Skip to main content
Biotechnology for Biofuels and Bioproducts logoLink to Biotechnology for Biofuels and Bioproducts
. 2022 Sep 24;15:99. doi: 10.1186/s13068-022-02197-9

Enhanced productivity of extracellular free fatty acids by gene disruptions of acyl-ACP synthetase and S-layer protein in Synechocystis sp. PCC 6803

Kamonchanock Eungrasamee 1, Peter Lindblad 2, Saowarath Jantaro 1,
PMCID: PMC9509626  PMID: 36153604

Abstract

Background

Based on known metabolic response to excess free fatty acid (FFA) products, cyanobacterium Synechocystis sp. PCC 6803 preferentially both recycles via FFA recycling process and secrets them into medium. Engineered cyanobacteria with well growth and highly secreted FFA capability are considered best resources for biofuel production and sustainable biotechnology. In this study, to achieve the higher FFA secretion goal, we successfully constructs Synechocystis sp. PCC 6803 mutants disrupting genes related to FFA recycling reaction (aas gene encoding acyl–acyl carrier protein synthetase), and surface layer protein (encoded by sll1951).

Results

Three Synechocystis sp. PCC 6803 engineered strains, including two single mutants lacking aas (KA) and sll1951 (KS), and one double mutant lacking both aas and sll1951 (KAS), significantly secreted FFAs higher than that of wild type (WT). Certain increase of secreted FFAs was noted when cells were exposed to nitrogen-deficient conditions, BG11-half N and BG11-N conditions, with the exception of strain KS. Under BG11-N condition at day 10, strain KAS strikingly secreted FFAs products up to 40%w/DCW or 238.1 mg/L, with trace amounts of PHB. Unexpectedly, strain KS, with S-layer disruption, appeared to have endured longer in BG11-N growth medium. This strain KS significantly acclimated to the BG11-N environment by accumulating a greater glycogen pool with lower FFA production, whereas strain KA favored higher PHB and intracellular lipid accumulations with moderate FFA secretion.

Conclusions

Mutations of both aas and sll1951 genes in Synechocystis sp. PCC 6803 significantly improved the productivity of secreted FFAs, especially under nitrogen deprivation.

Keywords: Free fatty acid secretion, Synechocystis sp. PCC 6803, S-layer protein, Acyl–acyl carrier protein synthetase, Nitrogen deprivation

Background

Despite the fact that biofuels presently are more expensive than fossil fuels, their production is growing at an exponential rate across the world. The biotechnological use of cyanobacteria for biofuel production has been classified as third and fourth generations of bioresources generating products, such as biodiesel, alka(e)ne, polyhydroxybutyrate (PHB), fatty alcohols, and energy-containing biomolecules of fatty acids and lipids [14]. In the field of biofuel biotechnology, the capacity of cyanobacteria to secrete free fatty acids (FFA) into the growth medium has shown to be useful in omitting the biofuel extraction process. Known strategies to enhance FFA secretion in cyanobacteria and green algae involves stressed environment effect, such as osmotic pressure, temperature, pH, and deprived nutrients, or genetically metabolic engineering, or a combination of the two [59]. In cyanobacteria, the cellular response mechanisms to FFAs toxicity as a result of accumulations are FFA secretion, FFA recycling, storage [9], and FFA degradation found in yeast and bacteria [1012]. Genetically modified cyanobacteria with increased FFA secretion have been mainly observed when overexpressing genes related to thioesterase (tesA), catalyzing the conversion of fatty acyl–acyl carrier protein (ACP) to FFA [13], or lipase A (lipA), catalyzing membrane lipid degradation [9] as well as when disrupting aas encoding fatty acyl-ACP synthetase [9, 14, 15]. On the other hand, weakening cell walls of Synechocystis 6803 resulted in increased FFA secretion by disturbing genes related to the surface protein S-layer and the peptidoglycan assembly protein, PBP2 [13].

In cyanobacteria, the main substrate for FFA production is acetyl-CoA, a pyruvate intermediate, which is further converted in various pathways, such as the TCA cycle, polyhydroxybutyrate (PHB) synthesis, and fatty acid synthesis via FASII, see Fig. 1. The fatty acyl-ACP intermediate from the FASII system is converted to membrane lipids by phosphotransacylase-type enzymes PlsX (slr1560), PlsC (sll1848), and PlsY [6, 13, 16]. For membrane lipid hydrolysis, the lipase A enzyme, encoded by lipA (sll1969), is capable of releasing free fatty acids inside the cells [3, 8, 9, 17]. The FFAs recycling to fatty acyl-ACP occurs via a fatty acyl-ACP synthetase, encoded by aas (slr1609) [3]. Moreover, excess of FFAs may be secreted by rapidly flip–flopping the un-ionized form of FFA through protein channels of membranes, such as efflux transmembrane transporters (sll0180 and slr2131) [18, 19]. For the surface layer (S-layer) on cell walls of cyanobacteria, its disruption results in increased FFA secretion [13]. The functions of S-layer proteins are mainly involved in carbon capture and storage (CCS) and CO2 diffusion through the cell membranes in relation to bicarbonate (HCO3) in Synechocystis sp. PCC6803 [20]. This S-layer protein has a supportive role for cell wall integrity in Synechocystis without any lethal effect in a Δsll1951 strain [21]. The carbon storage form of glycogen, glycogen is synthesized from glucose-1-phosphate (G1P) and ADP-glucose intermediates via glucose-1-phosphate adenylyltransferase (glgC) and glycogen synthase (glgA1 and glgA2), respectively, whereas its degradation is catalyzed by glycogen phosphorylase (glgP) and isoamylase (glgX) [22]. Under nitrogen deficiency condition, the glycogen pool may eventually be degraded to produce the other carbon storage form polyhydoxybutyrate (PHB) [22, 23]. To cope with environmental stresses with induced cells accumulating energy storage, the cyanobacterial PHB is preferentially produced from acetyl-CoA through multiple enzymes including acetyle-CoA acetyltransferase (phaA), acetoacetyl-CoA reductase (phaB), and the heterodimeric PHB synthase (phaEC) [2427].

Fig. 1.

Fig. 1

Overview of the production of lipids and free fatty acid (FFA), and FFA secretion into the growth medium in the cyanobacterium Synechocystis sp. PCC 6803 (modified from [9, 36]). Abbreviations of genes: accDACB, a multisubunit acetyl-CoA carboxylase gene; aas, acyl-ACP synthetase; glgA, glycogen synthase; glgC, ADP-glucose pyrophosphorylase; glgP, glycogen phosphorylase; glgX, glycogen isoamylase; glpD, glycerol-3-phosphate dehydrogenase; lipA, a lipolytic enzyme-encoding gene; phaA, β-ketothiolase; phaB, acetoacetyl-CoA reductase; phaEC, the heterodimeric PHB synthase; plsX and plsC, putative phosphate acyl-transferases; RuBisCO, the RuBisCO gene cluster including rbcLSX, encoding RuBisCo large, small and chaperone subunits, respectively; sll1951, the surface (S) layer protein. Abbreviations of intermediates: DHAP, dihydroxyacetone phosphate; FASII, fatty acid synthesis type II; fatty acyl-ACP, fatty acyl–acyl carrier protein; FFAs, free fatty acids; G1P, glucose 1-phosphate; G6P, glucose 6-phosphate; Gro3P, glycerol-3-phosphate; 3PG, 3-phosphoglycerate; PHB, polyhydroxybutyrate; RuBP, ribulose-1,5-bisphosphate; TCA cycle, Tricarboxylic acid cycle

In this study, we successfully created genetically engineered Synechocystis sp. PCC 6803 strains with high production of FFAs secreted into the growth medium using knockout (K) mutations of aas (A) and/or sll1951 (S), genes encoding fatty acyl-ACP synthetase and S-layer protein, respectively, resulting in strains KA, KS, and KAS. We discovered that a considerable long-term adaptation of the KS strain to nitrogen deprivation (BG11-N) resulted in increased glycogen storage with a comparable PHB pool and decreased FFA production when compared to Synechocystis sp. PCC 6803 wild type (WT) cells. Interestingly, the double mutant of the KAS strain released at least 5 times more FFAs than wild type cells while having the lowest PHB accumulation during nitrogen deprivation. The KA strain accumulated more intracellular lipids than the KAS strain, but secreted less FFA. Among all strains investigated, the KA strain showed the highest level of PHB under BG11-N condition.

Results

Synechocystis sp. PCC 6803 engineered strains and their growth under stress conditions

First, the sll1951 gene of WT and KA strains (Table 1) was disrupted through the integral insertion of a 0.9 kb fragment of a kanamycin cassette gene (kmr) to generate a knockout of sll1951 (KS) and a knockout of aas/sll1951 (KAS) strains (Fig. 2A). To confirm the segregation and location of the insertions (Fig. 2B, C), PCRs using gDNA of each strain as template and selected specific primers were performed (Table 2). Both strains KS and KAS contained the kmr fragment with a size of about 0.9 Kb, compared to those of WT and KA with kmr fragment, Fig. 2B-a, C-a. In addition, PCR products with Sll1951_F and Sll1951_R primers confirmed the correct size of 3.0 Kb in strain KS, whereas it was 2.1 Kb in WT (Fig. 2B-b). The Sll1951_UF and Km_SR primers confirmed the expected size of about 1.1 Kb in strain KAS comparing with no band in WT (Fig. 2C-b). When we amplified the fragment by primers Sll1951_UF and Sll1951_R, the PCR products gave a 3.2 Kb band in both KS and KAS strains, while it showed a 2.3 Kb band in the WT (Fig. 2B-c, C-c).

Table 1.

Strains and plasmids used in this study

Name Relevant genotype Reference
Cyanobacterial strains
Synechocystis sp. PCC 6803 Wild type Pasteur culture collection
Control WT (WTc) cmr and kmr integrated at region of native psbA2 gene in Synechocystis genome [9]
KA cmr integrated at region of native aas gene in Synechocystis genome [9]
KAOL

cmr integrated at region of native aas gene in Synechocystis genome

lipA, kmr integrated at region of native psbA2 gene in Synechocystis genome

[9]
KS

kmr integrated at region of native sll1951 gene in Synechocystis genome

glpD, Rubisco; rbcL,rbcX, rbcS, kmr integrated at region of native Rubisco gene in Synechocystis genome

This study
KAS

kmr integrated at region of native sll1951 gene in Synechocystis genome

cmr integrated at region of native aas gene in Synechocystis genome

This study
Plasmids
pJSKm PT7sll1951-cmr; plasmid containing kmr between the flanking region of sll1951 gene This study

Fig. 2.

Fig. 2

Genomic maps of the engineered Synechocystis sp. PCC 6803 strains, KS and KAS. A Double homologous recombination occurred between the conserved sequences of sll1951 or S-layer gene on the recombinant pJSKm plasmid containing an antibiotic kanamycin resistant cassette (Kmr) and genomic DNA of WT or KA host strain, generating KS or KAS strain, respectively. Confirmations of engineered strains were performed by PCR analysis using selected pairs of specific primers (shown in Table 2). For (B) KS strain; Lane M: GeneRuler DNA ladder (Fermentus); Lane 1: Negative control using WT as template (a–c), a Lanes 2–3: clone numbers 1 to 2 using Km_F and Km_R primers, b Lanes 2–3: clone numbers 1 to 2 using Sll1951_F and Sll1951_R primers, and c Lanes 2–4: clone numbers 1 to 3 using Sll1951_UF and Sll1951_R primers, and only positive clones (numbers 2 and 3) were selected for next experiments. For (C) KAS strain. Lane M: GeneRuler DNA ladder (Fermentus); Lane 1: Negative control using KA as template (a–c), a Lanes 2–5: clone numbers 1 to 4 using Km_F and Km_R primers, b Lanes 2–5: clone numbers 1 to 4 using Sll1951_UF and Km_SR primers, and c Lane 2: clone number 1 using Sll1951_UF and Sll1951_R as the primers, and only positive clone number 1 was selected for next experimentsq4

Table 2.

Primers used in this study

Name Sequence (5ʹ to 3ʹ) Purpose of primer Expected size Cycles/Tm Reference
Km_FKpnI TAGAGAGGTACCTTAGAAAAACTCATCGAG CA PCR for kmr 939 30/60.0 °C This study
Km_RKpnI TAGAGAGGTACCGTGTCTCAAAATCTCTGATG PCR for kmr This study
Km_SR TAGAGATCAGTCGTCACTCATGGTGA PCR for kmr This study
Sll1951_F TAGAGAGTGGAAGATGCAAAT ATACT PCR for sll1951 1980 35/56.3 °C This study
Sll1951_R TAGAGAGGCGCTATCACT GGTAAAAG PCR for sll1951 This study
Sll1951_UF TAGAGAGTGGAAATTGCG GCTTCC CT PCR for sll1951 This study
RTglgX_F360 GAGCTTCATCGAGGACGGAA RT-PCR for glgX 360 35/56.0 °C (BG11) This study
RTglgX_R360 GCCCGAATTGGGGTTGCGGG RT-PCR for glgX 30/56.0 °C (BG11-N)
RTphaA_F420 TCAGCCGGATAGAATTGGACG AAGT RT-PCR for phaA 420 35/53.5 °C (BG11) [8]
RTphaA_R420 CAAACAAGTCAAAATCTGCCA GGGTT RT-PCR for phaA 30/53.5 °C (BG11-N)
RTlipA_F379 TTGGCGGAGCAAGTGAAGCAAT RT-PCR for lipA 379 34/55.0 °C (BG11) [8]
RTLipA_R379 CATGGACCAGCACAGGCAAAAT RT-PCR for lipA 28/55.0 °C (BG11-N)
RTaccA_F428 ATGCACGGCGATCGAGGAGGT RT-PCR for accA 428 35/58.0 °C (BG11) [8]
RTaccA_R428 TGGAGTAGCCACGGTGTACAC RT-PCR for accA 32/58.0 °C (BG11-N)
RT16sRNA_F521 AGTTCTGACGGTACCTGATGA RT-PCR for 16 s 521 24/56.0 °C (BG11) [8]
RT16sRNA_R521 GTCAAGCCTTGGTAAGGTTAT RT-PCR for 16 s 22/56.0 °C (BG11-N)
RTaas_F307 GTGGTTTATCGCCGATCAAG RT-PCR for aas 307 38/54.5 °C (BG11) [8]
RTaas_R307 TTCCTGGCGGGGAACGGGAG RT-PCR for aas 33/54.5 °C (BG11-N)
RTPlsX_F AAGGGGTGGTGGAAATGGAA RT-PCR for PlsX 488 35/52.7 °C (BG11) [6]
RTPlsX_R AAGTAGGTCCCTTCCTTCGG RT-PCR for PlsX 32/52.7 °C (BG11-N)

Cell growths of the KA and KAS strains were lower than that of the wild type (WT) cells under BG11 growth conditions, although the KS strain exhibited a similar tendency as WT (Fig. 3A). It was intriguing to see that the oxygen evolution rates of all engineered strains were significantly higher than those of WT cells (Fig. 3B). Furthermore, the KS strain accumulated equivalent levels of chlorophyll a and carotenoids as the WT strain (Fig. 3C, D). The KA and KAS strains showed lower quantities of chlorophyll a and carotenoids, in agreement with their respective growth. On the other hand, all strains could grow similar to WT in BG11 with half concentration of NaNO3 (BG11-half N), with the exception of the KAS strain, which showed a slightly lower growth after 9 days (Fig. 4A). Under this growth condition, the KA and KS strains contained more chlorophyll a and carotenoids after 9 days (Fig. 4B, C). Images of cell culture in BG11-half N clearly demonstrated that strain KAS showed a lighter green color than the other strains (Fig. 4D), reflected in a lower chlorophyll a content (Fig. 4B). In line with growth and chlorophyll a content, KS and KA cell cultures showed a more deep green color under half N growth condition. When BG11 lacking NaNO3 condition (or BG11-N) was applied to all strains (Fig. 5). Strain KS showed the highest growth level (Fig. 5A). The chlorophyll a levels were comparable between the strains, with the exception of KAS which contained a lower amount (Fig. 5B). However, the carotenoid levels were relatively stable under BG11-N condition (Fig. 5C). It is clear from the images of cell cultures grown in BG11-N that all engineered strains remained green for at least 3 days before becoming yellow compared to WT cells, particularly strain KS (Fig. 5D). The KAS strain had a deep yellowish cell culture from days 5 to 7, whereas strain KS strain showed a deep yellowish cell culture from days 5 to 15.

Fig. 3.

Fig. 3

Growth curve (A), oxygen evolution rate (B), chlorophyll a content (C), and carotenoid content (D) of WT, KS, KA, and KAS Synechocystis sp. PCC 6803 strains cultured in BG11 medium for 14 days. In (A), (C), and (D), the error bars represent standard deviations of means (mean ± S.D., n = 3). In (B), the oxygen evolution rate was measured using log phase-growing cells (5 days). Data represent mean ± S.D., n = 3. Means with the same letter are not significantly different with the significance level at P < 0.05

Fig. 4.

Fig. 4

Growth curve (A), chlorophyll a content (B), carotenoid content (C), and images of cultured flasks of WT, KS, KA, and KAS Synechocystis sp. PCC 6803 strains cultured in BG11 containing 8.8 mM NaNO3 medium (BG11-half N) during 15 days of cultivation. The error bars represent standard deviations of means (mean ± S.D., n = 3)

Fig. 5.

Fig. 5

Growth curve (A), chlorophyll a content (B), carotenoid content (C), and images of cultured flasks of WT, KS, KA, and KAS Synechocystis sp. PCC 6803 strains cultured in BG11 without the addition of NaNO3 medium (BG11-N) during 15 days of cultivation. The error bars represent standard deviations of means (mean ± S.D., n = 3)

Contents of intracellular lipids, extracellular FFAs, PHB and glycogen under normal and stressed conditions

All engineered strains secreted more FFAs into the BG11 growth medium, Table 3. Strains KA and KAS notably contained higher total amounts of intracellular lipids and extracellular FFAs by about 35.8 and 39.0%w/DCW, respectively, than WT cells (23.6%w/DCW), in particular at day 5. In addition, we observed that all engineered strains had certain total yields (mg/L) that were higher than WT at days 5 and 10, particularly in strain KAS produced about 178.5 and 336.9 mg/L, respectively (Table 3). After exposing the cells to reduced levels of nitrogen (BG11-half N), all engineered strains produced higher levels of intracellular lipids than observed in WT cells, in particular strain KA at day 5 and KAS at day 10 with 39.0 and 44.8%w/DCW, respectively (Fig. 6A). The certain increase of FFA secretion of all engineered strains was also noted under this condition with the highest level in strain KAS at day 10, about 28.2%w/DCW (Fig. 6B), representing 376.2 mg/L or 53.3 mg/1011 cells (Table 4). On the other hand, when the strains were grown in BG11-N medium, we discovered that the KS strain accumulated extracellular FFAs at the same level, either %w/DCW or mg/L, as the WT, whereas the KA and KAS strains showed increased level (Fig. 6B and Table 4). The results indicate that strain KAS preferentially secreted FFAs into medium up to 40.4%w/DCW or 238.1 mg/L after a long period (10 days) of nitrogen deprived condition (BG11-N) rather than accumulated intracellular lipids (30.4%w/DCW) when compared to strain KA, 45.5 and 18.0%w/DCW% of intracellular lipids and extracellular FFAs contents, respectively (Fig. 6A–C).

Table 3.

Yields of intracellular lipids and extracellular FFAs of all strains under normal BG11 condition

Strains Contents (%/DCW) Yields (mg/L) Note
Intracellular lipids (A) Extracellular FFAs (B) Total
(A) + (B)
Intracellular lipids (A) Extracellular FFAs (B) Total
(A) + (B)
Start of cultivation
WT 12.4 ± 1.13a 1.53 ± 0.22f 13.9 ± 1.35a,c 7.69 ± 0.23A 0.68 ± 0.05F 8.37 ± 0.28E This study
KS 10.9 ± 0.50a 4.46 ± 0.12g 15.4 ± 0.62c 5.45 ± 0.25B 0.89 ± 0.02G 6.34 ± 0.27D This study
KA 17.6 ± 0.24b 4.52 ± 1.17g 22.1 ± 1.41e 10.6 ± 0.14C 1.35 ± 0.35H 11.9 ± 0.49J,C [9]
KAS 18.1 ± 1.27b 7.42 ± 0.66h 25.5 ± 1.93k 10.8 ± 1.36C 2.22 ± 0.20I 13.0 ± 1.56K,J,C This study
Day 5 of cultivation
WT 16.7 ± 1.37b,c 6.8 ± 1.35g,h 23.6 ± 2.72d,e,k 126.9 ± 7.26Q 7.81 ± 1.64A,D 134.7 ± 8.90Q,R This study
KS 17.2 ± 1.24b,c 11.1 ± 1.25a 28.3 ± 2.49k,l 154.2 ± 14.6S 15.0 ± 1.62K 169.2 ± 16.2T This study
KA 20.6 ± 0.65d 15.2 ± 1.12c 35.8 ± 1.77m,n 137.4 ± 0.57R 21.1 ± 0.84L 158.5 ± 1.41S [9]
KAS 23.0 ± 0.48e 16.0 ± 1.02c 39.0 ± 1.50n 155.8 ± 0.87S 22.7 ± 2.16L 178.5 ± 3.03T This study
Day 10 of cultivation
WT 15.5 ± 0.52c 5.6 ± 0.46g 21.1 ± 0.97d 143.2 ± 5.30R,S 31.0 ± 1.91M 174.2 ± 7.21T This study
KS 19.2 ± 1.42b,d 9.1 ± 0.49j 28.3 ± 1.91k,l 177.1 ± 15.0T 50.1 ± 2.37N 227.2 ± 17.4U This study
KA 16.4 ± 0.79b,c 13.9 ± 0.64a 30.3 ± 1.43l 255.2 ± 20.0V,U 108.4 ± 11.4P 363.6 ± 31.4W [9]
KAS 16.3 ± 0.48b,c 12.1 ± 1.02a 28.4 ± 1.50k,l 245.2 ± 15.8V,U 91.7 ± 10.7P 336.9 ± 26.5W This study

Data represent mean ± S.D., n = 3. For superscript, means with the different letter are significantly different with the significance level at P < 0.05

Fig. 6.

Fig. 6

Contents of total intracellular lipids (A) and extracellular FFAs (B), and total contents of total intracellular lipids and extracellular FFAs (C) of WT, KS, KA, and KAS Synechocystis sp. PCC 6803 strains growing in BG11-half N and BG11-N at 0, 5 and 10 days, respectively. The error bars represent standard deviations of means (mean ± S.D., n = 3). Means with the same letter are not significantly different with the significance level at P < 0.05

Table 4.

Yields of extracellular FFAs of all strains under normal BG11, BG11-half N, and BG11-N condition

Strains Extracellular FFA titer (mg/L) Extracellular FFA (mg/1011 cells)
Start Day 5 Day 10 Start Day 5 Day 10
BG11-half N condition
WT 0.53 ± 0.12a 18.21 ± 6.10h 29.52 ± 5.73k 1.46 ± 0.19A 6.11 ± 1.99D 5.30 ± 1.09D
KS 1.20 ± 0.09c 28.81 ± 6.55j,i 101.43 ± 8.05q 2.17 ± 0.09B 9.93 ± 2.58E 17.8 ± 1.80F
KA 1.25 ± 0.02d,c 92.38 ± 19.25m 182.54 ± 10.80r 2.43 ± 0.59B 34.3 ± 6.80I,H 32.0 ± 1.05I
KAS 1.73 ± 0.07e 62.38 ± 2.18l 376.19 ± 63.57t 4.04 ± 0.28C,D 20.0 ± 0.64G,F 53.3 ± 0.46J
BG11-N condition
WT 0.77 ± 0.08a 6.81 ± 1.66g 30.24 ± 7.33k 1.72 ± 0.18A 13.6 ± 3.01E 15.1 ± 3.39F,E
KS 1.04 ± 0.15b 8.24 ± 1.20g 32.14 ± 7.56k 2.54 ± 0.38B 7.26 ± 1.29D 7.11 ± 2.06D,E
KA 1.19 ± 0.02c,b 34.57 ± 4.88k 65.87 ± 3.64p 2.67 ± 0.08B 28.9 ± 4.78I,H 32.9 ± 1.72I
KAS 1.73 ± 0.02e 22.86 ± 1.78i 238.10 ± 36.67s 3.94 ± 0.13C 23.9 ± 1.82H 149 ± 22.6K

Data represent mean ± S.D., n = 3. For superscript, means with the different letter are significantly different with the significance level at P < 0.05

We also determined polyhydroxybutyrate or PHB contents of all strains under BG11, BG11-half N, and BG11-N growth conditions at day 10 (Fig. 7A). Unexpectedly, a substantial increase in PHB content occurred in all strains under BG11-N conditions, with the exception of strain KAS, which showed a low level equivalent to that under BG11 condition. Not all strains were affected by the BG11-half N condition, only strain KAS showed a 2.3 fold-increase in PHB accumulation when compared to WT cells. On the other hand, the glycogen content of all engineered strains were higher than in WT cells under BG11 condition, especially in strain KA with 21.4%w/DCW (Fig. 7B). It is worthy to note that the BG11-half N condition highly induced the glycogen accumulation in all strains examined. The KA strain accumulated significantly more glycogen up to 65.1%w/DCW. When the BG11-N condition was applied, the increased levels of glycogen were observed in strains KS and KAS, compared to under BG11 medium. It is interesting that strain KS showed similar glycogen content under both BG11-half N and BG11-N growth conditions.

Fig. 7.

Fig. 7

Contents of polyhydroxybutyrate (PHB) (A) and glycogen (B) of Synechocystis sp. PCC 6803 WT, KS, KA, KAS, and KAOL strains cultured under BG11-half N and BG11-N at day 10. The error bars represent standard deviations of means (mean ± S.D., n = 3). Means with the same letter are not significantly different with the significance level at P < 0.05

Moreover, transcript levels of genes related to fatty acid synthesis, its degradation, PHB synthesis and glycogen degradation were monitored in cells at day 10 of growth (Fig. 8). Under BG11 condition (Fig. 8A), the accA transcript levels, related to the initial step of fatty acid synthesis, were slightly increased in strains KA and KAS. The plsX transcript level, which is related to membrane lipid synthesis, was greatly elevated in strain KAS. The lipA transcript levels, related to membrane lipid hydrolysis, were increased in strains KS and KA but decreased in strain KAS. For PHB synthesis, the phaA transcript levels were slightly upregulated in all engineered strains corresponded to higher PHB contents when compared to WT cells. The glgX transcript amounts, related to glycogen degradation, showed a significant upregulation in strain KS, whereas decreased levels were observed in strains KA and KAS, compared to WT cells under BG11 growth condition. In addition, similar aas transcript levels, related to FFA recycling reaction, of WT and KS cells were observed. On the other hand, the higher ratio values of transcript/16 s band intensity of accA, aas, phaA and glgX in WT cells were noted under BG11-N condition when compared to those under BG11 condition, in Fig. 8B. The transcript levels of accA, aas, plsX, lipA, phaA and glgX in strain KS were higher than those in WT cells. For strain KA, only the lipA transcript level was increased, whereas similar or decreased levels were observed for the other genes.

Fig. 8.

Fig. 8

Transcript levels of genes including glgX, phaA, accA, aas, plsX, lipA and 16S rRNA of WT, KS, KA, and KAS Synechocystis sp. PCC 6803 strains under BG11 (A) and BG11-N (B) conditions. Cell culture at day 10 of treatment were harvested and analyzed. On the right hand side, the relative intensity ratios of each gene/16S rRNA were analyzed by GelQuant.NET program. Data represent mean ± S.D., n = 3. Means with the same letter are not significantly different with the significance level at P < 0.05

Discussion

To increase free fatty acid (FFA) secretion, genetically engineered cyanobacteria are considered as a promising option. However, FFAs secretion as a consequence of excessive production of FFAs may generate toxicity and damage the cells by randomly diffuse across the membranes, in particular short chain FFAs, generating reactive oxygen species (ROS) and a highly oxidative stressful environment for the cells [2830]. Some recent reports addressed the crucial consequences associated with higher FFA secretion after modifying the cyanobacterium Synechocystis sp. PCC6803 by gene disruption, such as aas, sll1951 encoding surface layer (S-layer) protein, and slr1710 encoding peptidoglycan assembly protein, or by overexpression of heterologous tesA encoding thioesterase, or combination strategies of aas inactivation either with tesA or lipA overexpression [9, 1315]. In this study, we created a Synechocystis sp. PCC6803 engineered strain with double gene disruptions of aas and sll1951, encoding S-layer, resulting in significantly increased secreted FFA content under nitrogen deprived conditions.

The hemolysin-like protein (HLP) Sll1951, surface layer protein (S-layer), is the outermost cell component in archaea and bacteria (Fig. 1). Especially, in Gram-negative bacteria including cyanobacteria, the S-layers are closely associated with the lipopolysaccharide on the outer membrane, while some S-layers in archaea are mushroom-like subunits (reviewed in [31]). Recently, several functions of S-layer in cyanobacteria have been addressed including a barrier against the adsorption of some toxic compounds and antibiotics, such as CdCl2, CuSO4, antibiotics (kanamycin, ampicillin), a component related to mobility in some motile species, a template of natural mineral formation process on surface in some species living in high mineral habitats [3234]. The sll1951 deletion mutation in Synechocystis 6803 had similar growth rate and carotenoid content to WT cells under photoautotrophic growth condition [21]. This is in agreement with our result under BG11 growth condition, strain KS or Synechocystis lacking sll1951, grew-like WT cells with similar accumulation of both chlorophyll a and carotenoids, except higher photosynthetic efficiency (Fig. 3). A S-layer disruption in Synechocystis did not generate any severe effects on cell growth and photosynthesis. More strikingly, we observed increased growth of strain KS grown in BG11 without NaNO3 (BG11-N) medium with green colored cell cultures (Fig. 5). As known for cyanobacterial chlorosis process, cells turn blue–green to yellow color during nitrogen deprivation, because phycobilisomes, as well as chlorophyll a, are degraded leading to decreased photosynthetic activities [3537]. Therefore, our observations indicate that the lack of S-layer may enhance the exchange or transport activities of some essential compounds which consequently helps the cells to survive under nitrogen deprived conditions. Although it was previously shown that the Δsll1951 mutant of Synechocystis sp. PCC 6803 may secret high quantities of protein into the medium [22], further experimental data and research are still needed to determine how nitrogen deprivation and S-layer disruption are related. For the other aspect, the strain KS, Synechocystis lacking the S-layer protein, may thrive better in lower nitrogen environments, since the production of the S-layer protein certainly consumes substantial amounts of nitrogen. In addition, although we found a lower cell growth under BG11 condition of both strains KA, Synechocystis lacking aas gene, and KAS when compared with WT cells, they all showed similar growth under BG11-N condition.

We demonstrate a significant increase of intracellular lipids and FFA secretion in all engineered strains (Table 3). It was worth to note that strain KAS showed the highest capacity to produce total contents of intracellular lipids and secreted FFAs, about 39.0%w/DCW or 178.5 mg/L at day 5, when compared, e.g., with strain KA [9]. Although strain KS secreted a lower level of FFAs, about 11.1%w/DCW or 15.0 mg/L compared to the other engineered strains, a higher FFA secretion was noted when compared to WT cells at days 5 and 10, in agreement with a previous report of a Δsll1951 strain of Synechocystis sp. PCC 6803 with higher FFA secretion [13]. Under BG11 growth condition, the aas and sll1951 gene disruptions slightly induced PHB accumulations when compared to that in WT cells but with a more significant increase in glycogen pool size, particularly in strain KA, about 21.4%w/DCW, 5.7 fold increase compared to WT cells (Fig. 7). This suggests that the deletion of aas, involved in FFA recycling process, can enhance the glycogen accumulation as carbon storage in Synechocystis. This is supported by the lower glgX transcript level, related to glycogen degradation, in strain KA compared to that in WT cells (Fig. 8A). For strain KS, the disruption of sll1951 seemed to stimulate glycogen and membrane lipid degradation, as evidently demonstrated by high glgX and lipA transcript levels compared to WT cells.

Nutrient (nitrogen) deficiency was addressed in this study to gain more understanding of carbon storage and fatty acid and lipids syntheses by applying BG11-half N and BG11-N growth conditions for 15 days (Figs. 4 and 5). For the BG11-half N condition, increased total contents of intracellular lipids and secreted FFAs were noted in all engineered strains compared to WT cells, particularly in strain KA at day 5 (60.0%w/DCW) and KAS (73.0%w/DCW) at days 5 and 10, respectively (Fig. 6A, B). Reduced nitrogen level (BG11-half N) did not significantly affect PHB content, except a lower level in strain KS and a higher content in strain KAS (Fig. 7A). The dramatic increase of glycogen accumulation was apparently induced by the lower nitrate condition employed, especially in strain KA (Fig. 7B). These results may suggest that higher glycogen accumulation contributes to higher growth and intracellular pigment contents under limited nitrogen supply, BG11-half N condition (Fig. 4), in agreement with earlier studies on glycogen metabolism under environmental stresses [38, 39]. Moreover, engineered strains, exposed to growth medium lacking nitrate (BG11-N), showed higher total levels of intracellular lipids and secreted FFAs, especially in strains KA and KAS, about 63.4 and 70.8%w/DCW, respectively, at day 10 (Fig. 6C). In Fig. 9, the summary of all engineered strains compared with WT was shown under BG11-N condition for 10 days. Strain KAS certainly secreted the highest level of FFAs, about 5.1 fold increase in comparison with WT and a 0.07 fold decrease in PHB accumulation (Figs. 6B, 7A and 9). While strain KS responded to N deprivation (BG11-N) by maintaining intracellular lipids in similar level to that of WT for 5 days, with enhanced carbon storages of glycogen, about 7.8 fold increase compared to WT, and decreased PHB levels, about 0.9 fold (Figs. 7 and 9). Only accA transcript level, involved in the initial step of fatty acid synthesis, was upregulated in KS and KAS strains (Figs. 8B and 9). Since nitrogen is a vital element substantially contributed in biomolecules and cofactors, its deficiency considerably affects cellular mechanisms which force cell coping to this stress for prolonging life by mainly synthesizing energy-containing molecules and increasing carbon or nitrogen source storage, such as glycogen, PHB, and lipid [37, 4043]. It was noted that the KA strain could cope nitrogen deprivation stress by relatively balancing its carbon storages, lipid and fatty acid syntheses, and FFA secretion (Fig. 9). However, the critical issue for FFA-producing cyanobacteria would result in a rich carbon supply for several other microorganisms. Aseptic production strategy on large scale are, therefore, essential for preventing contamination, and continuous fermentation would offer an appropriate solution.

Fig. 9.

Fig. 9

Summary of obtained results, products and gene expression levels, in the engineered strains compared to Synechocystis sp. PCC 6803 WT cells after 10 days of growth in BG11-N. Each box's number represents the fold of that value divided by WT. When compared to WT, the green and pink colored boxes show lower and higher folds of that product, respectively. For yellow and blue boxes represent lower and higher folds of that transcript amount when compared to WT, respectively

Conclusions

Increased levels of FFA secretion were achieved in engineered strains of Synechocystis sp. PCC 6803 (KA, KS, and KAS) by affecting the aas gene encoding acyl-ACP synthase in FFA recycling and sll1951 gene encoding surface layer of outer membranes resulting in significant increases of both intracellular lipids and secreted FFAs. Strain KAS with non-functional aas and sll1951, showed considerably a higher FFA-secreting under both BG11 and nitrogen deprived growth conditions (BG11-half N and BG11-N) with less PHB accumulation. Interestingly, disrupting the S-layer did not affect cell growth, it even improved under nitrogen deficiency conditions. FFA-producing and excreting cyanobacterial cells are promising cell factories for biotechnology applications including biofuel production.

Materials and methods

Strains and culture conditions

The host propagation, Escherichia coli DH5α strain, was grown either on agar plate or in liquid medium of Luria Bertani (LB) containing 35 µg/mL of kanamycin (Km) and 35 µg/mL of chloramphenicol (Cm) at 37 °C. Cyanobacterium Synechocystis sp. PCC 6803 cells were grown in BG11 medium on rotary shaker at 28 °C and continuous light illumination of 50 µmol photons m−2 s−1. Two engineered strains of Synechocystis KA (Δaas) and KAOL (KA with overexpressing lipA) were obtained as described previously [8, 9]. In this study, the Δsll1951 mutant (KS) and Δsll1951_Δaas mutant (KAS) were constructed (Table 1). All strains were cultured in BG11 medium containing 35 µg/mL of kanamycin and 35 µg/mL of chloramphenicol.

Constructions of recombinant plasmids

To construct the recombinant pJSKm plasmid, pJet1.2 blunt end vector was used to insert a kanamycin resistance cassette gene (kmr) fragment between sll1951 sequences. The sll1951 fragment with its designed size of about 1980 bp was amplified by PCR using a pair of primers; Sll1951_F and Sll1951_R (Table 2). After that, the sll1951 fragment was introduced into a pJet1.2 vector by blunt end ligation generating a pJetS vector. The antibiotic kanamycin resistance cassette gene (kmr) fragment was amplified by PCR using pEERM_Km vector from the previous study as the template [44], and used Km_FKpnI and Km_RKpnI as the primers (Table 2). Both of kmr fragment and pJetS vector were digested with the same restriction KpnI enzyme and subsequently ligated by T4 ligase, and generated the recombinant pJSKM plasmid (Table 1).

Transformation of Synechocystis cells

Two host cells including Synechocystis sp. PCC 6803 wild type (WT) and KA strains were grown in BG11 medium until an optical density of 0.3–0.5. The cells were harvested by centrifugation at 5000 rpm (2516 ×g) for 10 min. The cell pellets were washed by fresh BG11 medium and harvested by centrifugation at 5000 rpm (2516 ×g) for 10 min. The 1 µg of recombinant plasmids were separately added into condensed WT and KA cells and incubated at 28 °C for 6 h and inverted the tubes every 2 h. Then, the condensed cells were spread on a 0.45 µm sterile nitrocellulose membrane placed over BG11 agar plate overnight and then transferred that membrane to place over BG11 agar containing 35 µg/mL chloramphenicol or both of 35 µg/mL kanamycin and 35 µg/mL chloramphenicol depending on their host cells. Obtained colonies were collected and examined for gene location and segregation by PCR analysis using specific pairs of primers (Table 2).

Cell cultivation and nitrogen deficiency treatments

Cell culture with mid-log phase of growth was harvested by centrifugation at 6000 rpm (3622 ×g) for 10 min and transferred into various nitrogen deficiency conditions including BG11 medium containing 17.6 mM NaNO3, BG11 medium containing 50% NaNO3 concentration (8.8 mM NaNO3) or BG11-half N, and BG11 medium without NaNO3 (BG11-N). The OD730 at beginning of cultivation was about 0.1 and continuously cultured for 15 days.

Determinations of cell growth and pigment contents

Synechocystis cell growth was monitored by a spectrophotometer during cultivation. The pigment contents including chlorophyll a (chl a) and carotenoid were extracted and determined as described previously [45, 46]. One milliliter of cell culture was harvested and centrifuged at 6,000 rpm (3622 ×g) for 10 min. N,N-dimethylformamide (DMF) was added into a fraction of cell pellets to extract the pigments. After a quick centrifugation, the pigments in the supernatant were determined by measuring the absorbances (Abs) at 461, 625 and 664 nm using a spectrophotometer, and calculated according to [45, 46]. The results are normalized to cell numbers corresponding to 1.0 × 108 of the cells.

Measurement of oxygen evolution rate

Five mL of cell culture were centrifuged at 6000 rpm (3622 ×g) for 10 min. Cell pellets were resuspended by adding 2 mL of fresh BG11 medium and incubated in the darkness for 30 min. After that, the cell suspension was measured for oxygen evolution by Clark-type oxygen electrode (Hansatech instruments, UK) at room temperature (25 °C). The data in terms of the O2 evolution rate were presented as µmol/mg chlorophyll a/h.

Lipid extraction

Ten mL of cell culture was harvested by centrifugation at 6000 rpm (3622 ×g) for 10 min. Lipids, which are represented as intracellular lipids and extracellular free fatty acids, respectively, were extracted from the cell pellets and supernatant fraction. The lipids were extracted according to the Bligh and Dyer method [47] with slight modification. A glass tube containing cell pellets was filled with 1 mL of a 2:1 chloroform (CHCl3): methanol (CH3OH) solution, and the supernation fraction was added with a 5 mL solvent solution. The reaction mixture tube was then incubated in a water bath at 37 °C for 2 h. Then, one mL of 0.88% (v/v) potassium chloride (KCl) was added and vortexed for few seconds. After centrifugation of the reaction mixture tube at 3000 rpm (906 ×g) for 5 min, the lower organic phase containing lipids was collected. Then, the chloroform solvent was evaporated at 70 ºC.

Determinations of total lipid and free fatty acid contents

The total lipid and extracellular free fatty acid contents were determined by potassium dichromate oxidation reaction method [48]. The 0.5 mL of K2Cr2O7 (0.18 M) and sulfuric acid were added into the glass tube of extracted lipids. The reaction mixture was heated at 105ºC for 30 min. After the mixture was cooled down to room temperature, distilled water (0.5 mL) was added before measuring the absorbance at 600 nm (Abs600) using spectrophotometer. The canola oil was used as a commercial standard, prepared as same as sample. The unit of lipid content was represented by the percentage ratio of lipids to dry cell weight (%/wDCW). Dry cell weight (DCW) measurement was performed by dehydrating harvested cell pellets in the 60–70 °C oven until obtaining a constant dry weight.

Determination of PHB contents by HPLC

Five mL of cell culture were harvested by centrifugation at 6000 rpm (3622 ×g), 10 min. One hundred µL of adipic acid (20 mg/mL) and 800 µL of concentrated H2SO4 was added into the tube of cell pellets and further boiled at 100 °C for 1 h for converting of PHB to crotonic acid. After that, 50 µL of the reaction mixture was diluted with 1.20 mL of ultrapure water. Then, one mL of solution was filtered through PP Syringe filter 0.45 microns, 13 mm. and collected in a glass vial for HPLC analysis (Shimadzu HPLC LGE System, Japan). A carbon-18 column with inert sustain 3 µm (GL-Sciences, Japan) was used and performed with a flow rate of 1.0 mL/min. The running buffer was 30% (v/v) acetonitrile in 10 mM KH2PO4 at pH 2.3. The amount of crotonic acid was detected at 210 nm of UV detector. The commercial standard of crotonic acid was prepared as same as samples. The PHB content is represented as a percentage of PHB per dried cell weight (%w/DCW).

Determination of glycogen content

One mL of cell culture was harvested by centrifugation at 6000 rpm (3622 ×g), 10 min. Cell pellets were collected, and mixed with 600 µL of 30% (v/v) KOH. The mixture was then heated at 90 °C for 1 h. The supernatant was separated by centrifugation at 12,000 rpm (14,489 ×g) for 10 min, then it was transferred into a 1.5 mL microcentrifuge tube. After adding 900 mL of the absolute ethanol into the solution tube, it was incubated at − 20 °C for overnight to precipitate glycogen. The glycogen sediment fraction was harvested by centrifugation at 12,000 rpm (14,489 ×g) 4 °C for 10 min, and completely dried at 60 °C for overnight. After that, the sediment was dissolved with one mL of 10% (v/v) H2SO4. To determine glycogen content, the dissolved sample (0.5 mL) was taken to mix with 1 mL of anthrone solution (2 g/L anthrone dissolved in concentrated H2SO4). The reaction mixture was vigorously vortexed, and subsequently heated at 90 °C for 10 min. The sample solution was then measured by spectrophotometer at the absorbance of 625 nm. A commercial glycogen standard (Sigma-Aldrich) was prepared and used for calibrations. The unit of glycogen content presented represents by the percentage of glycogen per the dried cell weight (%w/DCW).

Reverse transcription polymerase chain reaction

Fifteen mL of cell culture was harvested by centrifugation at 6000 rpm (3622 ×g), 10 min, and the total RNA was extracted using 1 mL of TRIzol® Reagent (Invitrogen, Carlsbad, CA, USA). After that, the isolated RNAs were treated with RNaseI-free DNAseI (Fermentas, Life Sciences, Canada) to remove any DNA contaminants and then converted RNAs to cDNA using ReverTra Ace® qPCR RT Master Mix (Toyobo, Osaka, Japan). Then, the cDNA was used as a template for PCR analysis of genes involved in lipid biosynthesis and neighboring pathways including glgX, phaA, accA, aas, plsX, and lipA. The 16 s rRNA was used as reference. All RT-PCR primers used in this study are listed in Table 2. For PCR condition, it was first started by 98 °C for 3 min, followed by proper cycles of each gene at 98 °C for 15 s, the primer melting temperature (Tm) for 35 s, 68 °C for 15 s to extend the DNA strand, and 68 °C for 5 min at the last step. The cycle numbers and Tm of each primer pair are shown in Table 2. PCR products were verified by electrophoresis on 1.2% (w/v) agarose gels and the intensity of bands was detected using a Syngene Gel Documentation (SYNGENE, Frederick, MD).

Acknowledgements

Not applicable.

Abbreviations

AAS

Acyl–acyl carrier protein synthetase

ACP

Acyl carrier protein

Car

Carotenoids

Chl a

Chlorophyll a

CO2

Carbon dioxide

DCW

Dry cell weight

DMF

N,N-dimethylformamide

FFA

Free fatty acid

h

Hour

lipA

Lipase A

m

Meter

μg

Microgram

mL

Milliliter

min

Minute

nm

Nanometer

OD

Optical density

PCR

Polymerase chain reaction

plsX

Putative acyltransferase

PHB

Polyhydroxybutyrate

rpm

Revolutions per minute

s

Seconds

S-layer

Surface layer protein

WT

Wild type

Author contributions

KE responsible for study conception, experimenter, data collection and analysis, manuscript preparation. PL study conception and manuscript revision. SJ study conception, supervision, and design, critical revision and manuscript writing, and final approval of the manuscript. All authors read and approved the final manuscript.

Funding

This study was supported by Grants from Chulalongkorn University Second Century Fund, C2F to SJ and KE. This Research is also funded by Thailand Science research and Innovation Fund Chulalongkorn University (CU_FRB65_hea (66)_129_23_59) to SJ.

Availability of data and materials

Data generated and analyzed during this study are included in the published article.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable. All the authors agree to the submission and publication of this manuscript.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Quintana N, Van der Kooy F, Van de Rhee MD, Voshol GP, Verpoorte R. Renewable energy from cyanobacteria: energy production optimization by metabolic pathway engineering. Appl Microbiol Biotechnol. 2011;91:471–490. doi: 10.1007/s00253-011-3394-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Gao Q, Wang W, Zhao H, Lu X. Effects of fatty acid activation on photosynthetic production of fatty acid-based biofuels in Synechocystis sp. PCC 6803. Biotechnol Biofuels. 2012;5:17. doi: 10.1186/1754-6834-5-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kaczmarzyk D, Fulda M. Fatty acid activation in cyanobacteria mediated by acyl–acyl carrier protein synthetase enables fatty acid recycling. Plant Physiol. 2010;152:1598–1610. doi: 10.1104/pp.109.148007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wang W, Liu X, Lu X. Engineering cyanobacteria to improve photosynthetic production of alka(e)nes. Biotechnol Biofuels. 2013;6:69. doi: 10.1186/1754-6834-6-69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yang F, Xiang W, Li T, Long L. Transcriptome analysis for phosphorus starvation-induced lipid accumulation in Scenedesmus sp. Sci Rep. 2018;8:16420. doi: 10.1038/s41598-018-34650-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Towijit U, Songruk N, Lindblad P, Incharoensakdi A, Jantaro S. Co-overexpression of native phospholipid-biosynthetic genes plsX and plsC enhances lipid production in Synechocystis sp. PCC 6803. Sci Rep. 2018;8:13510. doi: 10.1038/s41598-018-31789-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Minyuk G, Sidorov R, Solovchenki A. Effect of nitrogen source on the growth, lipid, and valuable carotenoid production in the green microalga Chromochloris zofingiensis. J Appl Phycol. 2020;32:923–935. doi: 10.1007/s10811-020-02060-0. [DOI] [Google Scholar]
  • 8.Eungrasamee K, Miao R, Incharoensakdi A, Lindblad P, Jantaro S. Improved lipid production via fatty acid biosynthesis and free fatty acid recycling in engineered Synechocystis sp. PCC 6803. Biotechnol Biofuels. 2019;12:8. doi: 10.1186/s13068-018-1349-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Eungrasamee K, Incharoensakdi A, Lindblad P, Jantaro S. Overexpression of lipA or glpD_RuBisCO in the Synechocystis sp. PCC 6803 mutant lacking the aas gene enhances free fatty acid secretion and intracellular lipid accumulation. Int J Mol Sci. 2021;22(21):11468. doi: 10.3390/ijms222111468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Iram SH, Cronan JE. The β-oxidation systems of Escherichia coli and Salmonella enterica are not functionally equivalent. J Bacteriol. 2006;188:599–608. doi: 10.1128/JB.188.2.599-608.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Leber C, Polson B, Fernandez-Moya R, Da Silva NA. Overproduction and secretion of free fatty acids through disrupted neutral lipid recycle in Saccharomyces cerevisiae. Metab Eng. 2015;28:54–62. doi: 10.1016/j.ymben.2014.11.006. [DOI] [PubMed] [Google Scholar]
  • 12.Ferreira R, Teixeira PG, Siewers V, Nielsen J. Redirection of lipid flux toward phospholipids in yeast increases fatty acid turnover and secretion. Proc Natl Acad Sci USA. 2018;115:1262–1267. doi: 10.1073/pnas.1715282115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Liu X, Sheng J, Curtiss R., III Fatty acid production in genetically modified cyanobacteria. Proc Natl Acad Sci USA. 2011;108(17):6899–6904. doi: 10.1073/pnas.1103014108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Takatani N, Use K, Kato A, Ikeda K, Kojima K, Aichi M, Maeda SI, Omata T. Essential role of acyl-ACP synthetase in acclimation of the cyanobacterium Synechococcus elongatus strain PCC 7942 to high-light conditions. Plant Cell Physiol. 2015;56:1608–1615. doi: 10.1093/pcp/pcv086. [DOI] [PubMed] [Google Scholar]
  • 15.Ruffing AM, Jones HD. Physiological effects of free fatty acid production in genetically engineered Synechococcus elongatus PCC 7942. Biotechnol Bioeng. 2012;109:2190–2199. doi: 10.1002/bit.24509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Weier D, Müller C, Gaspers C, Frentzen M. Characterisation of acyltransferases from Synechocystis sp. PCC 6803. Biochem Biophys Res Commun. 2005;334(4):1127–1134. doi: 10.1016/j.bbrc.2005.06.197. [DOI] [PubMed] [Google Scholar]
  • 17.Paoletti L, Lu YJ, Schujman GE, de Mendoza D, Rock CO. Coupling of fatty acid and phospholipid synthesis in Bacillus subtilis. J Bacteriol. 2007;189(16):5816–5824. doi: 10.1128/JB.00602-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gao Q, Tan X, Lü X. Characterization of a key gene in membrane lipid cycle in Synechocystis sp. PCC 6803. Chin J Biotechnol. 2012;28(12):1473–1481. [PubMed] [Google Scholar]
  • 19.Hamilton JA, Kamp F. How are free fatty acids transported in membranes? Is it by proteins or by free diffusion through the lipids? Diabetes. 1999;48(12):2255–2269. doi: 10.2337/diabetes.48.12.2255. [DOI] [PubMed] [Google Scholar]
  • 20.Bellefleur MP, Wanda SY, Curtiss R. Characterizing active transportation mechanisms for free fatty acids and antibiotics in Synechocystis sp. PCC 6803. BMC Biotechnol. 2019;19(1):1–17. doi: 10.1186/s12896-019-0500-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Jansson C, Northen T. Calcifying cyanobacteria—the potential of biomineralization for carbon capture and storage. Curr Opin Biotechnol. 2010;21(3):365–371. doi: 10.1016/j.copbio.2010.03.017. [DOI] [PubMed] [Google Scholar]
  • 22.Trautner C, Vermaas WF. The sll1951 gene encodes the surface layer protein of Synechocystis sp. strain PCC 6803. J Bacteriol. 2013;195(23):5370–5380. doi: 10.1128/JB.00615-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Koch M, Doello S, Gutekunst K, Forchhammer K. PHB is produced from glycogen turn-over during nitrogen starvation in Synechocystis sp. PCC 6803. Int J Mol Sci. 2019;20:1942. doi: 10.3390/ijms20081942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Dutt V, Srivastava S. Novel quantitative insights into carbon sources for synthesis of poly hydroxybutyrate in Synechocystis PCC 6803. Photosynth Res. 2018;136:303–314. doi: 10.1007/s11120-017-0464-x. [DOI] [PubMed] [Google Scholar]
  • 25.Wu GF, Wu QY, Shen ZY. Accumulation of poly-β-hydroxybutyrate in cyanobacterium Synechocystis sp. PCC6803. Bioresour Technol. 2001;76(2):85–90. doi: 10.1016/S0960-8524(00)00099-7. [DOI] [PubMed] [Google Scholar]
  • 26.Khetkorn W, Incharoensakdi A, Lindblad P, Jantaro S. Enhancement of poly-3-hydroxybutyrate production in Synechocystis sp. PCC 6803 by overexpression of its native biosynthetic genes. Bioresour Technol. 2016;214:761–768. doi: 10.1016/j.biortech.2016.05.014. [DOI] [PubMed] [Google Scholar]
  • 27.Hauf W, Schlebusch M, Hüge J, Kopka J, Hagemann M, Forchhammer K. Metabolic changes in Synechocystis PCC6803 upon nitrogen-starvation: excess NADPH sustains polyhydroxybutyrate accumulation. Metabolites. 2013;3:101–118. doi: 10.3390/metabo3010101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Koch M, Berendzen KW, Forchhammer K. On the role and production of polyhydroxybutyrate (PHB) in the cyanobacterium Synechocystis sp. PCC 6803. Life. 2020;10(4):47. doi: 10.3390/life10040047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Desbois AP, Smith VJ. Antibacterial free fatty acids: activities, mechanisms of action and biotechnological potential. Appl Microbiol Biotechnol. 2010;85:162942. doi: 10.1007/s00253-009-2355-3. [DOI] [PubMed] [Google Scholar]
  • 30.Ruffing AM. Improved free fatty acid production in cyanobacteria with Synechococcus sp. PCC 7002 as host. Front Bioeng Biotechnol. 2014;2:17. doi: 10.3389/fbioe.2014.00017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kato A, Use K, Takatani N, Ikeda K, Matsuura M, Kojima K, Aichi M, Maeda S, Omata T. Modulation of the balance of fatty acid production and secretion is crucial for enhancement of growth and productivity of the engineered mutant of the cyanobacterium Synechococcus elongatus. Biotechnol Biofuels. 2016;9:91. doi: 10.1186/s13068-016-0506-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Schuster B, Sleytr UB. Biomimetic interfaces based on S-layer proteins, lipid membranes and functional biomolecules. J R Soc Interface. 2014;11:20140232. doi: 10.1098/rsif.2014.0232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Schultze-Lam S, Harauz G, Beveridge TJ. Participation of a cyanobacterial S layer in fine-grain mineral formation. J Bacteriol. 1992;174(24):7971–7981. doi: 10.1128/jb.174.24.7971-7981.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sakiyama T, Ueno H, Homma H, Numata O, Kuwabara T. Purification and characterization of a hemolysin-Like Protein, Sll 1951, a nontoxic member of the RTX protein family from the cyanobacterium Synechocystis sp. strain PCC 6803. J Bacteriol. 2006;188:3535–3542. doi: 10.1128/JB.188.10.3535-3542.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sakiyama T, Araie H, Suzuki T, Shiraiwa Y. Functions of a hemolysin-like protein in the cyanobacterium Synechocystis sp. PCC 6803. Arch Microbiol. 2011;193:565–571. doi: 10.1007/s00203-011-0700-2. [DOI] [PubMed] [Google Scholar]
  • 36.Wang RT, Stevens CLR, Myers J. Action spectra for photoreactions I and II of photosynthesis in the blue-green alga Anacystis nidulans. Photochem Photobiol. 1977;25(1):103–108. doi: 10.1111/j.1751-1097.1977.tb07429.x. [DOI] [Google Scholar]
  • 37.Görl M, Sauer J, Baier T, Forchhammer K. Nitrogen-starvation-induced chlorosis in Synechococcus PCC 7942: adaptation to long-term survival. Microbiology. 1998;144(9):2449–2458. doi: 10.1099/00221287-144-9-2449. [DOI] [PubMed] [Google Scholar]
  • 38.Schwarz R, Forchhammer K. Acclimation of unicellular cyanobacteria to macronutrient deficiency: emergence of a complex network of cellular responses. Microbiology. 2005;151(8):2503–2514. doi: 10.1099/mic.0.27883-0. [DOI] [PubMed] [Google Scholar]
  • 39.Joseph A, Aikawa S, Sasaki K, Matsuda F, Hasunuma T, Kondo A. Increased biomass production and glycogen accumulation in apcE gene deleted Synechocystis sp. PCC 6803. AMB Express. 2014;4:17. doi: 10.1186/s13568-014-0017-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Luan G, Zhang S, Wang M, Lu X. Progress and perspective on cyanobacterial glycogen metabolism engineering. Biotechnol Adv. 2019;37:771–786. doi: 10.1016/j.biotechadv.2019.04.005. [DOI] [PubMed] [Google Scholar]
  • 41.Giner-Lamia J, Robles-Rengel R, Hernández-Prieto MA, Muro-Pastor MI, Florencio FJ, Futschik ME. Identification of the direct regulon of NtcA during early acclimation to nitrogen starvation in the cyanobacterium Synechocystis sp. PCC 6803. Nucleic Acids Res. 2017;45(20):11800–11820. doi: 10.1093/nar/gkx860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Krasikov V, von Wobeser EA, Dekker HL, Huisman J, Matthijs HC. Time-series resolution of gradual nitrogen starvation and its impact on photosynthesis in the cyanobacterium Synechocystis PCC 6803. Physiol Plant. 2012;145(3):426–439. doi: 10.1111/j.1399-3054.2012.01585.x. [DOI] [PubMed] [Google Scholar]
  • 43.Osanai T, Imamura S, Asayama M, Shirai M, Suzuki I, Murata N, Tanaka K. Nitrogen induction of sugar catabolic gene expression in Synechocystis sp. PCC 6803. DNA Res. 2006;13(5):185–195. doi: 10.1093/dnares/dsl010. [DOI] [PubMed] [Google Scholar]
  • 44.Eungrasamee K, Incharoensakdi A, Lindblad P, Jantaro S. Synechocystis sp. PCC 6803 overexpressing genes involved in CBB cycle and free fatty acid cycling enhances the significant levels of intracellular lipids and secreted free fatty acids. Sci Rep. 2020;10:4515. doi: 10.1038/s41598-020-61100-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Chamovitz D, Sandmann G, Hirschberg J. Molecular and biochemical characterization of herbicide-resistant mutants of cyanobacteria reveals that phytoene desaturation is a rate-limiting step in carotenoid biosynthesis. J Biol Chem. 1993;268:17348–17353. doi: 10.1016/S0021-9258(19)85341-3. [DOI] [PubMed] [Google Scholar]
  • 46.Moran R. Formulae for determination of chlorophyllous pigments extracted with N,N-dimethylformamide. Plant Physiol. 1982;69:1376–1381. doi: 10.1104/pp.69.6.1376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Bligh EG, Dryer WJ. A rapid method of total lipid extraction and purification. J Biochem Physiol. 1959;37:911–917. doi: 10.1139/o59-099. [DOI] [PubMed] [Google Scholar]
  • 48.Fales MF. Evaluation of a spectrophotometric method for determination of total fecal lipid. Clin Chem. 1971;17:1103–1108. doi: 10.1093/clinchem/17.11.1103. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data generated and analyzed during this study are included in the published article.


Articles from Biotechnology for Biofuels and Bioproducts are provided here courtesy of BMC

RESOURCES