-fold in all the field populations in this study. We also found that LsCarE35 was significantly up-regulated in all tested field populations, but there are no reports on whether this gene is related to insecticide resistance, and we will focus on this gene in the next study.

In this study, only LsGSTd1 and LsGSTo1 in the Daiyue population, and LsGSTt1 and LsGSTz1 in the Donggang population were significantly up-regulated. Previous studies have confirmed that NIGSTd1 and NIGSTz1 are overexpressed in the fipronil-resistant population of N. lugens [47]. Imidacloprid or chlorpyrifos resistance in L. striatellus associated with the up-regulated expression of LsGSTo1 and LsGSTt1 has also been reported [30,48]. However, changes in the expression levels of eight tested GST genes in all the populations were not obvious.

As a target of insecticides, mutations in the nAChR gene inactivate the activity of ion channels, resulting in reduced insect sensitivity to insecticides [49]. In this study, no reported mutations at the positions V62I, R81T, and K265E of the nAChR β1 subunit were found in the L. striatellus population in Shandong Province. This may be due to the low insecticide resistance level in the tested populations of L. striatellus. The reported mutations are often found in insects with high resistance level to insecticides targeted at nAChR [50,51].

5. Conclusions

This study shows that some L. striatellus populations in Shandong Province have developed resistance to imidacloprid, dinotefuran, sulfoxaflor, and thiamethoxam, and all the field populations are sensitive to clothianidin, nitenpyram, and triflumezopyrim. This differential sensitivity phenomenon is not currently associated with mutations at positions V62I, R81T, and K265E of the nAChR β1 subunit, and they may be related to the enhanced P450s, CarE, and GST contents and the overexpression of the related genes in L. striatellus.

Acknowledgments

We thank all authors who contributed to this article, with special thanks to corresponding author Xiaoming Xia for financial support.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/insects13090780/s1, S1: The serial concentrations of each pesticide tested; S2: Determination steps of metabolic enzymes contents.

Author Contributions

Conceptualization, X.X. and Y.X.; Methodology, X.X. and Y.X.; Investigation, C.L., J.C. and D.L.; Software, Y.X. and C.L.; Data Curation, X.X. and Y.X.; Validation, C.L., D.L., W.D. and Z.L.; Supervision, X.X.; Funding Acquisition, X.X.; Writing–Original Draft Preparation, X.X. and Y.X.; Writing–Review & Editing, X.X., Y.X., C.L., D.L., W.D., Z.L. and J.C. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data supporting the conclusion of this paper have been reflected in the main text. The original data can be obtained from the corresponding authors.

Conflicts of Interest

The authors declare no conflict of interest.

Funding Statement

The present study was supported by grants from the National Natural Science Foundation of China [No. 32072459].

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Wang X.T., Liu X., Liu C., Wen S.F., Xue Y.N., Jin Y., Zhang G.F., Xia X.M. Effects of sublethal concentrations of cyantraniliprole on the biology and metabolic enzyme activities of Laodelphax striatellus (Fallén) Crop Prot. 2022;156:105964. doi: 10.1016/j.cropro.2022.105964. [DOI] [Google Scholar]
  • 2.Zeng B., Liu Y.T., Zhang W.J., Feng Z.R., Wu S.F., Gao C.F. Inheritance and fitness cost of buprofezin resistance in a near-isogenic, field-derived strain and insecticide resistance monitoring of Laodelphax striatellus in China. Pest Manag. 2022;78:1833–1841. doi: 10.1002/ps.6801. [DOI] [PubMed] [Google Scholar]
  • 3.Wang H.T., Dong Y., Wan B.J., Ji Y.H., Xu Q.F. Identification and characterization analysis of transient receptor potential mucolipin protein of Laodelphax striatellus Fallen. Insects. 2022;12:1107. doi: 10.3390/insects12121107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Lu G., Zhang X.D., Xu Z.T., Ye Z.X., Zhang Y., Chen J.P., Zhang C.X., Li J.M. Complete sequence and genetic characterization of a novel insect-specific reovirus discove red from Laodelphax striatellus. Virology. 2022;570:117–122. doi: 10.1016/j.virol.2022.03.011. [DOI] [PubMed] [Google Scholar]
  • 5.Datta J., Wei Q., Yang Q.X., Wan P.J., He J.C., Wang W.X., Lai F.X., Ail M.P., Fu Q. Current resistance status of the brown planthopper Nilaparvata lugens (Stål) to commonly used insecticides in China and Bangladesh. Crop Prot. 2021;150:105789. doi: 10.1016/j.cropro.2021.105789. [DOI] [Google Scholar]
  • 6.Gao B.L., Wu J., Huang S.J., Mu L.F., Han Z.J. Insecticide resistance in field populations of Laodelphax striatellus Fallén (Homoptera: Delphacidae) in China and its possible mechanisms. Int. J. Pest Manag. 2008;54:13–19. doi: 10.1080/09670870701553303. [DOI] [Google Scholar]
  • 7.Ban L.F., Zhang S., Huang Z.Y., He Y.P., Peng Y.Q., Gao C.F. Resistance monitoring and assessment of resistance risk to pymetrozine in Laodelphax striatellus (Hemiptera: Delphacidae) J. Econ. Entomol. 2012;105:2129–2135. doi: 10.1603/EC12213. [DOI] [PubMed] [Google Scholar]
  • 8.Jeong I.H., Lee S.W., Choi B.R., Lee S.H., Kwon D.H. Monitoring and evaluation of differential insecticide resistance profiles in the immigrant vs. indigenous populations of the small brown planthopper (Laodelphax striatellus Fallén) in Korea. J. Asia-Pac. Entomol. 2016;19:247–252. doi: 10.1016/j.aspen.2015.12.002. [DOI] [Google Scholar]
  • 9.Enayati A.A., Ranson H., Hemingway J. Insect glutathione transferases and insecticide resistance. Insect Mol. Biol. 2005;14:3–8. doi: 10.1111/j.1365-2583.2004.00529.x. [DOI] [PubMed] [Google Scholar]
  • 10.Cui F., Li M.X., Chang H.J., Mao Y., Zhang H.Y., Lu L.X., Yan S.G., Lang M.L., Liu L., Qiao C.L. Carboxylesterase-mediated insecticide resistance: Quantitative increase induces broader metabolic resistance than qualitative change. Pestic. Biochem. Physiol. 2015;121:88–96. doi: 10.1016/j.pestbp.2014.12.016. [DOI] [PubMed] [Google Scholar]
  • 11.Wu S.F., Zeng B., Zheng C., Mu X.C., Zhang Y., Hu J., Zhang S., Gao C.F., Shen J.L. The evolution of insecticide resistance in the brown planthopper (Nilaparvata lugens Stål) of China in the period 2012–2016. Sci. Rep. 2018;8:4586. doi: 10.1038/s41598-018-22906-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zhang Y.L., Liu B.S., Zhang Z.C., Wang L.H., Guo H.F., Li Z., He P., Liu Z.W., Fang J.C. Differential expression of P450 genes and nAChR subunits associated with imidacloprid resistance in Laodelphax striatellus (Hemiptera: Delphacidae) J. Econ. Entomol. 2018;111:1382–1387. doi: 10.1093/jee/toy051. [DOI] [PubMed] [Google Scholar]
  • 13.Zhang Y.L., Wang L.H., Guo H.F., Li G.Q., Zhang Z.C., Xie L., Fang J.C. A transcriptome-based screen of carboxylesterase-like genes that are involved in chlorpyrifos resistance in Laodelphax striatellus (Fallen) Pestic. Biochem. Physiol. 2012;104:224–228. doi: 10.1016/j.pestbp.2012.08.006. [DOI] [Google Scholar]
  • 14.Parkes T.L., Hilliker A.J., Phillips J.P. Genetic and biochemical analysis of glutathione S-transferases in the oxygen defence system of Drosophila melanogaster. Genome. 1993;36:1007–1014. doi: 10.1139/g93-134. [DOI] [PubMed] [Google Scholar]
  • 15.Yang B., Lin X., Yu N., Gao H., Liu Z. Contribution of glutathione S-transferases to imidacloprid resistance in Nilaparvata lugens. J. Agric. Food Chem. 2020;68:15403–15408. doi: 10.1021/acs.jafc.0c05763. [DOI] [PubMed] [Google Scholar]
  • 16.Zhang J., Cui L., Xu X., Rui C. Frequency detection of imidacloprid resistance allele in Aphis gossypii field populations by real-time PCR amplification of specific-allele (rtPASA) Pestic. Biochem. Physiol. 2015;125:1–7. doi: 10.1016/j.pestbp.2015.06.001. [DOI] [PubMed] [Google Scholar]
  • 17.Hirata K., Kiyota R., Matsuura A., Toda S., Yamamoto A., Iwasa T. Association between the R81T mutation in the nicotinic acetylcholine receptor β1 subunit of Aphis gossypii and the differential resistance to acetamiprid and imidacloprid. J. Pestic. Sci. 2015;40:25–31. doi: 10.1584/jpestics.D14-092. [DOI] [Google Scholar]
  • 18.Chen X.W., Li F., Chen A.Q., Ma K.S., Liang P.Z., Liu Y., Song D.L., Gao X.W. Both point mutations and low expression levels of the nicotinic acetylcholine receptor β1 subunit are associated with imidacloprid resistance in an Aphis gossypii (Glover) population from a Bt cotton field in China. Pestic. Biochem. Physiol. 2017;141:1–8. doi: 10.1016/j.pestbp.2016.11.004. [DOI] [PubMed] [Google Scholar]
  • 19.Wang Z.J., Liang C.R., Shang Z.Y., Yu Q.T., Xue C.B. Insecticide resistance and resistance mechanisms in the melon aphid, Aphis gossypii, in Shandong, China. Pestic. Biochem. Physiol. 2020;172:104768. doi: 10.1016/j.pestbp.2020.104768. [DOI] [PubMed] [Google Scholar]
  • 20.Ding J., Wen S.F., Wang X.T., Xue Y.N., Zhang G.F., Jin Y., Xia X.M. Effects of host plants on insecticide sensitivity and detoxification enzyme activities in Laodelphax striatellus (Hemiptera: Delphacidae) J. Econ. Entomol. 2021;43:406–412. [Google Scholar]
  • 21.Mu X.C. Resistance Monitoring of Laodelphax striatellus, Sogatella furcifera and Biochemical Resistance Mechanisms of Buprofezin in Nilaparvata lugens (Stal) Nanjing Agricultural University; Nanjing, China: 2017. [Google Scholar]
  • 22.Riske F.J., Eveleigh D.E., Macmillan J.D. Double-antibody sandwich enzyme-linked immunosorbent assay for cellobiohydrolase I. Appl. Environ. Microbiol. 1990;56:3261–3265. doi: 10.1128/aem.56.11.3261-3265.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wang W.X., Zhu T.H., Wan P.J., Wei Q., He J.C., Lai F.X., Fu Q. Cloning and functional analysis of calcineurin subunits A and B in development and fecundity of Nilaparvata lugens (Stål) Rice Sci. 2022;29:143–154. [Google Scholar]
  • 24.Fang K., Han L.X., Liu Y.L., Fang J.W., Wang X.G., Liu T. Enantioselective bioaccumulation and detoxification mechanisms of earthworms (Eisenia fetida) exposed to mandipropamid. Sci. Total Environ. 2021;796:149051. doi: 10.1016/j.scitotenv.2021.149051. [DOI] [PubMed] [Google Scholar]
  • 25.Wen S.F., Xue Y.N., Du R.S., Liu C., Wang X.T., Wang Y.W., Liu C., Wang S., Wang J.H., Xia X.M. Toxicity and sublethal effects of triflumezopyrim on the development and detoxification enzymatic activities in the small brown planthopper (SBPH), Laodelphax striatellus (Fallen) Crop Prot. 2021;150:105813. doi: 10.1016/j.cropro.2021.105813. [DOI] [Google Scholar]
  • 26.Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 27.Mu X.C., Zhang W., Wang L.X., Zhang S., Zhang K., Gao C.F., Wu S.F. Resistance monitoring and cross-resistance patterns of three rice planthoppers, Nilaparvata lugens, Sogatella furcifera and Laodelphax striatellus to dinotefuran in China. Pestic. Biochem. Physiol. 2016;134:8–13. doi: 10.1016/j.pestbp.2016.05.004. [DOI] [PubMed] [Google Scholar]
  • 28.Cai Y.B., Dou T., Gao F.T., Yin X.M., Liu X.Y., Ren Y.D. Resistance monitoring of the field populations of Laodelphax striatellus (Hemiptera: Delphacidae) to twelve insecticides in Henan Province of China. Chin. J. Pestic. 2021;24:483–491. [Google Scholar]
  • 29.Zhang K., Zhang W., Zhang S., Wu S.F., Ban L.F., Su J.Y., Gao C.F. Susceptibility of Sogatella furcifera and Laodelphax striatellus (Hemiptera: Delphacidae) to six insecticides in China. J. Econ. Entomol. 2014;107:1916–1922. doi: 10.1603/EC14156. [DOI] [PubMed] [Google Scholar]
  • 30.Zhang Y., Guo L., Atlihan R., Chi H., Chu D. Demographic analysis of progeny fitness and timing of resurgence of Laodelphax striatellus after insecticides exposure. Entomol. Gen. 2019;39:221–230. doi: 10.1127/entomologia/2019/0816. [DOI] [Google Scholar]
  • 31.Liao X., Mao K.K., Ali E., Zhang X.L., Wan H., Li J.H. Temporal variability and resistance correlation of sulfoxaflor susceptibility among. Chinese populations of the brown planthopper Nilaparvata lugens (Stal) Crop Prot. 2017;102:141–146. doi: 10.1016/j.cropro.2017.08.024. [DOI] [Google Scholar]
  • 32.Hu H.Y., Ren X.L., Ma X.Y., Ma Y.J., Song X.P., Wang D., Li H.H., Ma Y. Resistance monitoring of cotton bollworm, Helicoverpa armigera to three insecticides in northern China. J. Plant Prot. 2021;48:900–906. [Google Scholar]
  • 33.Wang C.Y., Fei M.H., Meng L., Harveyb J.A., Lia B.P. Effects of elevated CO2 and temperature on survival and wing dimorphism of two species of rice planthoppers (Hemiptera: Delphacidae) under interaction. Pest Manag. Sci. 2020;76:2087–2094. doi: 10.1002/ps.5747. [DOI] [PubMed] [Google Scholar]
  • 34.Zhang S.R., Wang X.G., Gu F.C., Gong C.W., Lin C., Zhang Y.M., Hasnain A., Shen L.T., Jiang C.X. Sublethal effects of triflumezopyrim on biological traits and detoxification enzyme activities in the small brown planthopper Laodelphax striatellus (Hemiptera: Delphacidae) Front Physiol. 2020;11:261. doi: 10.3389/fphys.2020.00261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sun X., Gong Y., Shahbaz A., Hou M.L. Mechanisms of resistance to thiamethoxam and dinotefuran compared to imidacloprid in the brown planthopper: Roles of cytochrome P450 monooxygenase and a P450 gene CYP6ER1. Pestic. Biochem. Physiol. 2018;150:17–26. doi: 10.1016/j.pestbp.2018.06.014. [DOI] [PubMed] [Google Scholar]
  • 36.Feng Y.T., Wu Q.J., Wang S.L., Chang X.L., Xie W., Xu B.J., Zhang Y.J. Cross-resistance study and biochemical mechanisms of thiamethoxam resistance in B-biotype Bemisia tabaci (Hemiptera: Aleyrodidae) Pest Manag. Sci. 2010;66:313–318. doi: 10.1002/ps.1877. [DOI] [PubMed] [Google Scholar]
  • 37.Qiu Y.C., Tittiger C., Wicker-Thomas C., Goff G.L., Young S., Wajnberg E., Fricaux T., Taquet N., Blomquist G.J., Feyereisen R. An insect-specific P450 oxidative decarbonylase for cuticular hydrocarbon biosynthesis. Proc. Natl. Acad. Sci. USA. 2012;109:14858–14863. doi: 10.1073/pnas.1208650109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Liu N.M., Li Y., Gong F., Liu T., Li T. Cytochrome P450s–Their expression, regulation, and role in insecticide resistance. Pestic. Biochem. Physiol. 2015;120:77–81. doi: 10.1016/j.pestbp.2015.01.006. [DOI] [PubMed] [Google Scholar]
  • 39.Vontas J., Blass C., Koutsos A.C., David J.P., Kafatos F.C., Louis C., Hemingway J., Christophides G.K., Ranson H. Gene expression in insecticide resistant and susceptible Anopheles gambiae strains constitutively or after insecticide exposure. Insect Mol. Biol. 2005;14:509–521. doi: 10.1111/j.1365-2583.2005.00582.x. [DOI] [PubMed] [Google Scholar]
  • 40.Ali E. Study on Buprofezin Resistance and Its Metabolic Mechanism in SOGATELLA furcifera (Horvath) Huazhong Agricultural University; Wuhan, China: 2019. [Google Scholar]
  • 41.Li K.L., Fu Q., Wang W.X., Lai F.X., Wan P.J. Molecular cloning and functional characterization of Halloween genes involved in ecdysteroid biosynthesis in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae) Acta Entomol. Sin. 2017;60:1129–1140. [Google Scholar]
  • 42.Elzaki M.E.A., Pu J., Zhu Y.X., Zhang W.F., Sun H., Wu M., Han Z.J. Cross-resistance among common insecticides and its possible mechanism in Laodelphax striatellus Fallén (Hemiptera: Delphacidae) Orient. Insects. 2018;52:2–15. doi: 10.1080/00305316.2017.1316784. [DOI] [Google Scholar]
  • 43.Zhang Y., Yang Y., Sun H., Liu Z. Metabolic imidacloprid resistance in the brown planthopper, Nilaparvata lugens, relies on multiple P450 enzymes. Insect Biochem. Mol. Biol. 2016;79:50–56. doi: 10.1016/j.ibmb.2016.10.009. [DOI] [PubMed] [Google Scholar]
  • 44.Xu L., Wu M., Han Z.J. Overexpression of multiple detoxification genes in deltamethrin resistant Laodelphax striatellus (Hemiptera: Delphacidae) in China. PLoS ONE. 2013;8:e79443. doi: 10.1371/journal.pone.0079443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Mao K.K., Ren Z.J., Li W.H., Cai T.W., Qin X.Y., Wan H., Jin B.R., He S., Li J.H. Carboxylesterase genes in nitenpyram-resistant brown planthoppers, Nilaparvata lugens. Insect Sci. 2021;28:1049–1060. doi: 10.1111/1744-7917.12829. [DOI] [PubMed] [Google Scholar]
  • 46.Wei P., Shi L., Shen G.M., Xu Z.F., Liu J.L., Pan Y., He L. Characteristics of carboxylesterase genes and their expression-level between acaricide-susceptible and resistant Tetranychus cinnabarinus (Boisduval) Pestic. Biochem. Physiol. 2016;131:87–95. doi: 10.1016/j.pestbp.2015.12.007. [DOI] [PubMed] [Google Scholar]
  • 47.Gao H.L., Lin X.M., Yang B.J., Liu Z.W. The roles of GSTs in fipronil resistance in Nilaparvata lugens: Over-expression and expression induction. Pestic. Biochem. Physiol. 2021;177:104880. doi: 10.1016/j.pestbp.2021.104880. [DOI] [PubMed] [Google Scholar]
  • 48.Zhou W.W., Li X.W., Quan Y.H., Cheng J.A., Zhang C.X., Gurr G., Zhu Z.R. Identification and expression profiles of nine glutathione S-transferase genes from the important rice phloem sap-sucker and virus vector Laodelphax striatellus (Fallén) (Hemiptera: Delphacidae) Pest Manag. Sci. 2012;68:1296–1305. doi: 10.1002/ps.3297. [DOI] [PubMed] [Google Scholar]
  • 49.Puinean A.M., Denholm I., Millar N.S., Nauen R., Williamson M.S. Characterisation of imidacloprid resistance mechanisms in the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae) Pestic. Biochem. Physiol. 2010;97:129–132. doi: 10.1016/j.pestbp.2009.06.008. [DOI] [Google Scholar]
  • 50.Kim J.I., Kwon M., Kim G.H., Kim S.Y., Lee S.H. Two mutations in nAChR beta subunit is associated with imidacloprid resistance in the Aphis gossypii. J. Asia-Pac. Entomol. 2015;18:291–296. doi: 10.1016/j.aspen.2015.01.010. [DOI] [Google Scholar]
  • 51.Zhang H.H., Yang H.L., Dong W.Y., Gu Z.X., Wang C.C., Chen A.Q., Shi X.Y., Gao X.W. Mutations in the nAChR β1 subunit and overexpression of P450 genes are associated with high resistance to thiamethoxam in melon aphid, Aphis gossypii Glover. Comp. Biochem. Physiol. Part B. 2022;258:110682. doi: 10.1016/j.cbpb.2021.110682. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The data supporting the conclusion of this paper have been reflected in the main text. The original data can be obtained from the corresponding authors.


Articles from Insects are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES