Skip to main content
PMC home page
eLife logoLink to eLife
. 2022 Sep 2;11:e65987. doi: 10.7554/eLife.65987

Keratinocyte PIEZO1 modulates cutaneous mechanosensation

Alexander R Mikesell 1, Olena Isaeva 1, Francie Moehring 1, Katelyn E Sadler 1, Anthony D Menzel 1, Cheryl L Stucky 1,✉
Editors: Alexander Theodore Chesler2, Kenton J Swartz3
PMCID: PMC9512397  PMID: 36053009

Abstract

Epidermal keratinocytes mediate touch sensation by detecting and encoding tactile information to sensory neurons. However, the specific mechanotransducers that enable keratinocytes to respond to mechanical stimulation are unknown. Here, we found that the mechanically-gated ion channel PIEZO1 is a key keratinocyte mechanotransducer. Keratinocyte expression of PIEZO1 is critical for normal sensory afferent firing and behavioral responses to mechanical stimuli in mice.

Research organism: Mouse

Introduction

Despite the importance of touch sensation for daily life, we are only beginning to understand the molecular and cellular signaling mechanisms through which tactile information is transduced from the skin to the central nervous system. In the last decade, sensory biologists have determined that non-neuronal cells and specialized end organ structures in the skin interact with sensory neurons to mediate touch sensation; Merkel cells and Meissner corpuscles encode unique aspects of gentle touch by tuning the responses of Aβ sensory neurons, and specialized terminal Schwann cells modulate the firing of nociceptors to noxious touch (Maksimovic et al., 2014; Woo et al., 2014; Hoffman et al., 2018; Abdo et al., 2019; Ojeda-Alonso et al., 2022; Neubarth et al., 2020). Keratinocytes, which constitute >95% of the cells in the epidermis, are innately sensitive to mechanical force, are capable of releasing a wide array of neuroactive factors, and form close ‘synapse-like’ connections with intraepidermal nerve fibers (Fuchs, 1995; Koizumi et al., 2004; Tsutsumi et al., 2009; Goto et al., 2010; Lumpkin and Caterina, 2007; Hou et al., 2011; Shi et al., 2013; Barr et al., 2013; Talagas et al., 2020a; Talagas et al., 2020c). Moreover, optogenetic activation of keratinocytes induces action potential firing in sensory neurons, whereas optogenetic inhibition of keratinocyte activity decreases both sensory neuron and behavioral responses to tactile stimuli (Baumbauer et al., 2015; Moehring et al., 2018a). Thus, keratinocyte activity is critical for normal sensory neuron and behavioral responses to mechanical stimuli.

The ability of keratinocytes to respond to force and contribute to touch sensation indicates that they must express one or more mechanically sensitive proteins, but the specific keratinocyte mechanotransducer(s) have not yet been identified. PIEZO1 and PIEZO2 are mechanically gated, non-selective cation channels that share approximately 42% amino acid similarity and are widely expressed in tissues that respond to mechanical force (e.g. lung, skin, bladder, and vasculature) (Li et al., 2014; Ranade et al., 2014a; Friedrich et al., 2019; Dalghi et al., 2019). PIEZO2 expression in both dorsal root ganglia (DRG) sensory neurons and Merkel cells is required for innocuous touch sensation (Woo et al., 2014; Ranade et al., 2014b; Coste et al., 2010). However, it is unknown if PIEZO1 also contributes to touch sensation. Because PIEZO1 is highly expressed in mouse skin (Coste et al., 2010), we hypothesized that this channel may be a key mechanotransducer in keratinocytes. Here, we show that virtually all keratinocytes isolated from mouse and human skin respond to the PIEZO1 agonist Yoda1 and that PIEZO1 expression is important for keratinocyte mechanical sensitivity. Furthermore, we demonstrate that loss of epidermal PIEZO1 decreases the firing rate of sensory nerve fibers in response to mechanical stimulation of the skin and blunts behavioral responses to both innocuous and noxious mechanical stimuli in vivo. Together, these data demonstrate that epidermal PIEZO1 is critical for normal touch sensation.

Results

To determine if PIEZO1 is a mechanotransducer in keratinocytes, we generated epidermal cell-specific PIEZO1 knockout mice (PIEZO1cKO) by crossing Keratin14(Krt14)Cre and Piezo1loxp/loxp mice (Cahalan et al., 2015). Successful knockout of the channel was verified with RNAscope in situ hybridization; RNA probes for Piezo1 stained the epidermis of wild-type mice, but Piezo1 puncta were absent from PIEZO1cKO epidermis (Figure 1A). Importantly, PIEZO1 deletion did not disrupt gross epidermal morphology, as the stratum corneum and stratum spinosum appeared similar in PIEZO1cKO and wild-type mice (Figure 1—figure supplement 1A and B). Quantitative real-time PCR also confirmed successful knockout of the channel; Piezo1 transcript was detected in the epidermis of wild-type mice but absent in PIEZO1cKO samples (Figure 1B). On a functional level, in vitro calcium imaging experiments revealed that keratinocytes isolated from wild-type animals responded robustly to the PIEZO1-specific chemical agonist Yoda1 (Syeda et al., 2015) in a concentration-dependent manner (Figure 1C and D). In contrast, keratinocytes from PIEZO1cKO animals were virtually unresponsive to Yoda1 (Figure 1C and D). Similarly, primary human keratinocytes displayed robust, concentration-dependent intracellular calcium flux in response to Yoda1 (Figure 1D and E). These data indicate that functional PIEZO1 is expressed in both human and mouse keratinocytes.

Figure 1. PIEZO1 is functionally expressed in mouse and human keratinocytes.

(A) RNAscope of hindpaw glabrous skin isolated from wildtype and PIEZO1cKO mice targeting PIEZO1 mRNA (blue: DAPI, red: PIEZO1). (B) PIEZO1 gene expression was measured in keratinocytes isolated from wildtype (wt; n=3) and PIEZO1cKO (n=3) mice using quantitative real-time PCR. Expression levels were normalized to HPRT. Piezo1 expression was undetected in PIEZO1cKO samples. (C) Average calcium flux in wildtype (wt) and PIEZO1cKO keratinocytes in response to 1000 nM Yoda1; trace outline is SEM. (D) Percentage of wildtype and PIEZO1cKO keratinocytes that respond to extracellular Yoda1; cells from n=3 mice per genotype; bars are group averages; Chi square. (E) Calcium flux in human keratinocytes in response to 1000 nM Yoda1; trace outline is SEM. (F) Percentage of human keratinocytes that respond to extracellular Yoda1; cells from the skin of n=3 human donors; bars are group averages. All data are mean ± SEM unless otherwise stated. Post-hoc comparisons for all panels: **p<0.01, ****p<0.0001.

Figure 1—source data 1. Data for panals Figure 1B-F.

Figure 1.

Figure 1—figure supplement 1. The epidermis of PIEZO1cKO animals has normal morphological features.

Figure 1—figure supplement 1.

(A) H&E stained skin from the hindpaw of wildtype (wt) and PIEZO1cKO mice. (B) Quantification of individual epidermal layer thickness; 2-way ANOVA, n.s. All data are mean ± SEM.
Figure 1—figure supplement 1—source data 1. Individual values for epidermal thickness.
Open in a new tab

PIEZO1 mediates keratinocyte mechanical sensitivity

To verify the mechanosensitivity of keratinocytes, we performed whole cell patch clamp recordings in primary cultures of mouse keratinocytes while probing the cell membrane with increasing levels of indentation. Keratinocytes were sensitive to mechanical stimulation as the majority of cells responded to a very gentle membrane indentation (≤1 µm) with a mechanically activated (MA) current. However, the amplitude of the MA current evoked by membrane indentation did not show a clear dependence on the increase in membrane indentation depth. Figure 2A shows a representative example of a MA current evoked in a keratinocyte in response to stepwise increases in membrane indentation. In this recording, the initial current was induced in response to 0.50 µm membrane indentation (shown in blue), maximum current was observed in response to the next stimulation (black, 0.75 µm membrane displacement), and subsequent displacements resulted in smaller currents (red, 1.00 µm) or no current (green, 1.25 µm). Increasing the time between mechanical stimulations to 2 min did not affect the properties of keratinocyte responses to increasing mechanical indentation (data not shown). We next examined whether PIEZO1 is required for keratinocytes mechanosensitivity. PIEZO1cKO keratinocytes required greater indentation to elicit MA currents compared to wild-type cells, indicating PIEZO1cKO keratinocytes have elevated mechanical thresholds (Figure 2B). In addition, there was an increase in the number of keratinocytes unresponsive to membrane indentation (mechanically insensitive) in the PIEZO1cKO group (51.35%, 19 out of 37 cells) compared to wild type group (21.74%, 5 out of 23 cells) (Figure 2C). However, there was no change in the proportion of keratinocytes that responded to membrane indentation with rapidly adapting (RA), intermediately adapting (IA), or slowly adapting (SA) currents (Figure 2D and E). Additionally, we did not observe any effect of PIEZO1 deletion on the profiles of RA, IA, and SA currents. Furthermore, there was no change in the maximum current amplitude elicited by membrane indentation at any force tested (Figure 2F). These findings indicate that PIEZO1 is critical for setting the mechanical threshold of keratinocytes and that its deletion increases the number of mechanically insensitive cells.

Figure 2. PIEZO1 deletion decreases keratinocyte mechanical sensitivity.

Figure 2.

Open in a new tab

(A) Examples of whole-cell recording of mechanically activated (MA) current (Vh = –40 mV) evoked in keratinocytes by a stepwise increase in membrane indentation depth. (B) The mechanical threshold to evoke MA current by gradual increasing of indentation depth is significantly increased in keratinocytes of PIEZO1cKO mice compared to wild-type controls; Mann-Whitney U-test. (C) PIEZO1 deletion significantly decreased number of keratinocytes that responded to membrane indentation with MA current (wildtype: n=23 cells; PIEZO1cKO: n=37 cells); Chi square test. (D) Representative traces of rapidly adapting (RA), intermediately adapting (IA), and slowly adapting (SA) MA currents induced in keratinocytes in response to membrane indentation. (E) Proportion of keratinocytes that responded to membrane indentation with RA, IA, and SA currents is not affected by PIEZO1 deletion (n=18 recordings of MA current per each group); Chi square and Fisher’s exact post hoc test, n.s. (F) Maximal amplitude of MA currents in wild-type and PIEZO1cKO keratinocytes; Mann-Whitney U-test, n.s. For whole-cell patch clamp experiments, cells were harvested from n=5 mice per group. All data are mean ± SEM. *p<0.05.

Figure 2—source data 1. Data for mechanical threshold, percent responders, current profile and max amplitude of wt and PIEZO1cKO keratinocytes.

Epidermal PIEZO1 is required for normal primary afferent responses to mechanical stimulation

Since keratinocytes are known to modulate cutaneous sensory afferent responses to mechanical stimulation (Baumbauer et al., 2015), we next used ex vivo tibial nerve recordings to determine whether deletion of PIEZO1 in non-neuronal epidermal cells affects mechanically evoked sensory nerve firing. Aδ fibers from PIEZO1cKO mice fired fewer action potentials during mechanical stimulation of receptive fields than fibers isolated from wild-type control tissue (Figure 3A and B). These differences were most notable at the upper range of tested forces (100-150mN) (Figure 3C). In contrast, epidermal PIEZO1 knockout had no effect on the firing frequency of Aβ or C fibers (Figure 3C–F). No difference in mechanical thresholds between wild-type and PIEZO1cKO mice were observed for any fiber type (Figure 3—figure supplement 1A-D). Based on these data, the normal mechanically induced firing of Aδ primary afferent fibers depends on epidermal expression of PIEZO1.

Figure 3. Normal mechanically-induced primary afferent firing requires epidermal PIEZO1 expression.

Ex vivo tibial nerve recordings of Piezo1cKO and wildtype (wt) mice. (A) Aδ fiber example traces. (B) Mean mechanically induced firing rates of Aδ fibers (n=33 wt and 30 PIEZO1cKO fibers). (C) SA-Aβ fiber example traces. (D) Mean mechanically induced firing rates of SA-β fibers (n=33 wt and 28 PIEZO1cKO fibers). (E) C fiber example traces. (F) Mean mechanically induced firing rates of C fibers (n=30 wt and 34 PIEZO1cKO fibers). For all recordings, the mechanical stimulus was applied to the skin for 10 seconds. All data are mean ± SEM; 2-way ANOVA and Sidak post-hoc comparisons for firing frequency panels: *p<0.05, **p<0.01; fibers from n=17–19 mice.

Figure 3—source data 1. Data for mechanically induced firing frequency of sensory afferents.

Figure 3.

Figure 3—figure supplement 1. PIEZO1 deletion does not alter sensory fiber mechanical thresholds.

Figure 3—figure supplement 1.

(A) Single unit firing in response to mechanical force ramp (0–100 mN; 10 s). Mechanical thresholds of (B) Aδ fibers, (C) SA-Aβ fibers, and (D) C fibers to ramp stimuli. All data are mean ± SEM; Student’s (two tailed) t test, n.s. Fibers from n=17–19 mice.
Figure 3—figure supplement 1—source data 1. Data for mechanical threshold.
Open in a new tab

Activation of epidermal PIEZO1 induces paw attending responses

To determine if direct activation of epidermal PIEZO1 is sufficient to induce behavioral responses, we injected Yoda1 into the hind paw of wild-type and PIEZO1cKO mice. Yoda1 induced dose-dependent paw attending responses in wild-type mice (Figure 4A) but had no effect in PIEZO1cKO mice (Figure 4B), suggesting that the observed attending behaviors were dependent on epidermally-expressed PIEZO1. To determine if these behaviors directly result from Yoda1-induced firing of sensory neurons, we performed ex vivo teased tibial nerve recordings in tissue isolated from wild-type mice. Application of 1 mM Yoda1 failed to induce firing in any fiber type tested (Aβ n=10, Aδ n=10, C n=10 fibers, data not shown). In light of this finding, we next hypothesized that the attending behaviors observed following Yoda1 injection were due to Yoda1-induced mechanical sensitization of primary sensory afferents, such that the normally innocuous pressure of the glass floor was now sufficient to induce paw attending (Wang et al., 2020). In support of this hypothesis, we found that Yoda1 application increased the mechanically induced firing frequency of wild-type C fibers relative to vehicle application (Figure 4C–F), but had no effect on the mechanically induced firing of Aβ or Aδ fibers (10 fibers of each tested, data not shown). The increase in C fiber mechanically induced firing frequency was absent in PIEZO1cKO preparations, indicating that epidermal PIEZO1 is required for the Yoda1-induced mechanical sensitization. Furthermore, we found that intraplantar injection of 1 mM Yoda1 sensitized wild-type mice behaviors to mechanical stimulation 30 minutes following injection, an effect which was absent in the PIEZO1ckO mice (Figure 4G). These results indicate that Yoda1 acts at keratinocyte PIEZO1 to induce C fiber mechanical hypersensitivity that results in attending behaviors and increased mechanical sensitivity.

Figure 4. Yoda1 induces paw attending behaviors and C fiber mechanical hypersensitivity.

Figure 4.

Open in a new tab

(A) Yoda1-induced attending behaviors in wildtype mice; Kruskal Wallis test. (B) 1 mM Yoda1 induced attending behaviors in wildtype and PIEZO1cKO mice; 2-way ANOVA. (C) Example traces from wildtype preparations exposed to 1 mM Yoda1 or vehicle during mechanical testing. (D) Mean mechanical firing frequency of C fibers from wildtype animals exposed to 1 mM Yoda1 or vehicle. (E) Example traces of PIEZO1cKO preparations exposed to 1 mM Yoda1 or vehicle during mechanical testing. (F) Mean mechanical firing frequency of C fibers from PIEZO1cKO animals exposed to 1 mM Yoda1 or vehicle. Fibers from n=12–14 mice. For all teased fiber recordings, the mechanical stimulus was applied to the skin for 10 s; 2-way ANOVA. (G) Von Frey mechanical thresholds of wildtype and PIEZO1cKO mice tested 30 min after an injection of 1 mM Yoda1 or vehicle; 2-way ANOVA . All data are mean ± SEM unless otherwise stated. Post-hoc comparisons for all panels: **p<0.01, ***p<0.001, ****p<0.0001.

Figure 4—source data 1. Data for time attending to hindpaws, Yoda1 induced firing frequency, and Yoda1 induced mechanical hypersensitivity.

Epidermal PIEZO1 mediates normal innocuous and noxious touch sensation

Finally, we investigated whether epidermal PIEZO1 is required for normal touch sensation in rodents by examining the responses of PIEZO1cKO mice and wild-type controls in a battery of behavioral assays. PIEZO1cKO mice were less sensitive to innocuous punctate stimulation with von Frey filaments (Figure 5A–C). Additionally, the response profiles to a dynamic light touch stimulus (paintbrush) and a noxious punctate (needle) stimulus were altered in PIEZO1cKO mice; PIEZO1cKO mice responded less frequently to both paintbrush and needle stimulation than wild-type controls (Figure 5D and E). PIEZO1cKO mice did not exhibit general somatosensory deficits, as animal responses to heat (Figure 5F) and cold (Figure 5G) were identical to those observed in wild-type mice. Furthermore, we utilized high-speed videography to capture sub-second behavioral features in response to a single hind paw application of von Frey filaments (0.4 g, 1.4 g, 4 g), a paintbrush, or a needle. Both reflexive (paw withdrawal height and velocity) and affective (pain score) behaviors were measured (Abdus-Saboor et al., 2019; Jones et al., 2020). PIEZO1cKO mice were less sensitive to stimulation with von Frey filaments; fewer PIEZO1cKO animals responded to the 0.6 g filament (Figure 5—figure supplement 1A). Raw values for reflexive and affective responses (Figure 5—figure supplement 1B-D) of each animal were converted to normalized z-scores to generate a cumulative sensitivity score for each stimulus (Figure 5H); these cumulative scores were then averaged into a combined mechanical sensitivity score for each animal (Figure 5I). PIEZO1cKO mice exhibited decreased mechanical sensitivity scores compared to wild-type animals, an effect that was most apparent in the needle stimulus (Figure 5H and I).

Figure 5. Epidermal Piezo1 is required for normal innocuous and noxious mechanosensation.

(A) Von Frey mechanical thresholds of wildtype and PIEZO1cKO mice; Mann-Whitney U-test. (B) Wildtype and PIEZO1cKO responses to repeated suprathreshold (3.61 mN) von Frey filament stimulation; Mann-Whitney U-test. (C) Wildtype and PIEZO1cKO responses to repeated static light touch (0.6 mN von Frey filament) stimulation; Mann-Whitney U-test. (D) Response characterization to paintbrush swiping across hindpaw; n=10–12; bars are group averages; Chi Square test. (E) Response characterization to noxious needle hindpaw stimulation; n=10–12; bars are group averages; Chi Square test. (F) Withdrawal latency to radiant heat hindpaw stimulation; Student’s (two-tailed) t test, n.s. (G) Withdrawal latency to dry ice hindpaw stimulation; Student’s (two-tailed) t test, n.s. (H) High-speed imaging mechanical sensitivity scores in response to von Frey (0.6 g, 1.4 g, 4 g), brush, and needle stimulation in wildtype and PIEZO1cKO mice; two-way ANOVA . Cumulative z-scores were calculated from paw height, paw velocity, and pain score at each stimulus. (I) Average high-speed imaging mechanical sensitivity score across all stimuli for each animal. All data are mean ± SEM unless otherwise stated. Post-hoc comparisons for all panels: **p<0.01, ***p<0.001, ****p<0.0001.

Figure 5—source data 1. Data for behavioral mechanical sensitivity.

Figure 5.

Figure 5—figure supplement 1. High-speed imaging of PIEZO1cKO and wildtype mice.

Figure 5—figure supplement 1.

(A) Percent of mice responding to a single application of von Frey (0.4 g, 1.4 g, 4.0 g), brush, or needle stimuli with a paw withdrawal; Chi square. (B) Height of paw withdrawal in response to mechanical stimulation. (C) Velocity of paw withdrawal in response to mechanical stimulation. (D) Pain score in response to mechanical stimulation. Pain score was calculated based on whether the animal exhibited paw fluttering, guarding, or jumping behaviors in response to stimulation. All data are mean ± SEM. *p<0.05.
Figure 5—figure supplement 1—source data 1. Data for high speed imaging of mechanical sensitivity.
Open in a new tab

Discussion

Until very recently, it was assumed that sensory neurons were the primary, and in some cases, sole transducers of innocuous and noxious stimuli in skin (Moehring et al., 2018b; Talagas et al., 2020b; Hill and Bautista, 2020). However, this dogma has essentially been negated by recent work that demonstrates how non-neuronal cells, including keratinocytes, are required for the normal detection and coding of somatosensory stimuli in the peripheral nervous system (Maksimovic et al., 2014; Abdo et al., 2019; Moehring et al., 2018a; Neubarth et al., 2020; Sadler et al., 2020). Here, we show for the first time that PIEZO1 is one of the critical mechanotransducers in keratinocytes that enables these cells to encode mechanical force and convey this signal to sensory afferent terminals.

Epidermal PIEZO1 is critical for normal gentle and noxious touch detection

Our findings are the first to demonstrate a role for PIEZO1 in tactile sensation. These data complement previous work showing the necessity of this channel as a sensor of mechanical forces in the lung, bladder, and circulatory system (Li et al., 2014; Ranade et al., 2014a; Friedrich et al., 2019; Dalghi et al., 2019), and the necessity of family member PIEZO2 in the detection of light touch (Maksimovic et al., 2014; Woo et al., 2014; Hoffman et al., 2018; Ranade et al., 2014b; Chesler et al., 2016). Furthermore, these results indicate that the functional contributions of PIEZO1 activity in the epidermis are multifaceted, as PIEZO1 also regulates epidermal cell extrusion and wound healing (Eisenhoffer et al., 2012; Holt et al., 2020). Epidermal PIEZO1 deletion decreased animal behavioral responsiveness to a range of intensities and qualities of mechanical stimuli. This contrasts to the behaviors observed when PIEZO2 is deleted from various peripheral cell types; animals are not able to detect very light punctate stimuli when PIEZO2 is deleted from Merkel cells (Maksimovic et al., 2014; Woo et al., 2014), and similarly, deletion of PIEZO2 from dorsal root ganglion neurons results in behavioral deficits to light punctate and dynamic stimuli but not to stimuli in the high to noxious range of forces (Ranade et al., 2014b). While Merkel cell and neuronal PIEZO2 specifically mediate sensitivity to light touch, epidermal PIEZO1 appears to be a more general amplifier of cutaneous mechanical stimuli. It is important to note that sensory neurons are capable of detecting and encoding aspects of mechanical stimuli without input from epidermal cells; neither epidermal PIEZO1 deletion nor optogenetic inhibition of keratinocytes completely abolishes touch sensation (Baumbauer et al., 2015; Moehring et al., 2018a), but rather both manipulations decrease neuronal and behavioral mechanical sensitivity. Keratinocyte activation and subsequent signaling appears to function in concert with sensory neurons and other cutaneous end organ structures to amplify normal touch sensation. Although it is possible that the mechanical deficits displayed by the PIEZO1cKO mice were due to indirect developmental effects of PIEZO1 deletion on the structure or function of the epidermis rather than a decrease in keratinocyte mechanical signaling, we observed no deficits in cold or heat behaviors in the PIEZO1cKO mice, suggesting that general somatosensation was not affected in the mutants. Furthermore, we did not observe gross changes in epidermal morphology, suggesting that general epidermal disorganization was not the main driver of the decreased mechanical sensitivity exhibited by the PIEZO1cKO mice.

PIEZO1 is a key keratinocyte mechanotransducer

Previous work has demonstrated that keratinocytes are inherently mechanically sensitive (Tsutsumi et al., 2009; Goto et al., 2010; Koizumi et al., 2004). However, the molecular transducer that converts force into cellular responses in keratinocytes was unknown (Moehring et al., 2018b; Talagas et al., 2020b). Here, we show that PIEZO1 deletion substantially reduces the number of keratinocytes that respond to membrane indentation; 51.35% of keratinocytes were insensitive to mechanical indentation following deletion of PIEZO1. These results indicate that PIEZO1 is a key mechanotransducer in keratinocytes, mirroring the role PIEZO2 plays in both Merkel cells and dorsal root ganglia (DRG) neurons (Woo et al., 2014; Ranade et al., 2014b; Coste et al., 2010). In the population of PIEZO1cKO keratinocytes that retained mechanical sensitivity, the mechanical threshold was higher than those observed in wild-type keratinocytes. Furthermore, PIEZO1 deletion reduced but did not eliminate the number of rapidly and intermediately adapting currents. These changes in mechanical response properties suggest that one or more unknown mechanotransducers function to detect mechanical stimuli in a subset of keratinocytes. One potential candidate for this function is PIEZO2, which is shown to mediate the rapidly adapting mechanical currents in DRG neurons and Merkel cells. However, keratinocytes express low levels of PIEZO2 transcript, making it unlikely to be the primary contributor to the remaining keratinocyte mechanical sensitivity (Hoffman et al., 2018; Coste et al., 2010). In addition to PIEZO1, keratinocytes express a host of ion channels that may modulate keratinocyte mechanical responses downstream of bona fide mechanotransducers. These include members of the transient receptor potential (TRP) family of ion channels, such as TRPV4 and TRPC5 (Peier et al., 2002; Tu et al., 2005; O’Neil and Heller, 2005; Shen et al., 2015). Interestingly, TRPV4 expression in keratinocytes is required for the development of mechanical allodynia in a mouse model of sunburn pain (Moore et al., 2013). Additionally, TRPC5 expression is required for the development of mechanical allodynia in several inflammatory and neuropathic pain models (Sadler et al., 2021), although the contribution of epidermal TRPC5 to injury induced mechanical hypersensitivity remains to be explored. Whether TRPV4, TRPC5, and/or other channels contribute to normal keratinocyte mechanotransduction, or the potential sensitization of keratinocyte mechanotransduction following injury, warrants further investigation beyond this current study.

Epidermal PIEZO1 is important for mechanically induced sensory afferent firing

Our teased fiber recordings revealed that deletion of PIEZO1 from the epidermis selectively decreased the firing frequency of Aδ fibers. This difference was most notable at the higher range of forces tested, indicating that epidermal PIEZO1 is important for the high intensity firing of Aδ fibers. However, the PIEZO1cKO animals had deficits in behavioral responses to both light touch and high-threshold mechanical stimuli. A potential explanation is that the reflexive behavioral responses to touch may rely on the summation of activity in many overlapping receptive fields, and therefore, activity in keratinocytes from a broad area of skin. Alternatively, the mechanical responsiveness of a single afferent fiber may rely on signaling from far fewer keratinocytes. Interestingly, Aδ nociceptors have been shown to mediate behavioral responses to pinprick stimuli (Arcourt et al., 2017), which was the behavior most affected by loss of epidermal PIEZO1 in our high-speed imaging experiments.

We found that epidermal PIEZO1 deletion had no effect on the mechanical responses of SA-Aβ fibers. This is likely because Merkel cells tune the mechanical responses of these fibers and Merkel cell mechanical sensitivity is primarily mediated by PIEZO2 (Maksimovic et al., 2014; Woo et al., 2014). Surprising to us, however, was that C fiber afferents from PIEZO1cKO and wild-type preparations exhibited similar mechanical firing frequency and mechanical thresholds. This was unexpected since many C fiber terminals are closely apposed to keratinocytes (Zylka et al., 2005) and, in experiments performed by Baumbauer, Deberry, and Adelman, et al., optogenetic inhibition of epidermal cells decreased C fiber mechanical firing in 12 of 25 fibers tested (Baumbauer et al., 2015). It is possible that the absence of an effect of keratinocyte PIEZO1 deletion on C fiber mechanical sensitivity may be explained by differences in our teased fiber recording methods compared to those used by Baumbauer and colleagues; we apply our mechanical stimulus to the dermal side of the skin, whereas Baumbauer et al. applied their mechanical stimulus to the corneum (i.e., how an external mechanical stimulus would naturally be applied to the skin in vivo). Alternatively, because many C fibers terminate more superficially in the epidermis than Aδ fibers (Zylka et al., 2005), it is possible that the differentiated keratinocytes of the outer epidermis rely on a different mechanotransducer than PIEZO1 to encode tactile information. We recently reported that keratinocytes release ATP in response to mechanical stimulation, which subsequently acts at purinergic receptors on sensory terminals to mediate tactile sensation (Moehring et al., 2018a). Therefore, ATP may be one of the signaling molecules linking epidermal PIEZO1 activity to sensory neuron responses. In addition to ATP, keratinocytes can release a variety of other neuroactive factors, including calcitonin gene-related peptide β, acetylcholine, glutamate, epinephrine, neurotrophic growth factors, endothelin-1, and cytokines (Hou et al., 2011; Shi et al., 2013; Barr et al., 2013; Moore et al., 2013; Lumpkin and Caterina, 2007) the contribution of these ligands to neuro-epithelial mechanical signaling remains to be explored.

An important caveat to our findings is that the use of the keratin 14 (K14) promotor to target PIEZO1 deletion in the epidermis means that we cannot definitively rule out the contribution of other K14-expressing cells to our experiments. For example, Merkel cells express K14 and would have PIEZO1 deleted from them (Maksimovic et al., 2014; Woo et al., 2014). However, given that keratinocytes make up the vast majority of cells in the epidermis (>95%) (Fuchs, 1995), and Merkel cells express minimal PIEZO1 (Maksimovic et al., 2014; Hoffman et al., 2018), we hypothesize that our findings are largely mediated by keratinocytes. Furthermore, it is unlikely that our PIEZO1 deletion is targeting the recently discovered sensory Schwann cells, as these cells do not express Keratin 14 (P. Ernfors, personal communication, unpublished data).

Chemical activation of epidermal PIEZO1 induces behavioral mechanical hypersensitivity

Yoda1 application induced robust calcium flux in both isolated mouse and human keratinocytes. The functional expression of PIEZO1 in human keratinocytes is intriguing as it suggests that epidermal PIEZO1 may also play a role in human touch sensation. PIEZO1 loss of function mutations have been identified in human patients (Lukacs et al., 2015; Alper, 2017), but to our knowledge, quantitative sensory testing, like that which has been performed in patients with PIEZO2 loss of function mutations (Chesler et al., 2016), has not yet been completed in these individuals. This type of study could reveal important information about the role of PIEZO1 in human touch sensation.

We found that intraplantar injection of the PIEZO1 specific agonist Yoda1 induced paw attending behaviors in wild-type but not PIEZO1cKO mice, suggesting that activation of epidermal PIEZO1 is sufficient to induce behavioral responses. However, application of Yoda1 to the receptive fields of functionally identified primary afferent fibers failed to induce action potential firing. This result was surprising given that Yoda1 induced calcium responses in isolated keratinocytes and PIEZO1 is functionally expressed in itch-specific sensory neurons (Hill et al., 2022). Because we applied Yoda1 to the dermal layer of the skin, it is possible that Yoda1 failed to penetrate sufficiently to the PIEZO1 expressing cells in the epidermis to induce sensory fiber firing. Interestingly, we observed an increase in C fiber mechanical sensitivity following Yoda1 application, an effect that was dependent on epidermal PIEZO1 expression. Therefore, an alternative explanation is that the Yoda1 induced behaviors may reflect increased hindpaw mechanical sensitivity, such that the innocuous force produced by the paw resting on the glass floor becomes sufficient to induce paw attending. In line with this hypothesis, we found that intraplantar injections of Yoda1 induced mechanical allodynia in wild-type but not PIEZO1cKO mice. Indeed, while Yoda1 can activate PIEZO1 channels on its own, it prominently sensitizes PIEZO1 to mechanical stimulation (Syeda et al., 2015; Lacroix et al., 2018). Such an increase in PIEZO1 mechanical sensitivity may explain why the effects of Yoda1 on sensory fiber firing were only observed in the presence of mechanical force. Interestingly, the team of Baumbauer, DeBerry, and Adelman reported that subthreshold mechanical stimulation could induce firing in high-threshold mechanically sensitive afferents when paired with optogenetic activation of keratinocytes (Baumbauer et al., 2015). This suggests that sensitization of keratinocyte mechanical signaling may enhance sensory afferent responses to force. This idea is intriguing, as injury induced sensitization of keratinocyte mechanotransduction may contribute to the development of mechanical allodynia and hyperalgesia. Alterations in keratinocyte function and signaling contribute to inflammatory and neuropathic cutaneous pain states, such as psoriasis, dermatitis, fibromyalgia, complex regional pain syndrome, and postherpetic neuralgia (Benhadou et al., 2019; Kim and Leung, 2018; Li et al., 2009; Evdokimov et al., 2020; Zhao et al., 2008). Furthermore, in a mouse model of sunburn pain, UVB light exposure resulted in profound mechanical and heat allodynia, effects which were completely dependent on UVB-induced activation and sensitization of keratinocyte expressed TRPV4 (Moore et al., 2013). Thus, injury-induced sensitization of keratinocyte mechanotransducers may enhance normal keratinocyte activation in response to mechanical stimulation and subsequent signaling to sensory neurons.

Conclusion

In summary, the data presented here demonstrate that epidermal PIEZO1 is critical for normal touch sensation in mice and that PIEZO1 is also expressed and functional in human keratinocytes. Future studies will focus on whether PIEZO1 signaling and resulting keratinocyte activity may be altered in injury models leading to mechanical hypersensitivity and allodynia.

Materials and methods

Animals

To target epidermal keratinocytes, a Keratin14 (Krt14)Cre driver was used, as Krt14 is expressed in all keratinocytes as early as E9.5 (Byrne et al., 1994; Wang et al., 1997; Dassule et al., 2000). These mice (Jackson Laboratory, Farmington) were mated with Piezo1loxp/loxp animals (Jackson Laboratory) to produce offspring that lacked PIEZO1 in K14-expressing cells and were genotyped as either Krt14Cre+ Piezo1loxp/loxp (PIEZO1cKO) or Krt14Cre- Piezo1loxp/loxp (wild type; wt). For all studies a mixture of male and female mice aged 6–20 weeks were used. Male and female mice were analyzed separately, and no sex differences were observed. Therefore, data shown in graphs show combined results of both sexes.

Animals had ad libitum access to food and water and were housed in a climate-controlled room with a 12:12 light:dark cycle, on Sani-Chips aspen wood chip bedding (P.J. Murphy Forest and Products, New Jersey) with a single pack of ENVIROPAK nesting material (W.F Fisher & Son, Inc, New Jersey). All animals were group housed with a minimum of 3 mice per cage. All animal procedures were strictly adhered according to the NIH Guide for the Care and Use of Laboratory animals and were performed in accordance with the Institutional Animal Care and Use Committee at the Medical College of Wisconsin (approval #0383). This manuscript adheres to the applicable ARRIVE guidelines.

Primary keratinocyte cell culture

Primary mouse keratinocytes were cultured from glabrous hindpaw tissue as previously described (Moehring et al., 2018a; Sadler et al., 2020 ). Briefly, isolated glabrous hindpaw skin was incubated at room temperature (RT) in 10 mg/mL dispase (Gibco, ThermoFisher Scientific, Waltham, MA) for 45 min. Primary human keratinocytes were isolated from human skin tissue (procured through the MCW Tissue Bank) as previously described (Sadler et al., 2020). Human skin was incubated overnight at 4 ° C in 10 mg/mL dispase. Following the dispase incubation, the epidermal sheet was separated from the dermis and incubated at RT in 50% EDTA (Sigma-Aldrich) and 0.05% trypsin (Sigma) in Hanks’ Balanced Salt Solution without calcium chloride, magnesium chloride and magnesium sulfate (Gibco) for 27 min. After 27 min, 15% heat inactivated fetal bovine serum (ThermoFisher Scientific, Carlsbad, CA) was added and the epidermal sheets were rubbed against the base of a petri dish to separate the keratinocytes. Keratinocytes were grown for 3 days in Epilife media (Gibco) supplemented with 1% human keratinocyte growth supplement (Gibco), 0.2% GibcoAmphotericin B (250 µg/mL of Amphotericin B and 205 µg/mL sodium deoxycholate, Gibco) and 0.25% penicillin-streptomycin (Gibco) on laminin coated coverslips. Plates were kept at 37 °C and 5% CO2 conditions. Growth media was exchanged every 2 days.

RNA isolation and quantitative real-time PCR

Keratinocytes were isolated from the glabrous hindpaw skin of PIEZO1cKO animals and littermate controls as described above. RNA was isolated from these keratinocytes using the PureLink RNA Mini Kit (LifeTechnologies, Carlsbad, CA). Total RNA content was assessed with a Nanodrop Lite spectrophotometer (Thermo Scientific, Wilmington, DE). cDNA was generated using the SuperScript III First-Strand Synthesis System (Invitrogen, LifeTechnologies). Quantitative real-time PCR reaction was performed on a BIO-RAD CFX96 system (Bio-Ra, Hercules, CA). Samples were run in triplicate. Gene expression was normalized to Hprt. The following primer sets were used: mPiezo1-qF: CTTACACGGTTGCTGGTTGG; mPiezo1-qR: CACTTGATGAGGGCGGAAT; Hprt-qF: GTTAAGCAGTACAGCCCCAAA; Hprt-qR: AGGGCATATCCAACAACAAACTT (Wang et al., 2020).

Calcium imaging

Calcium imaging was performed on keratinocytes on their third day in culture. Keratinocytes were loaded with 2.5 µg/mL Fura-2-AM, a dual-wavelength ratiometric calcium indicator dye, in 2% BSA for 45 min at RT then washed with extracellular buffer for 30 min. Keratinocytes were superfused with RT extracellular buffer (pH 7.4, 320 Osm) containing (in mM) 150 NaCl, 10 HEPES, 8 glucose, 5.6 KCl, 2 CaCl2, and 1 MgCl2, and viewed on a Nikon Eclipse TE200 inverted microscope. Nikon elements software (Nikon Instruments, Melville, NY) was used to capture fluorescence images at 340 and 380 nm. Responsive cells were those that exhibited >30% increase in 340/380 nm ratio from baseline. Yoda-1 (Sigma-Aldrich) was prepared from a 10 mM stock solution (5 mg Yoda1 in DMSO) at 62.5, 125, 250, 500, and 1000 (nM) concentrations in extracellular buffer for the dose response curve. Yoda-1 was applied for 3 min and washed out for 3 min.

Behavioral assays

For all spontaneous and evoked behavior experiments, the experimenter was blinded to genotype throughout testing and data entry. Animals were tested between 8am and 1pm and were allowed to acclimate for at least an hour to the new surroundings and experimenter before any behavior testing was performed.

Mechanical sensitivity: A battery of different assays using various stimuli were utilized to determine the mechanical sensitivity of the of PIEZO1cKO and wild-type littermate controls. Using the Up-Down method and a series of calibrated von Frey filaments ranging from 0.20 to 13.73 mN, mechanical thresholds of the glabrous hindpaw skin were assessed as previously described (Chaplan et al., 1994; Dixon, 1980). Additionally, the hindpaw skin was stimulated 10 times using a 3.61 mN von Frey Filament in the suprathreshold assay, and using a 0.6 mN von Frey Filament in the static light touch assay. The number of stimulus-evoked paw withdrawals were recorded (Weyer et al., 2016). Furthermore, we utilized a paintbrush that was stroked 10 times across the hindpaw and responses were categorized as: normal/innocuous (simple withdrawal of the paw), noxious (elevating the paw for extended periods of time, flicking and licking of the paw), and null responses (no withdrawal) (Cowie et al., 2019). Lastly, noxious mechanical sensitivity was assessed using the needle assay (Hogan et al., 2004; Garrison et al., 2014), where responses were categorized similar to the paintbrush assay.

To test heat sensitivity, mice were placed in a small plexiglass enclosures on top of a glass plate, and a focal radiant heat source was applied to the plantar hindpaw. The response latency to hind paw withdrawal from the heat stimulus was quantified (Hargreaves et al., 1988), with a cut off at 25 s to avoid tissue damage. Each paw was tested 4 times, with 5 min of rest between testing, and results were averaged for each animal.

To test cold sensitivity, animals were placed in small plexiglass enclosures on top of a thin 2.5-mm-thick glass plate, and powdered dry ice packed into a 10 mL syringe with the top cut off was pressed against the glass beneath the plantar surface of the hindpaw (Brenner et al., 2012). Withdrawal latencies were recorded three times for each paw, with 5 min of break in between testing, and results were averaged for each animal. The maximum time allowed for withdrawal was 20 s to avoid potential tissue damage.

Spontaneous behaviors were recorded in response to intraplantar Yoda-1 injections (10 µM, 100 µM, and 1 mM). Yoda1 or vehicle was injected into the plantar surface of the hindpaw and behaviors were recorded for 10 min following the injection. Videos were analyzed offline by an experimenter blinded to both genotype and treatment. Behaviors exhibited by the animals included biting and licking of the hindpaw.

High speed imaging was used to record withdrawal behaviors in response to von Frey filaments (0.6 g, 1.4 g, 4 g), paintbrush, and needle stimulation. Videos were recorded on a FastCAM UX100 high-speed camera (Photron, Tokyo, Japan) for five seconds at 2000 frames per second starting with the application of the mechanical stimulus to the hindpaw. Videos were analyzed offline using Fastcam software (Photron). Paw height was measured as the distance from the apex of the first upward movement to the point directly below it on the mesh, as previously described. Paw velocity was measured by taking two points at different frames during the first upward movement of the paw. Pain score was measured based on the presence of jumping, paw shaking, or paw guarding behaviors. The presence of each of these behaviors was worth 1 point toward the pain score. An animal displaying 2 of the 3 behaviors would receive a score of 2, whereas an animal exhibiting all three behaviors in response to the stimulus would receive a score of 3 (Abdus-Saboor et al., 2019; Jones et al., 2020).

H&E staining

A hematoxylin and eosin stain was performed to assess the general morphology of the glabrous skin of PIEZO1cKO and wild-type littermate controls. Glabrous skin of PIEZO1cKO and wild-type animals was dissected, and the tissue was fixed in 4% formaldehyde. The skin was processed, embedded in paraffin, sectioned into 4 μm sections and dried at RT until subsequent staining at the MCW Histology Core. Rehydrated sections were stained in hematoxylin for 3 min, washed in Richard-Allan Scientific Signature Series Clarifier 1,2 (for 45 sec, dipped for 30 sec in 0.1% ammonia water (bluing agent)), stained in eosin for 30 s, washed four times using 100% EtOH and lastly rinsed in Xylene. Slides were scanned using a Hamamatsu Nanozoomer HT slide scanner (Hamamatsu Photonics, K.K., Hamamatsu City, Japan) and images were assessed using NDP.View 2 software (Hamamatsu Photonics).

Patch clamp recordings

On the first day of culture, keratinocyte recordings were performed. Keratinocytes were superfused with RT extracellular normal HEPES solution containing (in mM): 127 NaCl, 3 KCl, 2.5 CaCl2,1 MgCl2, 10 HEPES, and 10 glucose, pH 7.35±0.05, and viewed on a Nikon Eclipse TE200 inverted microscope. Keratinocytes were patch clamped in voltage clamp mode (holding voltage –40 mV) with a borosilicate glass pipette (Sutter Instrument Company, Novato, CA) filled with intracellular solution containing (in mM): 135 KCl, 10 NaCl, 1 MgCl2, 1 EGTA, 0.2 NaGTP, 2.5 ATPNa2, 10 glucose and 10 HEPES, pH 7.25±0.05. Mechanical stimulation was elicited using a glass rod positioned approximately 2 µm from keratinocyte’s membrane and driven by a piezo stack actuator (PA25, PiezoSystem Jena, Jena, Germany) at a speed of 39.17 μm/ms. Keratinocytes were stimulated with a series of mechanical steps in 0.25 μm increments applied for 150ms every 30 s to avoid sensitization/desensitization of the cell membrane. Data was recorded using (Axon pCLAMP 11 software using Digidata 1550B and Axopatch 200B amplifier Molecular Devices LLC, San Jose, CA). The cell was considered mechanically insensitive if the inward current was not observed with 5.0 µm displacement beyond the initial touch. Current profiles were classified using the following parameters: rapidly adapting (RA, inactivation time constant (τ)>10ms), intermediately adapting (IA, 10ms < τ<30ms), and slowly adapting (SA; τ<30ms) current.

Ex vivo teased nerve fiber recordings

Tibial skin nerve recordings were performed as previously described (Reeh, 1988; Hoffman et al., 2018). Briefly, animals were anesthetized and sacrificed via cervical dislocation. The leg of the animal was shaved and the glabrous skin with the innervating tibial nerve was quickly removed and placed in a heated (32 +- 0.5 °C), oxygenated bath (pH 7.45 +- 0.05) consisting of (in mM): 123 NaCl, 3.5 KCl, 2.0 CaCl2, 0.7 MgSO4, 1.7 NaH2PO4, 5.5 glucose, 7.5 sucrose 9.5 sodium gluconate and 10 HEPES. Small nerve bundles were placed on a recording electrode and a blunt glass probe was used to search for receptive fields of single afferent fibers. Fibers were characterized based on their shape and conduction velocities: C-fibers<1.2 m/s; Aδ-fibers 1.2–10 m/s; and Aβ-fibers>10 m/s (Koltzenburg et al., 1997). Only slowly adapting Aβ and Aδ fibers were collected. Action potential thresholds were determined using a continuous force ramp (0–100 mN over 10 s). A custom designed feedback-controlled mechanical stimulator was used to stimulate the receptive fields with 2, 5, 10, 20, 40, 100, and 150 mN for 10 s. Sensitization was prevented by allowing 1 min breaks between mechanical stimulations. Data was recorded and analyzed with LabChart (ADInstruments; Colorado Springs, CO). A 3D printed plastic moat secured to the tissue with vacuum seal grease was used for recordings where Yoda1 was introduced to mechanically sensitive receptive fields. Drug was administered after determining the threshold with a continuous force ramp as described above, all other mechanical stimuli was conducted after addition of the drug. A 1 min recovery time was recorded to observe any drug induced activity.

Data analysis

Histological comparisons were made using a two-way ANOVA. For calcium imaging data, the percentage of keratinocytes responding was compared via Chi square and post hoc Fisher’s Exact tests. For behavior experiments, paw withdrawal thresholds and repeated stimulus responses were compared between two groups using non-parametric Mann-Whitney U-tests. Types of responses to the paintbrush and needle stimulus were analyzed using Chi square test with Fisher’s exact tests. Spontaneous behavior was assessed using a Kruskal Wallis test or two-way ANOVA with Tukey’s post-hoc test. Paw withdrawal latencies were compared between two groups using the Student’s (two-tailed) t test. For high-speed imaging, percent responders to each stimulus were compared via Chi square and post hoc Fisher’s Exact tests. Cumulative z-scores were analyzed using a two-way ANOVA with Bonferroni adjustment. Average z-score was compared using a Student’s (two-tailed) t-test.

Skin nerve recordings were analyzed using a repeated measures two-way ANOVA with Sidak post-hoc test. Skin nerve mechanical thresholds were analyzed using Student’s (two-tailed) t test. Patch clamp mechanical thresholds were analyzed using a Mann-Whitney U-test. Current amplitudes were analyzed using a non-parametric Mann-Whitney U-test. Percent responders to the patch clamp mechanical stimulus and current profile were compared using a Chi square and post hoc Fisher’s exact tests.

For all behavior experiments, ‘n’ corresponds to the number of animals. For patch clamp studies, skin nerve recordings, or calcium imaging experiments at least n=3 animals were utilized for each group shown, and the n on the graph corresponds to the number of cells, fibers, or repetitions. For qPCR experiments, an n of three animals per group were utilized. Summarized data are reported as mean ± SEM. The number within the bars on the graph corresponds to the number of animals used. All data analyses were performed using Prism 7 software (GraphPad, La Jolla, CA), with an alpha value of 0.05 set a priori. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, n.s. denotes a non-significant comparison.

Acknowledgements

The authors thank Michael Lawlor, MD for assessing gross morphological differences between skin samples, as well as Reilly Allison and Sarah Langer for experimental assistance. The authors also thank the Medical College of Wisconsin Histology Core for tissue sectioning and staining, the Medical College of Wisconsin Imaging Core for slide scanning, and the Medical College of Wisconsin Tissue Bank for human skin tissues.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Cheryl L Stucky, Email: cstucky@mcw.edu.

Alexander Theodore Chesler, National Institutes of Health, United States.

Kenton J Swartz, National Institute of Neurological Disorders and Stroke, National Institutes of Health, United States.

Funding Information

This paper was supported by the following grants:

  • National Institute of Neurological Disorders and Stroke NS040538 to Cheryl L Stucky.

  • National Institute of Neurological Disorders and Stroke NS070711 to Cheryl L Stucky.

  • National Institute of Neurological Disorders and Stroke NS108278 to Cheryl L Stucky.

  • Medical College of Wisconsin Advancing a Healthier Wisconsin Endowment to Cheryl L Stucky.

  • National Institute of Neurological Disorders and Stroke 1F31NS125941-01 to Alexander R Mikesell.

Additional information

Competing interests

No competing interests declared.

No competing interests declared.

Author contributions

Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing – review and editing.

Formal analysis, Validation, Investigation, Methodology, Writing – review and editing.

Conceptualization, Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing – review and editing.

Conceptualization, Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing – review and editing.

Data curation, Formal analysis, Investigation, Methodology, Writing – review and editing.

Conceptualization, Supervision, Funding acquisition, Writing – review and editing.

Ethics

Animal experimentation: All protocols were in accordance with National Institutes of Health guidelines and were approved by the Institutional Animal Care and Use Committee at the Medical College of Wisconsin (Milwaukee, WI; protocol #383).

Additional files

Transparent reporting form

Data availability

All data generated or analyzed during this study are included in the manuscript and supporting files.

References

  1. Abdo H, Calvo-Enrique L, Lopez JM, Song J, Zhang MD, Usoskin D, El Manira A, Adameyko I, Hjerling-Leffler J, Ernfors P. Specialized cutaneous schwann cells initiate pain sensation. Science. 2019;365:695–699. doi: 10.1126/science.aax6452. [DOI] [PubMed] [Google Scholar]
  2. Abdus-Saboor I, Fried NT, Lay M, Burdge J, Swanson K, Fischer R, Jones J, Dong P, Cai W, Guo X, Tao YX, Bethea J, Ma M, Dong X, Ding L, Luo W. Development of a mouse pain scale using sub-second behavioral mapping and statistical modeling. Cell Reports. 2019;28:1623–1634. doi: 10.1016/j.celrep.2019.07.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alper SL. Genetic diseases of PIEZO1 and PIEZO2 dysfunction. Current Topics in Membranes. 2017;79:97–134. doi: 10.1016/bs.ctm.2017.01.001. [DOI] [PubMed] [Google Scholar]
  4. Arcourt A, Gorham L, Dhandapani R, Prato V, Taberner FJ, Wende H, Gangadharan V, Birchmeier C, Heppenstall PA, Lechner SG. Touch receptor-derived sensory information alleviates acute pain signaling and fine-tunes nociceptive reflex coordination. Neuron. 2017;93:179–193. doi: 10.1016/j.neuron.2016.11.027. [DOI] [PubMed] [Google Scholar]
  5. Barr TP, Albrecht PJ, Hou Q, Mongin AA, Strichartz GR, Rice FL. Air-stimulated ATP release from keratinocytes occurs through connexin hemichannels. PLOS ONE. 2013;8:e56744. doi: 10.1371/journal.pone.0056744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Baumbauer KM, DeBerry JJ, Adelman PC, Miller RH, Hachisuka J, Lee KH, Ross SE, Koerber HR, Davis BM, Albers KM. Keratinocytes can modulate and directly initiate nociceptive responses. eLife. 2015;4:e09674. doi: 10.7554/eLife.09674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Benhadou F, Mintoff D, Del Marmol V. Psoriasis: keratinocytes or immune cells - which is the trigger? Dermatology. 2019;235:91–100. doi: 10.1159/000495291. [DOI] [PubMed] [Google Scholar]
  8. Brenner DS, Golden JP, Gereau RW, Sakakibara M. A novel behavioral assay for measuring cold sensation in mice. PLOS ONE. 2012;7:e39765. doi: 10.1371/journal.pone.0039765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Byrne C, Tainsky M, Fuchs E. Programming gene expression in developing epidermis. Development. 1994;120:2369–2383. doi: 10.1242/dev.120.9.2369. [DOI] [PubMed] [Google Scholar]
  10. Cahalan SM, Lukacs V, Ranade SS, Chien S, Bandell M, Patapoutian A. Piezo1 links mechanical forces to red blood cell volume. eLife. 2015;4:e07370. doi: 10.7554/eLife.07370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL. Quantitative assessment of tactile allodynia in the rat paw. Journal of Neuroscience Methods. 1994;53:55–63. doi: 10.1016/0165-0270(94)90144-9. [DOI] [PubMed] [Google Scholar]
  12. Chesler AT, Szczot M, Bharucha-Goebel D, Čeko M, Donkervoort S, Laubacher C, Hayes LH, Alter K, Zampieri C, Stanley C, Innes AM, Mah JK, Grosmann CM, Bradley N, Nguyen D, Foley AR, Le Pichon CE, Bönnemann CG. The role of PIEZO2 in human mechanosensation. The New England Journal of Medicine. 2016;375:1355–1364. doi: 10.1056/NEJMoa1602812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Coste B, Mathur J, Schmidt M, Earley TJ, Ranade S, Petrus MJ, Dubin AE, Patapoutian A. Piezo1 and piezo2 are essential components of distinct mechanically activated cation channels. Science. 2010;330:55–60. doi: 10.1126/science.1193270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Cowie AM, Menzel AD, O’Hara C, Lawlor MW, Stucky CL. NOD-like receptor protein 3 inflammasome drives postoperative mechanical pain in a sex-dependent manner. Pain. 2019;160:1794–1816. doi: 10.1097/j.pain.0000000000001555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dalghi MG, Clayton DR, Ruiz WG, Al-Bataineh MM, Satlin LM, Kleyman TR, Ricke WA, Carattino MD, Apodaca G. Expression and distribution of PIEZO1 in the mouse urinary tract. American Journal of Physiology. Renal Physiology. 2019;317:F303–F321. doi: 10.1152/ajprenal.00214.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Dassule HR, Lewis P, Bei M, Maas R, McMahon AP. Sonic hedgehog regulates growth and morphogenesis of the tooth. Development. 2000;127:4775–4785. doi: 10.1242/dev.127.22.4775. [DOI] [PubMed] [Google Scholar]
  17. Dixon WJ. Efficient analysis of experimental observations. Annual Review of Pharmacology and Toxicology. 1980;20:441–462. doi: 10.1146/annurev.pa.20.040180.002301. [DOI] [PubMed] [Google Scholar]
  18. Eisenhoffer GT, Loftus PD, Yoshigi M, Otsuna H, Chien CB, Morcos PA, Rosenblatt J. Crowding induces live cell extrusion to maintain homeostatic cell numbers in epithelia. Nature. 2012;484:546–549. doi: 10.1038/nature10999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Evdokimov D, Kreß L, Dinkel P, Frank J, Sommer C, Üçeyler N. Pain-associated mediators and axon pathfinders in fibromyalgia skin cells. The Journal of Rheumatology. 2020;47:140–148. doi: 10.3899/jrheum.190248. [DOI] [PubMed] [Google Scholar]
  20. Friedrich EE, Hong Z, Xiong S, Zhong M, Di A, Rehman J, Komarova YA, Malik AB. Endothelial cell piezo1 mediates pressure-induced lung vascular hyperpermeability via disruption of adherens junctions. PNAS. 2019;116:12980–12985. doi: 10.1073/pnas.1902165116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Fuchs E. Keratins and the skin. Annual Review of Cell and Developmental Biology. 1995;11:123–153. doi: 10.1146/annurev.cb.11.110195.001011. [DOI] [PubMed] [Google Scholar]
  22. Garrison SR, Weyer AD, Barabas ME, Beutler BA, Stucky CL. A gain-of-function voltage-gated sodium channel 1.8 mutation drives intense hyperexcitability of A- and C-fiber neurons. Pain. 2014;155:896–905. doi: 10.1016/j.pain.2014.01.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Goto M, Ikeyama K, Tsutsumi M, Denda S, Denda M. Calcium ion propagation in cultured keratinocytes and other cells in skin in response to hydraulic pressure stimulation. Journal of Cellular Physiology. 2010;224:229–233. doi: 10.1002/jcp.22121. [DOI] [PubMed] [Google Scholar]
  24. Hargreaves K, Dubner R, Brown F, Flores C, Joris J. A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain. 1988;32:77–88. doi: 10.1016/0304-3959(88)90026-7. [DOI] [PubMed] [Google Scholar]
  25. Hill RZ, Bautista DM. Getting in touch with mechanical pain mechanisms. Trends in Neurosciences. 2020;43:311–325. doi: 10.1016/j.tins.2020.03.004. [DOI] [PubMed] [Google Scholar]
  26. Hill RZ, Loud MC, Dubin AE, Peet B, Patapoutian A. PIEZO1 transduces mechanical itch in mice. Nature. 2022;607:104–110. doi: 10.1038/s41586-022-04860-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Hoffman BU, Baba Y, Griffith TN, Mosharov EV, Woo SH, Roybal DD, Karsenty G, Patapoutian A, Sulzer D, Lumpkin EA. Merkel cells activate sensory neural pathways through adrenergic synapses. Neuron. 2018;100:1401–1413. doi: 10.1016/j.neuron.2018.10.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Hogan Q, Sapunar D, Modric-Jednacak K, McCallum JB. Detection of neuropathic pain in a rat model of peripheral nerve injury. Anesthesiology. 2004;101:476–487. doi: 10.1097/00000542-200408000-00030. [DOI] [PubMed] [Google Scholar]
  29. Holt JR, Zeng WZ, Evans EL, Woo SH, Ma S, Abuwarda H, Loud M, Patapoutian A, Pathak MM. PIEZO1-Induced Cellular Retraction Controls Keratinocyte Migration in Wound Healing. bioRxiv. 2020 doi: 10.1101/2020.10.18.344598. [DOI]
  30. Hou Q, Barr T, Gee L, Vickers J, Wymer J, Borsani E, Rodella L, Getsios S, Burdo T, Eisenberg E, Guha U, Lavker R, Kessler J, Chittur S, Fiorino D, Rice F, Albrecht P. Keratinocyte expression of calcitonin gene-related peptide β: implications for neuropathic and inflammatory pain mechanisms. Pain. 2011;152:2036–2051. doi: 10.1016/j.pain.2011.04.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Jones JM, Foster W, Twomey CR, Burdge J, Ahmed OM, Pereira TD, Wojick JA, Corder G, Plotkin JB, Abdus-Saboor I. A machine-vision approach for automated pain measurement at millisecond timescales. eLife. 2020;9:e57258. doi: 10.7554/eLife.57258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kim BE, Leung DYM. Significance of skin barrier dysfunction in atopic dermatitis. Allergy, Asthma & Immunology Research. 2018;10:207–215. doi: 10.4168/aair.2018.10.3.207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Koizumi S, Fujishita K, Inoue K, Shigemoto-Mogami Y, Tsuda M, Inoue K. Ca2+ waves in keratinocytes are transmitted to sensory neurons: the involvement of extracellular ATP and p2y2 receptor activation. The Biochemical Journal. 2004;380:329–338. doi: 10.1042/BJ20031089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Koltzenburg M, Stucky CL, Lewin GR. Receptive properties of mouse sensory neurons innervating hairy skin. Journal of Neurophysiology. 1997;78:1841–1850. doi: 10.1152/jn.1997.78.4.1841. [DOI] [PubMed] [Google Scholar]
  35. Lacroix JJ, Botello-Smith WM, Luo Y. Probing the gating mechanism of the mechanosensitive channel piezo1 with the small molecule yoda1. Nature Communications. 2018;9:2029. doi: 10.1038/s41467-018-04405-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Li WW, Sabsovich I, Guo TZ, Zhao R, Kingery WS, Clark DJ. The role of enhanced cutaneous IL-1beta signaling in a rat tibia fracture model of complex regional pain syndrome. Pain. 2009;144:303–313. doi: 10.1016/j.pain.2009.04.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Li J, Hou B, Tumova S, Muraki K, Bruns A, Ludlow MJ, Sedo A, Hyman AJ, McKeown L, Young RS, Yuldasheva NY, Majeed Y, Wilson LA, Rode B, Bailey MA, Kim HR, Fu Z, Carter DA, Bilton J, Imrie H, Ajuh P, Dear TN, Cubbon RM, Kearney MT, Prasad RK, Evans PC, Ainscough JF, Beech DJ. Piezo1 integration of vascular architecture with physiological force. Nature. 2014;515:279–282. doi: 10.1038/nature13701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lukacs V, Mathur J, Mao R, Bayrak-Toydemir P, Procter M, Cahalan SM, Kim HJ, Bandell M, Longo N, Day RW, Stevenson DA, Patapoutian A, Krock BL. Impaired PIEZO1 function in patients with a novel autosomal recessive congenital lymphatic dysplasia. Nature Communications. 2015;6:1–7. doi: 10.1038/ncomms9329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Lumpkin EA, Caterina MJ. Mechanisms of sensory transduction in the skin. Nature. 2007;445:858–865. doi: 10.1038/nature05662. [DOI] [PubMed] [Google Scholar]
  40. Maksimovic S, Nakatani M, Baba Y, Nelson AM, Marshall KL, Wellnitz SA, Firozi P, Woo SH, Ranade S, Patapoutian A, Lumpkin EA. Epidermal merkel cells are mechanosensory cells that tune mammalian touch receptors. Nature. 2014;509:617–621. doi: 10.1038/nature13250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Moehring F, Cowie AM, Menzel AD, Weyer AD, Grzybowski M, Arzua T, Geurts AM, Palygin O, Stucky CL. Keratinocytes mediate innocuous and noxious touch via ATP-P2X4 signaling. eLife. 2018a;7:e31684. doi: 10.7554/eLife.31684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Moehring F, Halder P, Seal RP, Stucky CL. Uncovering the cells and circuits of touch in normal and pathological settings. Neuron. 2018b;100:349–360. doi: 10.1016/j.neuron.2018.10.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Moore C, Cevikbas F, Pasolli HA, Chen Y, Kong W, Kempkes C, Parekh P, Lee SH, Kontchou NA, Yeh I, Ye I, Jokerst NM, Fuchs E, Steinhoff M, Liedtke WB. UVB radiation generates sunburn pain and affects skin by activating epidermal TRPV4 ion channels and triggering endothelin-1 signaling. PNAS. 2013;110:E3225–E3234. doi: 10.1073/pnas.1312933110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Neubarth NL, Emanuel AJ, Liu Y, Springel MW, Handler A, Zhang Q, Lehnert BP, Guo C, Orefice LL, Abdelaziz A, DeLisle MM, Iskols M, Rhyins J, Kim SJ, Cattel SJ, Regehr W, Harvey CD, Drugowitsch J, Ginty DD. Meissner corpuscles and their spatially intermingled afferents underlie gentle touch perception. Science. 2020;368:eabb2751. doi: 10.1126/science.abb2751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Ojeda-Alonso J, Calvo-Enrique L, Paricio-Montesinos R, Kumar R, Zhang MD, Poulet JFA, Ernfors P, Lewin GR. Sensory Schwann Cells Are Required for Mechanical Nociception and Touch Perception. bioRxiv. 2022 doi: 10.1101/2022.02.04.477749. [DOI] [PMC free article] [PubMed]
  46. O’Neil RG, Heller S. The mechanosensitive nature of TRPV channels. Pflugers Archiv. 2005;451:193–203. doi: 10.1007/s00424-005-1424-4. [DOI] [PubMed] [Google Scholar]
  47. Peier AM, Reeve AJ, Andersson DA, Moqrich A, Earley TJ, Hergarden AC, Story GM, Colley S, Hogenesch JB, McIntyre P, Bevan S, Patapoutian A. A heat-sensitive TRP channel expressed in keratinocytes. Science. 2002;296:2046–2049. doi: 10.1126/science.1073140. [DOI] [PubMed] [Google Scholar]
  48. Ranade SS, Qiu Z, Woo SH, Hur SS, Murthy SE, Cahalan SM, Xu J, Mathur J, Bandell M, Coste B, Li YSJ, Chien S, Patapoutian A. Piezo1, a mechanically activated ion channel, is required for vascular development in mice. PNAS. 2014a;111:10347–10352. doi: 10.1073/pnas.1409233111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Ranade SS, Woo SH, Dubin AE, Moshourab RA, Wetzel C, Petrus M, Mathur J, Bégay V, Coste B, Mainquist J, Wilson AJ, Francisco AG, Reddy K, Qiu Z, Wood JN, Lewin GR, Patapoutian A. Piezo2 is the major transducer of mechanical forces for touch sensation in mice. Nature. 2014b;516:121–125. doi: 10.1038/nature13980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Reeh PW. Sensory receptors in a mammalian skin-nerve in vitro preparation. Progress in Brain Research. 1988;74:271–276. doi: 10.1016/s0079-6123(08)63024-1. [DOI] [PubMed] [Google Scholar]
  51. Sadler KE, Moehring F, Stucky CL. Keratinocytes contribute to normal cold and heat sensation. eLife. 2020;9:e58625. doi: 10.7554/eLife.58625. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Sadler KE, Moehring F, Shiers SI, Laskowski LJ, Mikesell AR, Plautz ZR, Brezinski AN, Mecca CM, Dussor G, Price TJ, McCorvy JD, Stucky CL. Transient receptor potential canonical 5 mediates inflammatory mechanical and spontaneous pain in mice. Science Translational Medicine. 2021;13:eabd7702. doi: 10.1126/scitranslmed.abd7702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Shen B, Wong CO, Lau OC, Woo T, Bai S, Huang Y, Yao X. Plasma membrane mechanical stress activates TRPC5 channels. PLOS ONE. 2015;10:e0122227. doi: 10.1371/journal.pone.0122227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Shi X, Wang L, Clark JD, Kingery WS. Keratinocytes express cytokines and nerve growth factor in response to neuropeptide activation of the ERK1/2 and JNK MAPK transcription pathways. Regulatory Peptides. 2013;186:92–103. doi: 10.1016/j.regpep.2013.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Syeda R, Xu J, Dubin AE, Coste B, Mathur J, Huynh T, Matzen J, Lao J, Tully DC, Engels IH, Petrassi HM, Schumacher AM, Montal M, Bandell M, Patapoutian A. Chemical activation of the mechanotransduction channel piezo1. eLife. 2015;4:e07369. doi: 10.7554/eLife.07369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Talagas M, Lebonvallet N, Leschiera R, Elies P, Marcorelles P, Misery L. Intra-epidermal nerve endings progress within keratinocyte cytoplasmic tunnels in normal human skin. Experimental Dermatology. 2020a;29:387–392. doi: 10.1111/exd.14081. [DOI] [PubMed] [Google Scholar]
  57. Talagas M, Lebonvallet N, Berthod F, Misery L. Lifting the veil on the keratinocyte contribution to cutaneous nociception. Protein & Cell. 2020b;11:239–250. doi: 10.1007/s13238-019-00683-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Talagas M, Lebonvallet N, Leschiera R, Sinquin G, Elies P, Haftek M, Pennec JP, Ressnikoff D, La Padula V, Le Garrec R, L’herondelle K, Mignen O, Le Pottier L, Kerfant N, Reux A, Marcorelles P, Misery L. Keratinocytes communicate with sensory neurons via synaptic-like contacts. Annals of Neurology. 2020c;88:1205–1219. doi: 10.1002/ana.25912. [DOI] [PubMed] [Google Scholar]
  59. Tsutsumi M, Inoue K, Denda S, Ikeyama K, Goto M, Denda M. Mechanical-stimulation-evoked calcium waves in proliferating and differentiated human keratinocytes. Cell and Tissue Research. 2009;338:99–106. doi: 10.1007/s00441-009-0848-0. [DOI] [PubMed] [Google Scholar]
  60. Tu CL, Chang W, Bikle DD. Phospholipase cgamma1 is required for activation of store-operated channels in human keratinocytes. The Journal of Investigative Dermatology. 2005;124:187–197. doi: 10.1111/j.0022-202X.2004.23544.x. [DOI] [PubMed] [Google Scholar]
  61. Wang X, Zinkel S, Polonsky K, Fuchs E. Transgenic studies with a keratin promoter-driven growth hormone transgene: prospects for gene therapy. PNAS. 1997;94:219–226. doi: 10.1073/pnas.94.1.219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Wang L, You X, Lotinun S, Zhang L, Wu N, Zou W. Mechanical sensing protein PIEZO1 regulates bone homeostasis via osteoblast-osteoclast crosstalk. Nature Communications. 2020;11:1–12. doi: 10.1038/s41467-019-14146-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Weyer AD, Zappia KJ, Garrison SR, O’Hara CL, Dodge AK, Stucky CL. Nociceptor sensitization depends on age and pain chronicity(1,2,3) ENeuro. 2016;3:2649–2656. doi: 10.1523/ENEURO.0115-15.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Woo SH, Ranade S, Weyer AD, Dubin AE, Baba Y, Qiu Z, Petrus M, Miyamoto T, Reddy K, Lumpkin EA, Stucky CL, Patapoutian A. Piezo2 is required for merkel-cell mechanotransduction. Nature. 2014;509:622–626. doi: 10.1038/nature13251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Zhao P, Barr TP, Hou Q, Dib-Hajj SD, Black JA, Albrecht PJ, Petersen K, Eisenberg E, Wymer JP, Rice FL, Waxman SG. Voltage-gated sodium channel expression in rat and human epidermal keratinocytes: evidence for a role in pain. Pain. 2008;139:90–105. doi: 10.1016/j.pain.2008.03.016. [DOI] [PubMed] [Google Scholar]
  66. Zylka MJ, Rice FL, Anderson DJ. Topographically distinct epidermal nociceptive circuits revealed by axonal tracers targeted to mrgprd. Neuron. 2005;45:17–25. doi: 10.1016/j.neuron.2004.12.015. [DOI] [PubMed] [Google Scholar]

Editor's evaluation

Alexander Theodore Chesler 1

Although sensory neurons are thought to be the primary detectors of environmental stimuli in skin, it is more and more appreciated that non-neuronal cell types also play important roles. This study investigates whether a very common type of cell in the skin functions in touch sensation and identifies the mechanically gated ion channel Piezo1 as key gene.

Decision letter

Editor: Alexander Theodore Chesler1
Reviewed by: Alexander Theodore Chesler2, Philippe Séguéla3

Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "Piezo1 mediates keratinocyte mechanotransduction" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, including Alexander Theodore Chesler as Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Kenton Swartz as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Philippe Séguéla (Reviewer #3).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Overview of requested revisions (Recommendations for the authors):

Each reviewer had distinct suggestions for improving the manuscript including additional analyses of the datasets. Please refer to the individual reviews below and address as many of these comments as possible. If a particular comment cannot be addressed, please state the reason.

Reviewer #1 (Recommendations for the authors):

Summary:

Although sensory neurons are thought to be the primary detectors of environmental stimuli in skin, it is more and more appreciated that non-neuronal cell types also play important roles. Previous work from the Stucky group (and others) has shown stimulation of optical excitation of keratinocytes can evoke action potentials in sensory neurons and behavioural responses suggesting functional connectivity. Earlier work from the Stucky group provided evidence that keratinocytes are thermosenstive and required for normal temperature sensation. Here, they look into whether these cells are also important for mechanosensation. Moehring and colleagues convincingly show that keratinocytes have mechanically evoked currents mediated by Piezo1. They next provide evidence that removing Piezo1 from keratinocytes reduces the frequency of spiking in select types of sensory neurons to punctate and dynamic touch stimuli. Finally, they supply quite surprising data documenting significant behavioural deficits in Krt-conditional knockout mice.

Overall, an intriguing topic although I do have some questions. My biggest concerns is that the differences in the skin-nerve recordings are quite subtle whereas the behavioural effects are remarkably robust. How do the author reconcile this? Similarly, it is hard to understand how such profound mechanical deficits could be occurring given the known essential role for Piezo2 in many of these touch behaviours

Major Comments

1. This manuscript is lacking a discussion.

2. In the skin nerve prep experiments, the authors should examine the response of Abeta and ADelta fibres to Yoda1 application to the skin. If Piezo1-expressing keratinocytes strongly couple to these fibres, then Yoda1 application should cause AP firing selectively in large calibre mechanically-sensitive afferents. Given the relatively low expression of Piezo1 in these afferents, the Yoda1-induced firing should be abolished by keratinocyte-specific deletion of Piezo1. This experiment would strongly support the author's interpretation of their behavioural experiments using Yoda1.

3. Piezo2 is required in LTMRs for light touch sensation. Can the authors explain why Piezo1 in keratinocytes is not sufficient to support residual touch sensation in the afferent Piezo2 KO lines? If the authors interpretation is correct, the Yoda1 behavioural experiments imply that keratinocyte Piezo1 activation is sufficient to drive behavioural responses.

4. In the skin nerve prep experiments, SA-Abeta fibres showed deficient firing in the keratinocyte Piezo1 KO only at the very highest applied forces. Likewise for Adelta. The authors also show the SA-Abeta threshold was not altered. On the other hand, in the behavioural experiments the keratinocyte Piezo1 KO animals showed a remarkable impairment for both high-threshold AND light touch stimuli. How do the authors explain the reduced behavioural response to low-threshold stimuli given the unaltered afferent responses to stimuli of a similar type?

5. Figure 1C and 1E – the figures show that virtually 100% of mouse and human keratinocytes respond to the highest doses of Yoda1. The lack of response in the mouse KO to the highest Yoda1 dose indicates this must be Piezo1-mediated, and by implication 100% of keratinocytes express functional Piezo1. This seems very high and worth commenting on. Do the authors have immuno or RNAscope data to expect ubiquitous expression of Piezo1 in keratinocytes? The authors have previously shown that keratinocytes respond to cold temperatures. How can keratinocytes selectively regulate cold sensation when the same cold-sensing keratinocytes presumably also express Piezo1 and are mechanosensitive, and thus also couple to the mechanically sensitive afferents?

6. Similarly, keratinocytes respond to cold, hot and mechanical stimuli? How then would there be any selectivity at the sensory neuron level? Something doesn't quite make sense to me.

7. Figure 2A – the current clamp experiments need representative traces of the force-dependent membrane depolarization to gauge the shape/kinetics of the response. E.g. at the highest forces, do you see a VG calcium spike(let) that rides on top of the depolarization attributable to Piezo1 opening? (Would expect this given the calcium imaging!)

8. It is surprising that Piezo1 knockout diminishes the amplitude of mechano-currents but not the activation threshold- can the authors discuss what they think is happening here?

Reviewer #2 (Recommendations for the authors):

Figure 3 B-D. These results put together suggest that keratinocytes have MA currents with three different kinetics and PIEZO1 is responsible for the RA mediated 60-70% of all MA responses in keratinocytes, whereas the remaining ~30% of the MA currents are unaccounted for and are likely mediated by an unknown mechanosensor. This is an interesting and important observation. I think a little more information in this figure will be helpful. Specifically, the authors should consider showing representative traces for the IA and SA responses. Pannel C and D suggests that in addition to a decrease in RA currents, knocking out PIEZO1 results in smaller MA currents in the remaining IA/SA containing cells. Is this true? This a bit confusing and the authors should consider describing these panels better.

Reviewer #3 (Recommendations for the authors):

Moehring and collaborators report that the mechanosensitive channel Piezo1 is expressed in keratinocytes in mice and humans and claim that it contributes to touch sensation. The identification of Piezo1 as a major mechanotransducer in keratinocytes is convincing however proving its direct role in touch would require more solid experimental evidence.

Major issues

1) K14 expression is not exclusive to keratinocytes (refs 1,2), therefore both expression and conditional KO of Piezo1 in other K14-expressing epidermal cells (i.e. melanocytes, Langerhans cells) could contribute to the cellular and behavioral responses observed.

2) In absence of a functional link (release of a mediator?) demonstrated between activation of Piezo1 in keratinocytes and transduction in primary sensory neurons, the changes observed in the cKO mice could be due to developmental or homeostatic effects of the cKO in the epidermis and their indirect consequences on the mechanosensitivity of cutaneous sensory fibers. Supplemental figure 3 does not address potential changes in cellular composition of the epidermis in adult cKO mice.

3) Supplemental Figure 1. If Piezo1 is a major mechanotransducer in keratinocytes, it is not clear to me how its ablation does not have any measurable impact on their mechanical threshold.

4) Figure 3 A-F: the typical traces shown in A, C, E do not fit with quantitative data in B, D, F. This discrepancy is more obvious in the condition of 40 mN stimulations for the three types of fibers.

5) Figure 4J is missing.

6) The manuscript title does not reflect the complete story. The sections on mechanosensory fibers and touch are left out.

Other comments

1) Figure 1A shows a double normalization. The real expression level of Piezo1mRNA (i.e. relative to HPRT) in wildtype vs. cKO is not indicated.

2) Figure 1B. How many cells have been recorded from how many mice in both conditions?

3) Based on the currents (or absence of) shown in figures 2B and based on 2C, panel 2D does not fit, or this was plotted should be explained.

4) Figure 2C. How many cells have been recorded in both groups? Is there an effect of the cKO on the phenotypes of IA and SA currents?

5) Figure 3. Timescales missing in panels A-F.

6) Figure 4E. Does a stimulation with a needle ever evoke normal/innocuous, not always nocifensive responses?

7) The doses used for the agonist Yoda1 in vitro and in vivo are vastly different (Figures 1 and 4). Is it a typo?

8) Page 8. "Spontaneous behaviors" for behavioral outcomes elicited by Yoda1 injection is too vague.

References

1-Yoshimura N, Motohashi T, Aoki H, Tezuka K, Watanabe N, Wakaoka T, Era T, Kunisada T. Dual origin of melanocytes defined by Sox1 expression and their region-specific distribution in mammalian skin. Dev Growth Differ. 2013 Feb;55(2):270-81. doi: 10.1111/dgd.12034. Epub 2013 Jan 24. PMID: 23347447.

2-De La Cruz Diaz JS, Kaplan DH. Langerhans cells spy on keratinocytes. J Invest Dermatol. 2019 Nov;139(11):2260-2262. doi: 10.1016/j.jid.2019.06.120. PMID: 31648687; PMCID: PMC6818751.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Keratinocyte PIEZO1 mediates mechanosensation" for further consideration by eLife. Your revised article has been evaluated by Kenton Swartz (Senior Editor) and a Reviewing Editor.

The manuscript has been improved but there are just a few remaining issues that need to be addressed (see below). Most importantly, the reviewers all felt the work needed to be revised in light of the recent findings by Hill et al., that Piezo1 is expressed in sensory neurons and mediates mechanical itch.

Reviewer #1 (Recommendations for the authors):

The authors have done an admirable job addressing the reviewer's questions. Notably, the new data clarify important details.

We have a few remaining questions:

1. The revised patch clamp recordings cast doubt on the relevance of Piezo1 in keratinocyte mechanotransduction. Keratinocytes respond robustly to Piezo1 agonist (Figure 1C-F), yet they have very little Piezo1 transcript (Figure 1A) and are minimally affected by Piezo1cKO (Figure 2).

2. Is there a clearer effect of Piezo1cKO if the mechanical threshold and current amplitude (Figure 2B, F) are analyzed in separate groups of RA, IA, and SA currents?

3. Why do the representative RA currents run down with increasing membrane indentation (Figure 2A)?

4. The Yoda1-induced paw attending behavior (Figure 4B) is also hard to interpret – it seems unlikely to be due to the discussed mechanism of neuronal sensitization because the mechanical threshold for neuron firing is unchanged (Figure 4D)

5. Very recently it was shown that Piezo1 is functionally expressed in mouse NppB/Ssst positive neurons and drives mechanical itch responses. Could this be another explanation for the paw-attending behavior? Even though that work came out after the initial submission, it would be great if can be addressed and cited here.

6. Similarly, if Piezo1 is expressed in a subset of c-Fibers, is it surprising there seem to be no responses to Yoda in the skin-nerve recordings? Can this be discussed?

Reviewer #3 (Recommendations for the authors):

The authors have addressed reviewers' comments satisfactorily and the manuscript is significantly improved.

Due to recently published findings on the role of PIEZO1 in mechanical itch (Hill et al., 2022), they must now address the potential impact of the expression of PIEZO1 in subsets of primary somatosensory neurons on the interpretation of their data on Yoda1-evoked fiber firing activity and behavioral responses.

The title could be downtoned as keratinocyte PIEZO1 appears to be neither necessary nor sufficient for mechanosensation.

eLife. 2022 Sep 2;11:e65987. doi: 10.7554/eLife.65987.sa2

Author response

Reviewer #1 (Recommendations for the authors):

1. This manuscript is lacking a discussion.

We have updated the manuscript to include a full Discussion section.

2. In the skin nerve prep experiments, the authors should examine the response of Abeta and ADelta fibres to Yoda1 application to the skin. If Piezo1-expressing keratinocytes strongly couple to these fibres, then Yoda1 application should cause AP firing selectively in large calibre mechanically-sensitive afferents. Given the relatively low expression of Piezo1 in these afferents, the Yoda1-induced firing should be abolished by keratinocyte-specific deletion of Piezo1. This experiment would strongly support the author's interpretation of their behavioural experiments using Yoda1.

To address this question, we performed teased fiber recordings while applying 1 mM Yoda1 to the receptive field of identified fibers. We found that Yoda1 application failed to induce any Yoda1-induced firing in any fiber types tested (Aβ n=10, Aδ n=10, C fibers n=10). In contrast, 1 μM capsaicin to the same receptive fields induced robust firing in all C fibers tested. These findings suggest that Yoda1 does not directly induce firing in primary afferent terminals, which is at odds with our original interpretation of the behavior data in Figure 4 where Yoda1 injection into the hind paw induced paw withdrawal behaviors. In light of this, we hypothesized that these behaviors induced by direct activation of PIEZO1 expressing cells were withdrawal behaviors elicited by Yoda1-mediated mechanical sensitization, such that the pressure of the glass floor on the paw skin was sufficient to induce withdrawal responses. To test this on a behavioral level, we measured von Frey withdrawal thresholds in mice following intraplantar injection of Yoda1. Yoda1 decreased the withdrawal thresholds of wildtype mice 30 min post injection but had no effect on PIEZO1cKO mice (Figure 4G). Next, we performed additional teased fiber recordings in the presence of 1 mM Yoda1 while simultaneously mechanically stimulating the receptive fields of identified fibers (Figure 4C-F). We found that Yoda1 elevated the mechanical firing frequency of C fiber types in wildtype preparations but had no effect on the mechanical responses of A fiber afferents. Interestingly, the Yoda1 induced mechanical sensitization of C fiber afferents was absent in PIEZO1cKO preparations, indicating a requirement for epidermal PIEZO1. These findings suggest that the Yoda1-induced behavioral responses were primarily due to the epidermal-PIEZO1 mediated sensitization of C fiber afferents.

3. Piezo2 is required in LTMRs for light touch sensation. Can the authors explain why Piezo1 in keratinocytes is not sufficient to support residual touch sensation in the afferent Piezo2 KO lines? If the authors interpretation is correct, the Yoda1 behavioural experiments imply that keratinocyte Piezo1 activation is sufficient to drive behavioural responses.

Based on our recently added teased fiber recordings (see comment 2 above), Yoda1 application is not sufficient to initiate firing in sensory fibers but does sensitize C fiber afferents to mechanical stimulation in an epidermal-PIEZO1 dependent manor. Therefore, we believe that both keratinocytes and sensory neuron mechanoreceptors function together to mediate touch sensation. Neither epidermal PIEZO1 deletion nor optogenetic inhibition is sufficient to completely abolish behavioral responses to mechanical stimulation, indicating the requirement of neuronal mechanotransducers in these behavioral responses. We hypothesize that activation of keratinocyte PIEZO1 amplifies (likely through the release of signaling mediators such as ATP) but does not necessarily initiate sensory fiber responses to mechanical force. In the absence of neuronal PIEZO2, the keratinocyte to neuronal mechanical signaling does not appear to be sufficient to on its own preserve behavioral responses to light touch.

4. In the skin nerve prep experiments, SA-Abeta fibres showed deficient firing in the keratinocyte Piezo1 KO only at the very highest applied forces. Likewise for Adelta. The authors also show the SA-Abeta threshold was not altered. On the other hand, in the behavioural experiments the keratinocyte Piezo1 KO animals showed a remarkable impairment for both high-threshold AND light touch stimuli. How do the authors explain the reduced behavioural response to low-threshold stimuli given the unaltered afferent responses to stimuli of a similar type?

We performed additional teased fiber recordings on all fiber types and our revised data in Figure 3 and figure 4 show that there is little effect of keratinocyte PIEZO1 deletion on afferent firing to mechanical stimulation of the receptive field. The only difference that remains is a decrease in PIEZO1cKO Aδ mechanically induced firing frequency, specifically at the highest forces tested. The dichotomy between the effect of PIEZO1 deletion on behavior and lack of effect on terminal firing is even more striking with the addition of these new data. A potential explanation is that the reflexive behavioral responses to touch may rely on the summation of activity in many overlapping receptive fields, and therefore, activity in keratinocytes from a broad area of skin. Alternatively, the mechanical responsiveness of a single afferent fiber may rely on far fewer keratinocytes. Another possibility is that the nature of our teased fiber recording preparation is not entirely representative of the processes that occur during in vivo mechanical stimulation; in our preparation the vasculature and connective tissues are removed and the corium (inside) of the epidermis is stimulated. In behavioral experiments, the stratum corneum (outermost layer) of keratinocytes was stimulated; perhaps there are anatomical differences in the ways in which keratinocytes respond to punctate stimuli in the two directional formats.

5. Figure 1C and 1E – the figures show that virtually 100% of mouse and human keratinocytes respond to the highest doses of Yoda1. The lack of response in the mouse KO to the highest Yoda1 dose indicates this must be Piezo1-mediated, and by implication 100% of keratinocytes express functional Piezo1. This seems very high and worth commenting on. Do the authors have immuno or RNAscope data to expect ubiquitous expression of Piezo1 in keratinocytes?

We performed RNAscope on skin sections and found that Piezo1 mRNA is expressed throughout the epidermis in wild type skin and this staining is not present in the PIEZO1cKO skin. These findings are presented in Figure 1A. Although virtually 100% of keratinocytes responded during Yoda1 application, it is possible that some of these responses may not actually be due to Yoda1 but rather caused by the release of paracrine compounds from nearby cells that are activated by Yoda1.

6. Similarly, keratinocytes respond to cold, hot and mechanical stimuli? How then would there be any selectivity at the sensory neuron level? Something doesn't quite make sense to me.

Thank you for bringing up this interesting point. Based on previous work from our lab and others, we hypothesize that keratinocytes function as general detectors and amplifiers of cold, heat, and mechanical sensation by signaling to sensory neurons and thus increasing their likelihood of firing. For example, we have identified keratinocyte ATP release as important for normal behavioral responses to cold, heat and mechanical stimuli. Thus, epidermal purinergic signaling appears to be a ubiquitous mechanism that amplifies sensory neuron firing to multiple modalities of somatosensory stimuli. Detection of the sensory stimulus (cold, heat, mechanical) still requires the sensory fiber and it is likely at the level of the sensory neuron that sensory selectivity is mainly regulated. The keratinocytes seem to be generic amplifiers of somatosensory stimuli that function to potentiate but not necessarily initiate sensory neuron firing in response to heat, cold and mechanical stimuli. Additionally, there may exist modality-specific signaling pathways that convey specific aspects of cold, heat or mechanical stimuli to sensory neurons, although future studies are needed to identify these.

7. Figure 2A – the current clamp experiments need representative traces of the force-dependent membrane depolarization to gauge the shape/kinetics of the response. E.g. at the highest forces, do you see a VG calcium spike(let) that rides on top of the depolarization attributable to Piezo1 opening? (Would expect this given the calcium imaging!)

We had issues finding representative traces to clearly illustrate attributes of the mechanically induced current in keratinocytes, thus we decided to repeat these patch clamp experiments to confirm our original data set. Two skilled electrophysiologists in the lab have now independently observed results similar to those presented in updated Figure 2. Specifically, we show that PIEZO1cKO keratinocytes require a greater level of indentation to elicit mechanical currents compared to wild-type cells, indicating PIEZO1cKO keratinocytes have elevated mechanical thresholds (Figure 2B). In addition, there was an increase in the proportion of mechanically insensitive cells in PIEZO1cKO group compared to wild type (Figure 2C). In whole-cell current clamp mode we observed activation of fast conductance (presumably, calcium or sodium voltage-gated channels) in response to the indentation-induced membrane depolarization. We did not include these data in resubmission as we are still in the process of studying the effect of mechanical stimulation on keratinocytes membrane voltage and plan to describe these mechanisms in a future study.

8. It is surprising that Piezo1 knockout diminishes the amplitude of mechano-currents but not the activation threshold- can the authors discuss what they think is happening here?

We have updated the patch data in figure 2 and now find that PIEZO1 deletion increases the activation threshold of keratinocytes. However, the amplitude of the evoked mechanical current in keratinocytes did not show a clear dependence on the increase of membrane indentation depth. Figure 2A shows a representative example of a MA current evoked in a keratinocyte in response to stepwise increase in membrane indentation.

Reviewer #2 (Recommendations for the authors):

Figure 3 B-D. These results put together suggest that keratinocytes have MA currents with three different kinetics and PIEZO1 is responsible for the RA mediated 60-70% of all MA responses in keratinocytes, whereas the remaining ~30% of the MA currents are unaccounted for and are likely mediated by an unknown mechanosensor. This is an interesting and important observation. I think a little more information in this figure will be helpful. Specifically, the authors should consider showing representative traces for the IA and SA responses. Pannel C and D suggests that in addition to a decrease in RA currents, knocking out PIEZO1 results in smaller MA currents in the remaining IA/SA containing cells. Is this true? This a bit confusing and the authors should consider describing these panels better.

Thank you for these comments. As mentioned in our responses to Reviewer 1, we re-evaluated the effects of PIEZO1 deletion on mechanically activated currents in keratinocytes. Example traces of different mechanical currents are now presented on Figure 2D. Our new data show that the percentage of cells that did not responded to membrane indentation is significantly increased in the PIEZO1cKO group compared to control. However, in this new data set, we did not observe any significant difference in the proportion of RA, IA, or SA currents evoked in PIEZO1cKO or wildtype keratinocytes.

Reviewer #3 (Recommendations for the authors):

Moehring and collaborators report that the mechanosensitive channel Piezo1 is expressed in keratinocytes in mice and humans and claim that it contributes to touch sensation. The identification of Piezo1 as a major mechanotransducer in keratinocytes is convincing however proving its direct role in touch would require more solid experimental evidence.

Major issues

1) K14 expression is not exclusive to keratinocytes (refs 1,2), therefore both expression and conditional KO of Piezo1 in other K14-expressing epidermal cells (i.e. melanocytes, Langerhans cells) could contribute to the cellular and behavioral responses observed.

Although keratinocytes make up the vast majority (>95%) of epidermal cells, Reviewer 3 is correct in that other K14 expressing cells may be contributing the observed behavioral effects of the PIEZO1 knockout. We have updated the language in the manuscript when discussing the in vivo and ex vivo experiments to reflect this. We have also added to the discussion to better describe this limitation of the study.

2) In absence of a functional link (release of a mediator?) demonstrated between activation of Piezo1 in keratinocytes and transduction in primary sensory neurons, the changes observed in the cKO mice could be due to developmental or homeostatic effects of the cKO in the epidermis and their indirect consequences on the mechanosensitivity of cutaneous sensory fibers. Supplemental figure 3 does not address potential changes in cellular composition of the epidermis in adult cKO mice.

We agree and have updated our discussion to point out this limitation of our study. We tested the cold and heat sensitivities of wild type and PIEZO1cKO mice and found that there was no difference between the genotypes. Thus, any development or homeostatic effects of the knockout on behavior would have to be specific to mechanical sensitivity.

3) Supplemental Figure 1. If Piezo1 is a major mechanotransducer in keratinocytes, it is not clear to me how its ablation does not have any measurable impact on their mechanical threshold.

We conducted subsequent patch clamp recordings (see response to reviewer 1, comment 7 for more details) and now demonstrate a significant difference in mechanical threshold between the PIEZO1cKO keratinocytes and wildtype.

4) Figure 3 A-F: the typical traces shown in A, C, E do not fit with quantitative data in B, D, F. This discrepancy is more obvious in the condition of 40 mN stimulations for the three types of fibers.

We have updated the example traces to more accurately depict the quantitative data.

5) Figure 4J is missing.

Thank you for catching this. This is a typo, there is no figure 4J. We have updated to figure to correct this.

6) The manuscript title does not reflect the complete story. The sections on mechanosensory fibers and touch are left out.

We agree and have updated the title to Keratinocyte PIEZO1 mediates mechanosensation.

Other comments

1) Figure 1A shows a double normalization. The real expression level of Piezo1mRNA (i.e. relative to HPRT) in wildtype vs. cKO is not indicated.

Thank you for pointing out this error. We have removed the double normalization, the figure now displays the expression level of PIEZO1mRNA relative to HPRT in wildtype vs. PIEZO1cKO keratinocytes.

2) Figure 1B. How many cells have been recorded from how many mice in both conditions?

For patch clamp experiments we used 5 mice per group. Data was collected from 37 cells in Piezo1 cKO group and 23 cells in wildtype group. This data is now presented in the figure 2 legend.

3) Based on the currents (or absence of) shown in figures 2B and based on 2C, panel 2D does not fit, or this was plotted should be explained.

Thank you for pointing this out. In our original submission, 2D included only the cells that responded to membrane indentation with mechanical currents (none of the mechanically insensitive cells). However, as explained in the response to reviewer 1 comment 7, we have had to redo this data and the new patch data is displayed in figure 2 of the manuscript.

4) Figure 2C. How many cells have been recorded in both groups? Is there an effect of the cKO on the phenotypes of IA and SA currents?

We recorded n=23 cells from wildtype tissue and n=37 cells from PIEZO1cKO tissue. 18 cells responded to mechanical stimulation in each group. The figure legend has been updated to include this information. We did not observe any effect of the PIEZO1 deletion on the phenotype of IA and SA currents.

5) Figure 3. Timescales missing in panels A-F.

Thank you for bringing this omission to our attention. The figure legend has been updated to include the timescale (10 seconds).

6) Figure 4E. Does a stimulation with a needle ever evoke normal/innocuous, not always nocifensive responses?

Yes, the needle stimulus sometimes evokes a simple withdrawal reflex (categorized as a normal response), a paw attending response (categorized as a nocifensive response), or the animal fails to respond to the needle stimulus (no response).

7) The doses used for the agonist Yoda1 in vitro and in vivo are vastly different (Figures 1 and 4). Is it a typo?

This is not a typo, we used higher doses for our in vivo experiments.

8) Page 8. "Spontaneous behaviors" for behavioral outcomes elicited by Yoda1 injection is too vague.

We agree and have updated the text to describe these as Yoda1 induced paw attending behaviors. Based on our Yoda1 skin nerve data (figure 4), we no longer consider these spontaneous behaviors, but rather the result of Yoda1 sensitizing the injected paw to mechanical stimulation, as described in our response to Reviewer 1 comment 1.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Reviewer #1 (Recommendations for the authors):

The authors have done an admirable job addressing the reviewer's questions. Notably, the new data clarify important details.

We have a few remaining questions:

1. The revised patch clamp recordings cast doubt on the relevance of Piezo1 in keratinocyte mechanotransduction. Keratinocytes respond robustly to Piezo1 agonist (Figure 1C-F), yet they have very little Piezo1 transcript (Figure 1A) and are minimally affected by Piezo1cKO (Figure 2).

The reviewer is correct that we observed less robust PIEZO1 mRNA staining than would have been expected based on the calcium imaging data. This was surprising given that recent publications examining the role of keratinocyte PIEZO1 in wound healing (PMID: 34569935) and the epidermal mesenchymal transition (PMID: 35615675) both found more robust PIEZO1 expression in keratinocytes than we observed here. This discrepancy may reflect differences in the techniques used between these studies; we used RNAscope to measure PIEZO1 mRNA expression in the skin, whereas the other studies used PIEZO1 reporter lines and immunohistochemistry to visualize PIEZO1 expression in the epidermis. Thus, it is possible that the PIEZO1 mRNA staining we performed underrepresents the amount of PIEZO1 protein present in these cells. Ultimately, cellular function is a more sensitive reporter assay than mRNA transcript. Our data in the PIEZO1cKO keratinocytes shows no Yoda1-induced responses, indicating that the Yoda1-induced function is entirely due to PIEZO1.

For our patch clamp studies, the most noticeable effect of PIEZO1cKO was in the number of keratinocytes that failed to respond to the mechanical stimulus when it was applied (21.74% of the WT vs. 51.35% of the PIEZO1cKO cells were non-responsive to force). We also observed an increase in the mechanical threshold that elicited the first mechanical current upon membrane indentation in the PIEZO1cKO cells. However, we observed no change the maximum current amplitude evoked by membrane indentation in mechanically sensitive PIEZO1ckO keratinocytes compared to wildtype. This suggests that the role of PIEZO1 in keratinocyte mechanotransduction is in tuning the sensitivity of the cell to the mechanical stimulus but may be dispensable for the magnitude of inward current when the keratinocytes responds to force.

2. Is there a clearer effect of Piezo1cKO if the mechanical threshold and current amplitude (Figure 2B, F) are analyzed in separate groups of RA, IA, and SA currents?

All subtypes of mechanically induced current recorded in PIEZO1cKO keratinocytes showed a tendency for a higher threshold of current activation in response to the increase in membrane indentation compared to wildtype keratinocytes (please see data in (Author response table 1) ). The maximum amplitude was variable for all subtypes of current. We did not find any statistically significant difference between genotypes in these characteristics.

Author response table 1.

Type WT Piezo1cKO P value
Threshold RA 0.92±0.19 (n=9) 1.36±0.31 (n=9) 0.24
IA 1.13±0.48 (n=4) 2.13±0.63 (n=2)
SA 0.85±0.22 (n=5) 1.86±0.48 (n=7) 0.13
MAX amplitude RA 126.4±38.76 (n=9) 214±78.62 (n=9) 0.73
IA 282.8±136.3 (n=4) 79.5±40.50 (n=2)
SA 320.8±164.8 (n=5) 128.1±48.03 (n=7) 0.22
Open in a new tab

3. Why do the representative RA currents run down with increasing membrane indentation (Figure 2A)?

We found that there was a large amount of variability in the current amplitude evoked by mechanical stimulation at each stimulus intensity in keratinocytes. As such, we did not observe a relationship between stimulus intensity and the amplitude of the evoked current. In some keratinocytes, the cell would respond with the largest inward current in response to the lowest membrane indentation and decrease in amplitude as the stimulus intensity was increased. In other keratinocytes, an intermediate intensity stimulus evoked the largest amplitude current. As such, the average maximum amplitude comparison in Figure 2C represents the maximum current amplitude evoked during the entire cell’s recording, regardless of stimulus intensity. These results in keratinocytes are very different to results from our recordings in isolated Dorsal Root Ganglion neurons where we observe a clear stimulus-intensity current-amplitude relationship using a similar stimulation protocol (PMID: 29563343). At this point, we do not have an explanation for the finding that keratinocytes do not respond in a stimulus-graded manner to mechanical poking. Because our data indicate that the mechanical sensitivity of keratinocytes is a result of the amalgamated activation of several channels, some of which we have not identified, we suggest that the channels involved may have different inactivation kinetics that could affect the keratinocytes’ total membrane response to increasing membrane indentation. Future studies are needed to determine whether this speculation is accurate or not.

4. The Yoda1-induced paw attending behavior (Figure 4B) is also hard to interpret – it seems unlikely to be due to the discussed mechanism of neuronal sensitization because the mechanical threshold for neuron firing is unchanged (Figure 4D)

We agree that the Yoda1-induced paw attending behavior is likely not due to direct neuronal sensitization by Yoda1 and have updated the text to better reflect and explain this. Since this attending behavior was reduced in the PIEZO1cKO mice, we hypothesize that Yoda1 is acting on epidermal PIEZO1 and sensitizing the keratinocytes to mechanical stimulation. This sensitization may lead to increased release of signaling molecules from keratinocytes, such as ATP, in response to mechanical stimulation, leading to the increased C fiber firing that we show in 4D. Since there was an increase in the firing frequency of wildtype C fibers treated with Yoda1 but not PIEZO1cKO C fibers, this may indicate that keratinocyte PIEZO1 mediated paracrine signaling is important for the depolarization of neighboring sensory afferents, leading to sustained sensory fiber firing in response to stimulation.

5. Very recently it was shown that Piezo1 is functionally expressed in mouse NppB/Ssst positive neurons and drives mechanical itch responses. Could this be another explanation for the paw-attending behavior? Even though that work came out after the initial submission, it would be great if can be addressed and cited here.

Thank you for suggesting this. We have updated the Discussion to include these recent findings. Although we cannot rule out the contribution of neuronal PIEZO1 to the Yoda1 paw attending behaviors, we believe our findings are specific to epidermal PIEZO1 since the PIEZO1 conditional keratinocyte knockout animals did not exhibit increased paw attending time following Yoda1 injection over vehicle treatment. This suggests that epidermal PIEZO1 is necessary for these responses, at least 10 minutes after Yoda1 injection.

6. Similarly, if Piezo1 is expressed in a subset of c-Fibers, is it surprising there seem to be no responses to Yoda in the skin-nerve recordings? Can this be discussed?

We agree that it is surprising that Yoda1 failed to induce firing in the skin nerve preparation, both in light of our calcium imaging data showing robust keratinocyte responses to Yoda1 (Figure 1C) and in light of the recent Hill et al., 2022 article demonstrating a role for neuronal PIEZO1 in mechanical itch. Because we applied Yoda1 to the dermal layer of the skin, it is possible that Yoda1 failed to penetrate sufficiently to the PIEZO1 expressing cells in the epidermis to induce sensory fiber firing. Interestingly, we observed an increase in C fiber mechanical sensitivity following Yoda1 application, an effect that was dependent on epidermal PIEZO1 expression. Therefore, an alternative explanation is that the Yoda1 induced behaviors may reflect increased hindpaw mechanical sensitivity, such that the innocuous force produced by the paw resting on the glass floor becomes sufficient to induce paw attending. In line with this hypothesis, we found that intraplantar injections of Yoda1 induced mechanical allodynia in wild-type but not PIEZO1cKO mice. Indeed, while Yoda1 can activate PIEZO1 channels on its own, it has been shown to prominently sensitize PIEZO1 to mechanical stimulation26. Such an increase in PIEZO1 mechanical sensitivity may explain why the effects of Yoda1 on sensory fiber firing were only observed in the presence of mechanical force.

Reviewer #3 (Recommendations for the authors):

The authors have addressed reviewers' comments satisfactorily and the manuscript is significantly improved.

Due to recently published findings on the role of PIEZO1 in mechanical itch (Hill et al., 2022), they must now address the potential impact of the expression of PIEZO1 in subsets of primary somatosensory neurons on the interpretation of their data on Yoda1-evoked fiber firing activity and behavioral responses.

We have updated our discussion of the Yoda1 evoked behavior and fiber sensitization to include this recent publication.

The title could be downtoned as keratinocyte PIEZO1 appears to be neither necessary nor sufficient for mechanosensation.

We agree and have updated the title to “Keratinocyte PIEZO1 modulates cutaneous mechanosensation”.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—source data 1. Data for panals Figure 1B-F.
    elife-65987-fig1-data1.xlsx (1.3MB, xlsx)
    Figure 1—figure supplement 1—source data 1. Individual values for epidermal thickness.
    elife-65987-fig1-figsupp1-data1.xlsx (11.3KB, xlsx)
    Figure 2—source data 1. Data for mechanical threshold, percent responders, current profile and max amplitude of wt and PIEZO1cKO keratinocytes.
    elife-65987-fig2-data1.xlsx (12KB, xlsx)
    Figure 3—source data 1. Data for mechanically induced firing frequency of sensory afferents.
    elife-65987-fig3-data1.xlsx (16.5KB, xlsx)
    Figure 3—figure supplement 1—source data 1. Data for mechanical threshold.
    elife-65987-fig3-figsupp1-data1.xlsx (11.9KB, xlsx)
    Figure 4—source data 1. Data for time attending to hindpaws, Yoda1 induced firing frequency, and Yoda1 induced mechanical hypersensitivity.
    elife-65987-fig4-data1.xlsx (15.9KB, xlsx)
    Figure 5—source data 1. Data for behavioral mechanical sensitivity.
    elife-65987-fig5-data1.xlsx (17.1KB, xlsx)
    Figure 5—figure supplement 1—source data 1. Data for high speed imaging of mechanical sensitivity.
    elife-65987-fig5-figsupp1-data1.xlsx (13.3KB, xlsx)
    Transparent reporting form
    elife-65987-transrepform1.pdf (884.8KB, pdf)

    Data Availability Statement

    All data generated or analyzed during this study are included in the manuscript and supporting files.

    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES