Skip to main content
eLife logoLink to eLife
. 2022 Sep 26;11:e76721. doi: 10.7554/eLife.76721

c-Myc plays a key role in IFN-γ-induced persistence of Chlamydia trachomatis

Nadine Vollmuth 1, Lisa Schlicker 2, Yongxia Guo 1,3, Pargev Hovhannisyan 1, Sudha Janaki-Raman 4, Naziia Kurmasheva 1, Werner Schmitz 5, Almut Schulze 2,5, Kathrin Stelzner 1, Karthika Rajeeve 1,6,, Thomas Rudel 1,†,
Editors: Sophie Helaine7, Dominique Soldati-Favre8
PMCID: PMC9512400  PMID: 36155135

Abstract

Chlamydia trachomatis (Ctr) can persist over extended times within their host cell and thereby establish chronic infections. One of the major inducers of chlamydial persistence is interferon-gamma (IFN-γ) released by immune cells as a mechanism of immune defence. IFN-γ activates the catabolic depletion of L-tryptophan (Trp) via indoleamine-2,3-dioxygenase (IDO), resulting in persistent Ctr. Here, we show that IFN-γ induces the downregulation of c-Myc, the key regulator of host cell metabolism, in a STAT1-dependent manner. Expression of c-Myc rescued Ctr from IFN-γ-induced persistence in cell lines and human fallopian tube organoids. Trp concentrations control c-Myc levels most likely via the PI3K-GSK3β axis. Unbiased metabolic analysis revealed that Ctr infection reprograms the host cell tricarboxylic acid (TCA) cycle to support pyrimidine biosynthesis. Addition of TCA cycle intermediates or pyrimidine/purine nucleosides to infected cells rescued Ctr from IFN-γ-induced persistence. Thus, our results challenge the longstanding hypothesis of Trp depletion through IDO as the major mechanism of IFN-γ-induced metabolic immune defence and significantly extends the understanding of the role of IFN-γ as a broad modulator of host cell metabolism.

Research organism: Other

Introduction

Chlamydia trachomatis (Ctr) is an obligate intracellular human pathogen, which causes a broad range of acute and chronic diseases (Fenwick, 2012). It is the leading cause of bacterial sexually transmitted diseases (STD), with more than 130 million new cases annually (Newman et al., 2015). Infection of the urogenital tract by Chlamydia can lead to urethritis, infertility, ectopic pregnancies, and pelvic inflammatory disease (PID) (Malik et al., 2009; Svenstrup et al., 2008). Furthermore, left untreated, Chlamydia infection increases the risk of HIV infections (Galvin and Cohen, 2004; Ho et al., 1995) and might contribute to the development of cervical and ovarian cancer (Gagnaire et al., 2017; Hare et al., 1982; Koskela et al., 2000; Smith et al., 2004). The pathogen extensively interferes with the physiology of the infected cell, since it depends entirely on its host cell as a replicative niche during infection (Wang et al., 2011).

Chlamydiae have a unique biphasic life cycle, consisting of two physiologically and morphologically distinct forms (Gaylord, 1954). This gram-negative bacterium initiates its developmental cycle by attachment and invasion of the host cell by the elementary body (EB), the non-dividing infectious form of the pathogen. Inside the cell, EB stay within the endosomes, which they modify rapidly to create a replicative niche termed ‘inclusion’, to avoid lysosomal degradation (Hackstadt et al., 1997). EB differentiate into reticulate bodies (RB), which is the non-infectious replicating form of the pathogen. It takes several rounds of cell division until RB re-differentiate back into EB and the progenies are released by host cell lysis or extrusion, an exocytosis like mechanism, to infect neighbouring cells (Abdelrahman and Belland, 2005; Hybiske and Stephens, 2007). Apart from active infection, Chlamydia can turn into a dormant state called persistence and can remain over a long time, maybe even years (Suchland et al., 2017) within its host cell and thereby establish a chronic infection. During the persistent state, the pathogen remains viable and replicates its genome, but it exhibits decreased metabolic activity and inhibited cell division, which leads to the formation of enlarged pleomorphic aberrant bodies (AB) (Wyrick, 2010). The transition to the persistent form might represent an important chlamydial survival mechanism against antibiotics and the immune response of the host, since this process is reversible (Beatty et al., 1994; Wyrick, 2010). The conversion to this dormant stage is induced by penicillin (Tamura and Manire, 1968), iron deficiency (Raulston, 1997), amino acid starvation (Allan and Pearce, 1983b), and interferon-gamma (IFN-γ) (Beatty et al., 1994; Wyrick, 2010). IFN-γ is an immune-regulated cytokine, which is involved in the cell-intrinsic immunity against several intracellular pathogens, including Chlamydia (MacMicking, 2012). The downstream signalling pathways activated by IFN-γ are highly species specific and differ dramatically between mouse and human cells (Nelson et al., 2005). In human cells, the anti-chlamydial effect of IFN-γ is predominantly mediated by the induction of indoleamine-2,3-dioxygenase (IDO), an enzyme that catalyses the initial step of L-tryptophan (Trp) degradation to N-formyl kynurenine and kynurenine (Taylor and Feng, 1991). Ctr as a Trp auxotroph needs to take up Trp from the host cell for its development (Østergaard et al., 2016; Wyrick, 2010). Trp depletion by IFN-γ treatment therefore leads to persistence (Beatty et al., 1994; Byrne et al., 1986). However, Ctr contain a tryptophan synthase operon comprised of genes encoding the tryptophan repressor (TrpR) and tryptophan synthase α and β subunits (TrpA and TrpB, respectively) (Fehlner-Gardiner et al., 2002). Chlamydia with an intact tryptophan synthase operon have been shown to produce Trp from indole, a metabolic activity that can rescue these strains from IFN-γ-induced growth restriction, if indole is available at the site of infection (Caldwell et al., 2003; Ziklo et al., 2016).

IFN-γ belongs to the type II interferons that bind to the extracellular domain of the IFN-γ receptor, which is a heterodimer of the two subunits IFNGR1 and IFNGR2. The intracellular domains of the IFNGR1 subunits are associated with Janus kinase 1 (Jak1), while the IFNGR2 subunits are associated with Jak2. Activation of Jak1 and Jak2 results in phosphorylation of the receptor and subsequent recruitment and phosphorylation of signal transducer and activator of transcription (STAT1). STAT1 phosphorylation at tyrosine 701 and serine 727 leads to its homodimerization and nuclear translocation. Once in the nucleus, STAT1 homodimers bind to IFN-γ-activated sequence (GAS) elements in the promoters of target genes to regulate their transcription (Hu and Ivashkiv, 2009; Krause et al., 2006; Ramana et al., 2000). IFN-γ can function as both a growth inhibiting and promoting cytokine in a STAT1-dependent manner (Asao and Fu, 2000; Ramana et al., 2000). Binding of STAT1 homodimers to the consensus GAS elements in the c-myc promoter inhibits its expression transcriptionally (Ramana et al., 2000). Concurrently, c-myc expression is not only negatively regulated by STAT1 but stat1 is also a negative target gene of c-Myc. Hence, c-Myc and STAT1 regulate each other in a negative feedback loop at the transcriptional level (Schlee et al., 2007).

The transcription factor c-Myc targets genes involved in the regulation of numerous cellular processes, such as cell proliferation, cell growth, translation, metabolism, and apoptosis (Battey et al., 1983; Coffin et al., 1981; Dang, 1999; Duesberg and Vogt, 1979). Furthermore, c-Myc activity increases energy production, anabolic metabolism, promotion of aerobic glycolysis, and glutaminolysis, inducing mitochondrial biogenesis and tricarboxylic acid (TCA) cycle activity (Dang, 1999). Glutaminolysis increases the production of biomass by providing TCA cycle intermediates via anaplerosis, which enhances their availability for the production of amino acids, nucleotides, and lipids (Kress et al., 2015). c-Myc also critically controls nucleotide biosynthesis by directly regulating the expression of genes that encode the enzymes involved in the production of precursors of all nucleotides (Liu et al., 2008; Mannava et al., 2008). For example, c-Myc directly controls the cis-regulatory element in the 5’-UTR of phosphoribosyl pyrophosphate synthetase, which catalyses the first committed step in purine biosynthesis (Cunningham et al., 2014). In pyrimidine biosynthesis, the rate-limiting step is catalysed by carbamoyl aspartate dehydratase (CAD) (Evans and Guy, 2004), which is also regulated by c-Myc as a response to growth stimulatory signals, such as activation of EGFR/RAS/MAP kinase (Makinoshima et al., 2014), Hif 1/2 α (Gordan et al., 2007), or estrogen receptor/Sp1 (Khan et al., 2003) pathways. We recently identified a central role of c-Myc in the control of the metabolism in Chlamydia-infected cells (Rajeeve et al., 2020). Chlamydia has a reduced genome and only very limited metabolic capacity. For example, they have a truncated TCA cycle and lack the ability to synthesize purine and pyrimidine nucleotides de novo but acquire ATP and nucleosides from the host cell (McClarty and Tipples, 1991; Tipples and McClarty, 1993).

Expression of IDO and depletion of Trp has been previously described as the main reason for interferon-induced persistence in Chlamydia (Aiyar et al., 2014; Panzetta et al., 2018). Here, we show that IFN-γ induces a STAT1-dependent depletion of c-Myc in Chlamydia-infected cells, which de-regulates the host metabolism and induces Chlamydia persistence. Importantly, addition of the TCA cycle intermediate α-ketoglutarate or pyrimidine/purine nucleosides were sufficient to prevent persistence and restore chlamydial replication. Our data demonstrate a central role of c-Myc-regulated metabolic pathways in the IFN-γ-induced persistence of Ctr.

Results

IFN-γ treatment prevents c-Myc induction and impairs the development of Chlamydia

c-Myc is an important regulator of host cell metabolism and is indispensable for chlamydial acute infection and progeny formation (Rajeeve et al., 2020). Since Chlamydia adapts a parasitic lifestyle, and it has been shown that several environmental conditions affecting host cell metabolism like iron and amino acid starvation also induce chlamydial persistence (Allan and Pearce, 1983a; Raulston, 1997), we investigated the role of c-Myc in chlamydial persistence. From our previous study, it was known that ablation of c-Myc expression interfered with chlamydial development and progeny formation (Rajeeve et al., 2020). To investigate if Chlamydia enter a persistence state in c-Myc-depleted cells, we infected a HeLa 229 cell line with an anhydrotetracycline (AHT)-inducible short hairpin RNA (shRNA) for c-Myc in the absence and presence of the inducer. In agreement with our previous results (Rajeeve et al., 2020), silencing of c-Myc expression prevented normal inclusion formation and chlamydial development (Figure 1A, B and C). We then cultivated cells for 24 hr with AHT to suppress c-Myc expression (conditions 3 and 4; see Figure 1A). At this 24 hr time point, infection load and c-Myc levels were similarly low for conditions 3 and 4. We then either added AHT for another 12 hr (condition 3) or removed AHT (condition 4) to re-establish c-Myc expression (see scheme Figure 1A). In contrast to the cells with silenced c-Myc, removal of AHT efficiently restored inclusion formation (Figure 1A, B and C), suggesting that suppression of c-Myc induces a persistence state in Chlamydia. The bacteria obtained in the conditions 2, 3, and 4 were replated on fresh HeLa cell to test if they formed infectious EB under these conditions. These so-called secondary infections demonstrated that the development of EB was severely affected in condition 3, but not in the conditions 2 and 4 (Figure 1B and C). AHT alone did not impact inclusion formation in the absence of c-Myc suppression (Figure 1—figure supplement 1A, B).

Figure 1. Interferon-gamma (IFN-γ) induces depletion of c-Myc and impairs chlamydial growth.

(A) HeLa 229 cells with an anhydrotetracycline (AHT)-inducible expression of shc-Myc were infected with Chlamydia trachomatis (Ctr) at multiplicity of infection (MOI) 1. The infected cells were either left untreated or treated with 100 ng/mL AHT to deplete c-Myc 8 hr before infection. After 24 hr of infection, AHT was removed to release c-Myc expression, and the restoration of inclusion formation was tested. Cells were either fixed with 4% PFA after 36 hpi and immunostained for Ctr (cHSP60: green) and DNA (DAPI: blue) or lysed and analysed by (B) Western blot in order to analyse the rescue. Additionally, infected cells were lysed to infect freshly plated HeLa 229 shc-Myc cells at 24 hpi and analysed via Western blot to investigate the formation of infectious progenies. The panel shows the image of one representative blot (n=3). cHSP60 indicates Chlamydia infection and β-Actin staining serves as the loading control (n=3). (C) Inclusions and cells were counted and the results are shown as bar diagram. One-way ANOVA was used for analysis. *** indicates p-value <0.001, **** indicates a p-value <0.0001. (D) HeLa 229 cells were either left untreated or were pre-treated for 2 hr with 10 ng/mL IFN-γ or 1 unit of penicillin, infected with Ctr at MOI 1 for different time intervals and lysed for Western blot analysis. Bacterial load (cHSP60) and c-Myc levels were determined, and β-Actin served as loading control (n=3). (E) HeLa 229 cells were either left untreated or were pre-treated for 2 hr with 10 ng/mL of IFN-γ and infected with Chlamydia (Ctr) at MOI 1 and lysed at 30 hr to perform Western blot analysis. Phosphorylated form of c-Myc at serine 62 (pc-Myc [Ser62]) and threonine 58 (pc-Myc [Thr58]), c-Myc, and Chlamydia (cHSP60) were detected and quantified (Fc) (n=3). (F) HeLa 229 cells were either left untreated or treated with 10 ng/mL of IFN-γ and infected with Ctr. The cells were lysed and relative mRNA levels of c-Myc were determined by qPCR. GAPDH was used for normalization (n=3). One-way ANOVA was used for analysis. *** indicates p-value <0.001, **** indicates a p-value <0.0001. (G) Cartoon depicting IFN-γ signalling. IFN-γ binds to the IFN-γ receptor which results in the phosphorylation of STAT1. pSTAT1 binds to the IFN-γ-activated sequence (GAS) sequence and thus blocks c-Myc transcription. IFN-γ can also induce indoleamine-2,3-dioxygenase (IDO) and thereby the degradation of L-tryptophan. (H) HeLa 229 cells were either left untreated or were pre-treated for 2 hr with 10 ng/mL of IFN-γ and infected with Chlamydia (Ctr) at MOI 1 and lysed at 30 hpi to study STAT1 signalling after Ctr infection (n=3). (I) HeLa 229 cells were transfected with siRNA against STAT1 (+) or control (-) for 48 hr and then infected with Ctr for 24 hr. The cells were lysed and analysed by Western blot to investigate the STAT1 signalling and infectivity of Ctr (n=3). (J) HeLa 229 cells were either left untreated or were pre-treated for 2 hr with 10 ng/mL of IFN-α and infected with Ctr at MOI 1 and lysed at 36 hpi and analysed via Western blot. For all Western blots shown in A-J, Chlamydia load (cHSP60) and the respective host cell protein levels were quantified by normalization to β-Actin and indicated as fold change (Fc). Image of Western blots was taken from one of a total of at least three blots of biological replicates.

Figure 1—source data 1. Complete and cutted membranes of all Western blots from Figure 1.

Figure 1.

Figure 1—figure supplement 1. Interferon-gamma (IFN-γ) induces c-Myc depletion and impairs chlamydial growth.

Figure 1—figure supplement 1.

(A) HeLa 229 NTC SCC5 cells with an anhydrotetracycline (AHT)-inducible expression of a control short hairpin RNA (shRNA) were infected with Chlamydia trachomatis (Ctr) at a multiplicity of infection (MOI) of 1. The infected cells were either left untreated or treated with 100 ng/mL AHT 8 hr before infection to show that AHT has no effect on Ctr. After 24 hr of infection, AHT was removed to have the same conditions as in the shc-Myc cell line (Figure 1A). Cells were fixed with 4% PFA after 36 hpi and immunostained for Ctr (cHSP60: green) and DNA (DAPI: blue). The panel shows representative images (n=3). (B) Additionally, infected cells were lysed to infect freshly plated HeLa 229 NTC SCC5 cells to investigate the formation of infectious progenies. Inclusions and cells were counted, and the results are shown as bar diagram. One-way ANOVA was used for analysis (ns, not significant). (C) An infectivity assay was performed in HeLa 229 cells to test for infectious progenies after addition of IFN-γ (10 ng/mL) or penicillin (1 unit). Lysates were subjected to Western blot analysis and bacterial load (cHSP60) was quantified by normalizing to β-Actin levels. (D) The number of inclusions and the number of the cells were counted to plot the graph. One-way ANOVA was used for analysis. **** indicates a p-value <0.0001. (E/F) HeLa 229 cells (E) or human Fimb cells (F) were treated with different doses of IFN-γ (10–50 ng/mL) and either left uninfected or infected with Ctr for 30/24 hr. The cells were lysed and analysed via Western blotting (n=3). (G) HeLa 229 cells were treated with 10 or 50 ng/mL of IFN-γ and infected with Ctr D serovar. After 48 hr the cells were lysed with glass beads and the supernatant was used to infect freshly plated HeLa 229 cells. After 30 hr the cells were lysed and analysed via Western blotting. Bacterial load was determined by quantifying cHSP60 levels and β-Actin serves as loading control. (H) The number of inclusions and the number of the cells were counted to plot the graph. One-way ANOVA was used for analysis. *** indicates a p-value <0.001. (I) Infectivity assay of the experiment shown in Figure 1H. The cells were lysed at 48 hpi and dilutions of the resulting Chlamydia-containing supernatants were added onto fresh HeLa 229 cells, which were then lysed at 30 hpi for Western blot analysis (n=3). (J) The number of inclusions and the number of the cells were counted to plot the graph. Paired t-test was used for analysis. * indicates a p-value <0.05. (K) HeLa 229 cells were either left untreated or treated with 10 ng/mL of IFN-γ and infected with Ctr for 30 hr. 12 hpi media was changed for reactivation. The cells were lysed and relative mRNA levels of TrpB were determined by qPCR. 16SrRNA was used for normalization (n=3). (L) HeLa 229 cells with an AHT-inducible expression of shc-Myc were either left untreated or induced with 100 ng/mL AHT and infected with Ctr MOI 1 for 30 hr. 12 hpi media was changed for reactivation. The cells were lysed and relative mRNA levels of TrpB were determined by qPCR. 16SrRNA was used for normalization (n=3). Western blots shown in A-L were quantified by normalizing the Chlamydia load (cHSP60) and the respective host cell protein levels to β-Actin and the result was indicated as fold change (Fc). Image of Western blots was taken from one of a total of at least three blots of biological replicates (n=3).
Figure 1—figure supplement 1—source data 1. Complete and cutted membranes of all Western blots from Figure 1—figure supplement 1.

A physiological mechanism to induce chlamydial persistence is the exposure of infected cells to IFN-γ which causes the depletion of Trp via the induction of IDO (Taylor and Feng, 1991). We therefore investigated the connection of persistence induced by IFN-γ and c-Myc depletion. Interestingly, IFN-γ-treated cells failed to stabilize c-Myc upon Chlamydia infection (Figure 1D). In contrast, induction of persistence by antibiotic treatment, which targets the bacterial rather than host cell metabolism, did not alter c-Myc levels (Figure 1D). Nevertheless, both modes of persistence induction caused a failure of the bacteria to produce infectious progenies (Figure 1—figure supplement 1C, D). To test whether silencing of c-Myc also induces depletion of Trp in Ctr, we monitored the transcription of the chlamydial Trp synthase gene trpB which is strongly induced upon endogenous Trp depletion by IFN-γ treatment (Figure 1—figure supplement 1K). However, silencing of c-Myc did not cause significant changes in trpB transcription (Figure 1—figure supplement 1L), indicating that c-Myc depletion does not affect endogenous Trp levels in Ctr.

c-Myc protein stability is regulated by two phosphorylation sites with opposing functions. Serine 62 phosphorylation (pS62) stabilizes c-Myc whereas threonine 58 phosphorylation (pT58) promotes c-Myc degradation (Vervoorts et al., 2006). IFN-γ treatment led to decreased phosphorylation of c-Myc at serine 62, a modification that prevents the ubiquitination and proteasomal degradation of the protein (Welcker et al., 2004) while phosphorylation at threonine 58 was unchanged (Figure 1E). These results were obtained, if protein bands of the Western blot were normalized to actin as loading control. However, since c-Myc levels varied significantly upon IFN-γ exposure, normalization to c-Myc protein levels revealed strongly increased phosphorylation at Thr58 (4- and 7-fold, IFN- γ and IFN-γ/infected, respectively) and a mild increase at Ser62 (1.3- and 2-fold, IFN-γ and IFN-γ/infected, respectively). These data are consistent with a role for Thr58 phosphorylation in IFN-γ-mediated downregulation of c-Myc. c-Myc was also depleted upon IFN-γ treatment of primary cells from human fimbriae (Fimb), although the concentration of IFN-γ required to achieve the same effect was five times higher than in HeLa 229 cells (10 ng/mL in HeLa 229 compared to 50 ng/mL in Fimb) (Figure 1—figure supplement 1E, F). Similar results were obtained with a serovar D strain involved in STD (Figure 1—figure supplement 1G, H).

IFN-γ is known to signal via the JAK-STAT pathway via phosphorylation of STAT1 and subsequent transcriptional regulation of gene expression (Figure 1G). Treatment with IFN-γ led to the phosphorylation of STAT1 at serine 727 and tyrosine 701 (Figure 1H) and prevented the induction of c-Myc protein (Figure 1H) and mRNA expression (Figure 1F) upon Chlamydia infection. To verify that interferon transcriptionally depletes c-Myc via STAT1 signalling, we used siRNA against STAT1 (Figure 1I). STAT1 depletion rescued c-Myc levels and chlamydial growth in primary infections (Figure 1I). When bacteria from IFN-γ-treated and STAT1-depleted cells were transferred to fresh cells, infectious progeny could be recovered, indicating that STAT1 downregulates c-Myc and prevents chlamydial development (Figure 1—figure supplement 1I, J). Since IFN-α also signals through STAT1, we tested whether IFN-α also downregulates c-Myc and chlamydial growth. Although c-Myc levels and the bacterial load were slightly reduced upon IFN-α treatment, it failed to induce strong c-Myc depletion and chlamydial persistence suggesting that type I and II IFNs have different effects on c-Myc levels and chlamydial replication (Figure 1J).

The IFN-γ response in humans and mice is entirely different, limiting the use of murine systems as models for human pathogenic Ctr infections (Nelson et al., 2005). We therefore established an IFN-γ-induced persistence model in human fallopian tube organoids. Healthy tissue obtained from patients that underwent hysterectomy was used to establish organoid cultures. These organoids obtained from five different patients were pre-treated with IFN-γ for 2 hr and then infected with Chlamydia for 6 days (Figure 2A and B; Figure 2—figure supplement 1C). In this human infection model, IFN-γ treatment strongly reduced inclusion formation (primary infection: Figure 2B) and production of infectious progeny (Figure 2C and F; Figure 2—figure supplement 1A, B). Moreover, the IFN-γ-STAT1 signalling axis was active in human organoids and efficiently prevented the induction of c-Myc upon infection (Figure 2E). When IFN-γ was removed by replacing the culture medium, a significant rescue of chlamydial inclusion formation was measured (Figure 2D), indicating that this system can be used as a model of persistent infection.

Figure 2. Interferon-gamma (IFN-γ) induces depletion of c-Myc and impairs chlamydial growth in human fallopian tube organoids.

(A) Layout of the infectivity assay performed in human fallopian tube organoids. Organoids (see Materials and methods) were infected with Chlamydia trachomatis (Ctr) and treated with or without IFN-γ for 6 days and lysed using glass beads. Dilutions of the supernatants were used to infect freshly plated HeLa 229 cells. (B) Human fallopian tube organoids were infected with Ctr and were either left untreated or treated with IFN-γ for 6 days. The organoids were fixed with 4% PFA and immunostained for DNA (DAPI: blue), Ctr (cHSP60: green), Cytokeratin (magenta), and F-actin (Phalloidin, cyan). The panel shows representative images from organoids derived from five patients. (C) The infected organoids from (B) were lysed using glass beads, and dilutions of the supernatant were used to infect freshly plated HeLa 229 cells. The number of inclusions as shown in (F) were counted from five different patients and mean ± SD was depicted in the graph (n=5). * indicates p-value <0.05. (D) Human fallopian tube organoids were infected with Ctr and treated with or without IFN-γ for 6 days or IFN-γ was removed after 2 days for a 4-day recovery. Infected organoids were lysed using glass beads, and dilutions of the supernatants were used to infect freshly plated HeLa 229 cells. The number of inclusions and the number of the cells were counted to plot the graph. Paired t-test was used for analysis. * indicates a p-value <0.05. (E) Human fallopian tube organoids were infected with Ctr and treated with IFN-γ or left untreated for 6 days. The organoids were lysed in ×2 Laemmli buffer and analysed by Western blotting. Chlamydia load (cHSP60) and STAT1 protein levels were quantified by normalization to β-Actin and indicated as fold change (Fc). Shown are representative Western blots of at least three independent experiments (n=3).

Figure 2—source data 1. Complete and cutted membranes of all Western blots from Figure 2.

Figure 2.

Figure 2—figure supplement 1. Interferon-gamma (IFN-γ)-induced persistence of Chlamydia trachomatis (Ctr) in human organoids.

Figure 2—figure supplement 1.

(A) Human fallopian tube organoids were infected with Ctr and treated with or without IFN-γ for 6 days. The infected organoids were lysed using glass beads, and dilutions of the supernatant were used to infect freshly plated HeLa 229 cells for an infectivity assay. Cells were fixed with 4% PFA after 30 hpi and immunostained for Ctr (cHSP60: green) and actin (Phalloidin: red). The data from five different patients are presented here. (B) The number of inclusions and the number of the cells were counted to plot the graph. Paired t-test was used for analysis. * indicates a p-value <0.05. (C) Infected and treated with or without IFN-γ human fallopian tube organoids were pelleted after 6 days and analysed by electron microscopy. Elementary bodies (EB), reticulate bodies (RB), and aberrant bodies (AB) are indicated. Arrowheads point to inclusions and to one AB in the IFN-γ-treated sample. Scale bar 2 µm.

Expression of c-Myc rescues Chlamydia from IFN-γ-induced persistence

As we observed a key role of c-Myc in chlamydial persistence, we next asked if maintaining c-Myc levels can overcome IFN-γ-induced persistence. To address this question, we used a WII-U2OS cell line, in which c-Myc expression is under the control of an AHT-inducible promoter. These cells were used as infection models for IFN-γ-induced persistence under constant c-Myc expression. Bacterial replication efficiency and the ability to produce infectious progenies were studied. Interestingly, ectopic expression of c-Myc suppressed growth inhibition induced by IFN-γ (Figure 3A) and supported the development of infectious progeny (Figure 3B and C; Figure 3—figure supplement 1A). Even after extended exposure of infected cells for 24 hr to IFN-γ, expression of c-Myc rescued progeny formation (Figure 3—figure supplement 1B). We also tested the effect of c-Myc on persistence in organoids derived from human fallopian tubes. Organoids were transduced with lentivirus expressing c-Myc or GFP as control (Figure 3—figure supplement 1C-E) and selected for puromycin resistance (Figure 3—figure supplement 1F). IFN-γ-induced c-Myc downregulation varies in different cell lines and in organoids downregulation is only visible in infected organoids due to weak c-Myc expression in uninfected human organoids (Figure 2E). Therefore, lentivirus-induced overexpression is also weaker in human organoids as compared to HeLa 229 cells as shown in Figure 3—figure supplement 1C and D. These organoids were then infected with Chlamydia and treated with IFN-γ. Induced expression of c-Myc rescued the strong suppression of infectious progeny development by IFN-γ also in fallopian tube organoids (Figure 3D and E), demonstrating that downregulation of c-Myc is essential for IFN-γ-mediated persistence in this human infection model.

Figure 3. Expression of c-Myc rescues Chlamydia from persistence.

(A) WII-U2OS cells were induced with 100 ng/mL anhydrotetracycline (AHT) for 2 hr. Cells were left untreated or were pre-treated for 2 hr with 10 ng/mL interferon-gamma (IFN-γ), infected with Chlamydia (Ctr) at multiplicity of infection (MOI) 1 and lysed at 30 hpi for Western blot analysis (n=3). (B) The infected cells from (A) were lysed to infect freshly plated HeLa 229 cells. The numbers of inclusions were counted from the different conditions shown in (A). The mean ± SD are shown in the graph. **** indicates a p<0.0001. (C) For the same culture conditions as in (A), an infectivity assay was performed. The HeLa 229 cells were fixed with 4% PFA after 30 hpi and immunostained for Ctr (cHSP60: green) and actin (Phalloidin: blue) in order to analyse the rescue. (D) From the experiment shown in (E) the infected/ IFN-γ-treated organoids were lysed with glass beads and different dilutions of the supernatant was used to infect freshly plated HeLa 229 cells. The number of inclusions were counted from three different experiments and mean ± SD are shown in the graph. **** indicates a p-value <0.0001. (E) The organoids from Figure 3—figure supplement 1 were infected with Ctr for 6 days with and without IFN-γ, were lysed using glass beads, and dilutions of the supernatant were used to infect freshly plated HeLa 229 cells for an infectivity assay. Cells were fixed with 4% PFA after 30 hpi and immunostained for Ctr (cHSP60: green) and actin (Phalloidin: red) in order to analyse the rescue (n=3).

Figure 3—source data 1. Complete and cutted membranes of all Western blots from Figure 3.

Figure 3.

Figure 3—figure supplement 1. Expression of c-Myc rescues Chlamydia from persistence.

Figure 3—figure supplement 1.

(A) For the same culture conditions as in Figure 3A, an infectivity assay was performed. The cells were lysed at 48 hpi and dilutions of the resulting Chlamydia-containing supernatant were added onto fresh HeLa 229 cells, which were then lysed at 30 hpi to examine infectious progenies. The cHSP60 detect Chlamydia infection and the β-Actin serves as loading control (n=3). (B) WII-U2OS cells were left untreated or were pre-treated for 2 hr with 10 ng/mL IFN-γ, infected with Chlamydia (Ctr) at multiplicity of infection (MOI) 1 and after 24 hr of IFN-γ treatment induced with 100 ng/mL anhydrotetracycline (AHT). The cells were lysed at 48 hpi and dilutions of the resulting Chlamydia-containing supernatant were added onto fresh WII-U2OS cells to examine infectious progenies. Number of inclusions were counted of three different experiments to plot the graph. (C) Human fallopian tube organoids were transduced with either lentivirus expressing c-Myc or GFP as control (see Materials and methods). The puromycin selected organoids were lysed and analysed via Western blotting. β-Actin serves as loading control. (D/E) HeLa 229 cells were transduced with lentivirus expressing c-Myc (D) or GFP (E). The cells were analysed by Western blotting. β-Actin serves as the loading control. (F) The virus preparations from (D) and (E) were used to infect human organoids derived from fallopian tube. The organoids were selected for puromycin. The images show organoids under selection 2, 4, and 6 days, respectively.
Figure 3—figure supplement 1—source data 1. Complete and cutted membranes of all Western blots from Figure 3—figure supplement 1.

Both c-Myc and Trp are required to rescue Chlamydia from IFN-γ-induced persistence

It has been shown previously that IFN-γ-mediated persistence can be overcome by the addition of exogenous Trp (Beatty et al., 1994). To investigate the importance of Trp in the context of IFN-γ-mediated regulation of c-Myc expression in our model system, HeLa 229 and human Fimb cells were treated with IFN-γ, infected with Chlamydia and provided with exogenous Trp. Subsequently, bacterial replication efficiency as well as production of infectious progeny was analysed by Western blotting. As expected, addition of Trp rescued chlamydial growth after IFN-γ treatment (Figure 4—figure supplement 1A) and gave rise to infectious progeny (Figure 4A; Figure 4—figure supplement 1B, C). Surprisingly, addition of Trp also resulted in the stabilization of c-Myc, even without chlamydial infection (Figure 4—figure supplement 1D).

Figure 4. L-tryptophan activates the pGSK3β-c-Myc axis and rescues chlamydial infection.

(A) HeLa 229 cells were treated with interferon-gamma (IFN-γ) and different doses of L-tryptophan (W) (10–100 ng/mL). After 30 hr the cells were lysed and used for Western blot analysis (n=3). (B) HeLa 229 cells were infected with Ctr at multiplicity of infection (MOI) 1 for 30 hr and treated with IFN-γ and/or indole. The cells were lysed and analysed by Western blotting for c-Myc, pGSK3β, and cHSP60 levels (n=3). (C) HeLa 229 cells with an anhydrotetracycline (AHT)-inducible expression of shc-Myc were either left uninfected or infected with Chlamydia at MOI 1 for 30 hr. Additionally, cells were treated with L-tryptophan and/or 100 ng/mL AHT to deplete c-Myc. The cells were further analysed via Western blotting (n=3). (D) Cartoon left side: active phosphatidylinositol-3-kinase (PI3K) with inactive glycogen synthase kinase-3 (GSK3β) leading to c-Myc stabilization. Right side: IFN-γ binding to its receptor, activates PI3K and serine-threonine protein kinase (AKT) and induces the dephosphorylation and activation of GSK3β, leading to c-Myc depletion. Chlamydia infection activates the PI3K and MEK/ERK pathway. (E) HeLa 229 cells were either left uninfected or infected with Ctr and treated with IFN-γ with or without L-tryptophan (W). The cells were analysed by Western blotting 30 hpi. cHSP60 shows the intensity of chlamydial infection and β-Actin serves as loading control (n=3). Western blots shown in A-E were quantified by normalizing the Chlamydia load (cHSP60 or OmpA) and the respective host cell protein levels to β-Actin and the result was indicated as fold change (Fc). Image of Western blots was taken from one of a total of at least three blots of biological replicates (n=3).

Figure 4—source data 1. Complete and cutted membranes of all Western blots from Figure 4.

Figure 4.

Figure 4—figure supplement 1. L-tryptophan activates the pGSK3β-c-Myc axis and rescues chlamydial infection.

Figure 4—figure supplement 1.

(A) HeLa 229 cells were either left uninfected or infected with Chlamydia (Ctr) and treated with interferon-gamma (IFN-γ) with or without L-tryptophan (W). After 30 hpi, the cells were analysed via Western blotting (n=3). (B) HeLa 229 cells were infected with Ctr at multiplicity of infection (MOI) 1 for 24 hr and or treated with IFN-γ and L-tryptophan (W). The cells were lysed, and the supernatant was used to infect freshly plated HeLa 229 cells and bacterial load was determined by Western blotting for cHSP60. (C) Light microscopy pictures of (B). (D) HeLa 229 cells were either left untreated or were treated with different amounts of L-tryptophan (W). After 24 hr the cells were lysed and analysed by Western blotting. (E) The cells from Figure 4B were lysed and the supernatant was used to infect freshly plated HeLa 229 cells to assess the infectivity of the progeny. (F) Light microscopy pictures of (E). (G) HeLa 229 cells with anhydrotetracycline (AHT)-inducible expression of shc-Myc cells were treated with 100 ng/mL AHT for 2 hr. Cells were left untreated or were pre-treated for 2 hr with 100 ng/mL L-tryptophan (W), infected with Ctr at MOI 1. The cells were lysed, the supernatant was used to infect fresh cells, and lysed 30 hpi to study infectivity. (H) WII-U2OS cells with inducible expression of c-Myc were left untreated or treated with 100 ng/mL AHT and 10 ng/mL IFN-γ for 2 hr. Cells were grown without L-tryptophan and infected with Ctr at MOI 1 and lysed at 30 hpi for Western blot analysis. (I) Cells from the experiment shown in (H) were used for infectivity assay. (J) Cells from human fimbriae (human Fimb) were either left uninfected or infected with Ctr and treated with IFN-γ with or without L-tryptophan (W). The cells were analysed by Western blotting 24 hpi. cHSP60 shows the intensity of chlamydial infection and β-Actin serves as loading control (n=3). Western blots shown in A-J were quantified by normalizing the Chlamydia load (cHSP60) and the respective host cell protein levels to β-Actin and the result was indicated as fold change (Fc). Image of Western blots was taken from one of a total of at least three blots of biological replicates (n=3).
Figure 4—figure supplement 1—source data 1. Complete and cutted membranes of all Western blots from Figure 4—figure supplement 1.

All Ctr strains are Trp auxotroph but the genital strains retain a Trp synthase (trpB), which uses exogenous indole provided by the microflora in the genital tract as a substrate to synthesize Trp (Byrne et al., 1986; Kari et al., 2011; Østergaard et al., 2016). Thus, we validated if exogenous indole recovers chlamydial growth and leads to infectious progenies. Intriguingly, indole addition resulted not only in suppression of persistence (Figure 4B) and formation of infectious progeny (Figure 4—figure supplement 1E, F), but also in the stabilization of c-Myc in both infected and non-infected cells (Figure 4B).

Next, we tested whether Trp alone is sufficient to support Chlamydia development also in the absence of c-Myc. To address this question, we depleted c-Myc by AHT-inducible shRNA-mediated gene silencing and supplemented the medium with Trp as done in previous experiments. These cells were used for infection studies with Chlamydia and the formation of progeny was analysed via Western blot (Figure 4C, Figure 4—figure supplement 1G). Interestingly, the pathogen failed to develop in cells with reduced levels of c-Myc even in presence of excessive exogenous Trp (Figure 4C). Furthermore, Chlamydia was also unable to establish a secondary infection under low c-Myc expression conditions, irrespective of Trp availability (Figure 4—figure supplement 1G). Since excess Trp cannot overcome the suppression of c-Myc, we tested if the constant expression of c-Myc in a Trp-free environment would be able to rescue chlamydial growth. Therefore, WII-U2OS cells were cultivated in Trp-free medium, induced with AHT, treated with IFN-γ, and infected with Chlamydia. Bacterial replication efficiency and the ability to produce infectious progeny was examined by Western blotting. Neither chlamydial development nor a secondary infection could be observed (Figure 4—figure supplement 1H, I). In addition, c-Myc was not stabilized upon chlamydial infection in the absence of Trp (Figure 4—figure supplement 1H), suggesting that viable bacteria and Trp are required for the stabilization of c-Myc. These data support the role of c-Myc in Trp- or indole-mediated rescue from IFN-γ-induced chlamydial persistence.

Trp addition leads to activation of pGSK3β/c-Myc axis and restores chlamydial infection

Since we observed that Trp and c-Myc are both required for the development of Chlamydia, we next investigated the mechanism by which this amino acid regulates c-Myc levels. IFN-γ, upon binding to its receptor, activates phosphatidylinositol-3-kinase (PI3K) and serine-threonine protein kinase (AKT) and induces the dephosphorylation and activation of glycogen synthase kinase-3 (GSK3β) (Nguyen et al., 2001). If c-Myc is stabilized by the phosphorylation at serine 62 by the MAPK pathway, dephosphorylated active GSK3β phosphorylates c-Myc at threonine 58, followed by its ubiquitination and proteasomal degradation (Albert et al., 1994; Figure 4D). Both the MAPK and PI3K pathways activated during infection are critical for chlamydial development (Capmany et al., 2019; Patel et al., 2014; Siegl et al., 2014; Subbarayal et al., 2015). Therefore, the phosphorylation status of AKT and GSK3β was examined in HeLa 229 and human Fimb cells, which were treated with IFN-γ and/or Trp and infected with Chlamydia. IFN-γ activated the PI3 kinase pathway as evident from the phosphorylation of AKT (Figure 4E; Figure 4—figure supplement 1J). Despite this increase in AKT phosphorylation, IFN-γ treatment caused a reduction of GSK3β phosphorylation and c-Myc levels (Figure 4E; Figure 4—figure supplement 1J). Surprisingly, the addition of Trp to HeLa 229 or human Fimb cells increased phosphorylation of GSK3β, presumably resulting in its inactivation, and the elevation of c-Myc levels (Figure 4E; Figure 4—figure supplement 1J). Taken together, these data suggest that Trp rescues chlamydial infection via the activation of the pGSK3β/c-Myc axis.

IFN-γ-induced downregulation of c-Myc has a pleiotropic effect on host metabolism

Since c-Myc is centrally involved in regulating amino acid transport (Dong et al., 2020), we asked if stabilized c-Myc also increases Trp uptake. In our previous RNA-seq analysis we observed the upregulation of the L-amino acid transporter Solute Carrier Family 7 Member 5 (LAT1/SLC7A5) in cells infected with Chlamydia (Rajeeve et al., 2020). LAT1 is a system L-amino acid transporter with high affinity for branched chain and bulky amino acids, including Trp (Bhutia et al., 2015). Furthermore, the LAT1 promoter has a binding site for c-Myc and it has been shown that overexpression of c-Myc leads to an increased expression of LAT1 (Bhutia et al., 2015). Therefore, the protein levels of LAT1 during a chlamydial infection and upon IFN-γ treatment were investigated by Western blotting. Accumulation of LAT1 protein was detected in a time-dependent manner in infected HeLa 229 cells (Figure 5A). In contrast, LAT1 protein levels were strongly reduced in IFN-γ-treated cells, irrespective of infection (Figure 5B). Following c-Myc expression, LAT1 levels in infected cells were rescued even in the presence of IFN-γ (Figure 5C). Differences in reduction of LAT1 levels between HeLa 229 and U2OS cells might be due to a better survival of c-Myc overexpression that can be pro-apoptotic in U2OS cells. Interestingly, the Trp-degrading enzyme IDO, which was strongly induced by IFN-γ treatment as expected, was only partially suppressed by c-Myc expression (Figure 5C). We then tested whether inhibition of IDO1 with the competitive inhibitor Epacadostat affects the levels of c-Myc. Whereas inhibiting IDO1 partially rescued Ctr from IFN-γ-induced persistence (Figure 5D, E and F), it had no effect on the levels of c-Myc (Figure 5D), indicating that rescue from IFN-γ-induced persistence by IDO1 inhibition does not depend on c-Myc levels.

Figure 5. Influence of stabilized c-Myc on L-tryptophan (Trp) uptake and metabolites.

(A) HeLa 229 cells were infected with Chlamydia (Ctr) for various time points. The cells were analysed via Western blotting for the levels of LAT1 (n=3). (B) HeLa 229 cells were either left untreated or were pre-treated for 2 hr with 10 ng/mL of IFN-γ, infected with Ctr at multiplicity of infection (MOI) 1 and lysed at 24 hpi to examine LAT1 regulation via Western blotting. (C) c-Myc overexpression in WII-U2OS cells was induced with 100 ng/mL anhydrotetracycline (AHT) for 2 hr. Cells were left untreated or were pre-treated for 2 hr with 10 ng/mL IFN-γ, infected with Chlamydia (Ctr) at MOI 1 and lysed at 24 hpi for Western blot analysis (n=3). (D) HeLa 229 cells were either left untreated or were pre-treated for 2 hr with 10 ng/mL of IFN-γ and/or 10 µM IDO inhibitor, infected with Ctr at MOI 1 and lysed at 36 hpi to examine c-Myc regulation via Western blotting. (E) After 48 hpi cells from (D) were lysed and used to infect freshly plated HeLa 229 cells to analyse progeny via Western blot. (F) The number of inclusions and the number of the cells of (E) were counted to plot the graph. One-way ANOVA was used for analysis. * indicates a p-value <0.05, *** indicates a p-value <0.001. (G) WII-U2OS cells were either left uninfected or infected with Ctr at MOI 1 for 30 hr. These cells were either left untreated or treated with just 10 ng/mL IFN-γ and/or 100 ng/mL AHT to induce expression of c-Myc. The cells were extracted, and metabolites were analysed by LC-MS. Data are presented as mean ± SD of triplicate wells. ** indicates a p-value <0.01, *** indicates a p-value <0.001. The intracellular levels of tryptophan are shown. (H) WII-U2OS cells were either left uninfected or infected with Ctr at MOI 1 for 30 hr. The infected cells were either left untreated or treated with just 10 ng/mL IFN-γ and 100 ng/mL AHT to induce overexpression of c-Myc. The media, in which the cells were grown, was extracted and metabolites were analysed by LC-MS. Data are presented as mean ± SD of triplicate wells. ** indicates a p-value <0.01, *** indicates a p-value <0.001. The levels of tryptophan present in medium are shown. (I) WII-U2OS cells were either left uninfected or infected with Ctr at MOI 1 for 30 hr. The infected cells were either left untreated or treated with just 10 ng/mL IFN-γ and 100 ng/mL AHT to induce expression of c-Myc. The cells were extracted, and metabolites were analysed by LC-MS. Data are presented as mean ± SD of triplicate wells. **** indicates a p-value <0.0001. The intracellular levels of kynurenine are shown. Western blots shown in Figure 5 were quantified by normalizing the Chlamydia load (cHSP60) and the respective host cell protein levels to β-Actin and the result was indicated as fold change (Fc). Image of western blots was taken from one of a total of at least three blots of biological replicates (n=3).

Figure 5—source data 1. Complete and cutted membranes of all Western blots from Figure 5.

Figure 5.

Figure 5—figure supplement 1. Pathway analysis.

Figure 5—figure supplement 1.

(A.–D) WII-U2OS cells were either left uninfected or infected with Chlamydia trachomatis (Ctr) at multiplicity of infection (MOI) 1 for 30 hr. The infected cells were either left untreated or treated with just 10 ng/mL interferon-gamma (IFN-γ) and 100 ng/mL anhydrotetracycline (AHT) to induce expression of c-Myc. The cells were extracted, and metabolites were analysed by LC-MS. Quality controls and data normalization were performed and a principal component analysis (PCA) (A), and pathway analysis (control vs. infected (B), infected vs. infected IFN-γ treated (C), infected IFN-γ treated vs. infected IFN-γ treated and c-Myc expressed (D)) are shown here. FDR <0.05, Impact >0.4.

To investigate how c-Myc restoration affects Trp metabolism in IFN-γ-treated cells, we measured intracellular levels of Trp via LC-MS of WII-U2OS cells with an AHT-inducible c-Myc expression. This analysis showed that Chlamydia infection increases intracellular levels of Trp, while addition of IFN-γ results in decreased Trp levels (Figure 5G). Interestingly, c-Myc expression in non-infected cells increased intracellular Trp to the levels of infected cells (Figure 5G). However, in the presence of IFN-γ, expression of c-Myc only induced a small increase in intracellular Trp levels to about the same level observed in uninfected cells (Figure 5G), indicating that c-Myc expression does not prevent the effect of IFN-γ on Trp degradation. To investigate whether induction of LAT1 by c-Myc increases Trp uptake, we also measured Trp levels in the culture medium (Figure 5H). Unexpectedly, c-Myc expression had no major effect on Trp uptake in untreated and IFN-γ-treated cells (Figure 5H). To directly measure the impact of c-Myc expression on the IDO activity, we determined the levels of kynurenine as the first and rate-limiting steps in Trp breakdown. To our surprise, c-Myc expression strongly enhanced the production of kynurenine in all IFN-γ-treated samples whereas infection alone or in cells with constant c-Myc expression had no effect (Figure 5I), suggesting that the relatively low Trp levels in the IFN-γ-treated, c-Myc-expressing cells depend on an increased turn-over. In conclusion, restoring Trp metabolism is not the main mechanism of the c-Myc-dependent rescue of chlamydial persistence downstream of IFN-γ signalling.

We next performed an unbiased metabolomics analysis. WII-U2OS cells were infected with Chlamydia and either induced with AHT and/or treated with IFN-γ, and the resulting changes in metabolite levels were analysed by LC-MS. Quality controls and data normalization were performed and a principal component analysis (PCA) demonstrated the validity of the datasets (Figure 5—figure supplement 1A). Interestingly, hierarchical clustering analysis revealed the grouping of all conditions permissive for chlamydial development (Figure 6A), strongly suggesting that these metabolite profiles are indicative of productive chlamydial infection. Chlamydial development is favoured in an environment with high levels of amino acids (tyrosine, histidine, alanine, homoserine, methionine, lysine, phenylalanine, threonine, asparagine, glutamate) and TCA (citrate, aconitate, malate, α-ketoglutarate) and urea cycle intermediates (ornithine, citrulline) (Figure 6A).

Figure 6. Tricarboxylic acid (TCA) intermediates and nucleosides can overcome interferon-gamma (IFN-γ)-induced persistence.

(A) A heatmap with hierarchical clustering of all metabolites detected by LC-MS analysis of (Figure 5G). (B/C) WII-U2OS cells were either left uninfected or infected with Chlamydia trachomatis (Ctr) at multiplicity of infection (MOI) 1 for 30 hr. The infected cells were either left untreated or treated with just 10 ng/mL IFN-γ and 100 ng/mL anhydrotetracycline (AHT) to induce overexpression of c-Myc. The cells were extracted, and metabolites were analysed by LC-MS. Data are presented as mean ± SD of triplicate wells. Intracellular levels of metabolites like citrate, aconitate, α-ketoglutarate, glutamate (B), or nucleosides (adenosine, guanosine, cytidine, and uridine) (C) were determined and quantified. Statistical analysis was performed using MetaboAnalyst 4.0. Significantly changed metabolite levels were determined by ANOVA with subsequent FDR correction, where a p value of 0.05 was considered statistically significant (*) and Tukey HSD was applied as post hoc test. (D) Cells were left untreated or were pre-treated for 2 hr with 10 ng/mL IFN-γ, 4 mM α-ketoglutarate (DMKG), or 100 µM nucleosides, infected with Ctr at MOI 1 and lysed at 30 hpi for Western blot analysis (n=3). The α-ketoglutarate was supplied as cell-permeable dimethyl ester. (E) For the same culture conditions as in (D), an infectivity assay was performed. The cells were lysed at 48 hpi and dilutions of the resulting Chlamydia containing supernatant were added onto freshly plated WII-U2OS cells, which were then lysed at 30 hpi to examine infectious progeny via Western blotting (n=3). Inclusions and cells were counted, and the results are shown as bar diagram. One-way ANOVA was used for analysis. * indicates a p-value <0.05, *** indicates a p-value <0.001. (F) HeLa 229 cells were either infected with Chlamydia or infected and treated with IFN-γ and nucleosides (uridine/cytosine or adenosine/guanosine) were added. The cells were lysed at 48 hpi and dilutions of the resulting Chlamydia containing supernatant were added onto freshly plated HeLa 229 cells, which were then lysed at 30 hpi to examine infectious progenies via Western blot (n=3). Inclusions and cells were counted, and the results are shown as bar diagram. One-way ANOVA was used for analysis. * indicates a p-value <0.05, *** indicates a p-value <0.001, **** indicates a p-value <0.0001. (G) HeLa 229 cells were left untreated or were pre-treated for 2 hr with 10 ng/mL IFN-γ before 4 mM citrate and Ctr at an MOI 1 were added. The cells were lysed at 48 hpi and dilutions of the resulting Ctr containing supernatant were added onto freshly plated HeLa 229 cells, which were then lysed at 24 hpi to examine infectious progenies via Western blot (n=3). Inclusions and cells were counted, and the results are shown as bar diagram. One-way ANOVA was used for analysis. *** indicates a p-value <0.001. (H) Human Fimb cells were left untreated or were pre-treated for 2 hr with 10 ng/mL IFN-γ, 4 mM α-ketoglutarate (DMKG), infected with Ctr at MOI 1. The cells were lysed at 48 hpi and dilutions of the resulting Chlamydia containing supernatant were added onto freshly plated human Fimb cells, which were then lysed at 24 hpi to examine infectious progenies via Western blot (n=3). Inclusions and cells were counted, and the results are shown as bar diagram. One-way ANOVA was used for analysis. ** indicates a p-value <0.01, *** indicates a p-value <0.001. Western blots shown in Figure 6 were quantified by normalizing the Chlamydia load (cHSP60) and the respective host cell protein levels to β-Actin and the result was indicated as fold change (Fc). Image of Western blots was taken from one of a total of at least three blots of biological replicates (n=3).

Figure 6—source data 1. Complete and cutted membranes of all Western blots from Figure 6.

Figure 6.

Figure 6—figure supplement 1. Urea cycle intermediates.

Figure 6—figure supplement 1.

(A) Cartoon depicting tricarboxylic acid (TCA) cycle and nucleotide biosynthesis in human cells. (B) Cartoon depicting the flux of aspartate from the TCA cycle. Oxaloacetate from TCA is converted into aspartate by mitochondrial malate dehydrogenase. The glutamate-aspartate antiporter transports aspartate into the cytosol where it is shuttled into the urea cycle. (C–F) WII-U2OS cells were either left uninfected or infected with Chlamydia trachomatis (Ctr) at multiplicity of infection (MOI) 1 for 30 hr. The infected cells were either left untreated or treated with just 10 ng/mL interferon-gamma (IFN-γ) and 100 ng/mL anhydrotetracycline (AHT) to induce overexpression of c-Myc. The cells were extracted, and metabolites were analysed by LC-MS. Data are presented as mean ± SD of triplicate wells. Statistical analysis was performed using MetaboAnalyst 4.0. Significantly changed metabolite levels were determined by ANOVA with subsequent FDR correction, where a p value of 0.05 was considered statistically significant (*) and Tukey HSD was applied as post hoc test. The levels of aspartate, serine, and glycine (C), arginine, ornithine, citrulline (D), nucleotide triphosphate (ATP, GTP, CTP, and UTP) (E), and nucleotide monophosphate (AMP, GMP, CMP, and UMP) (F) are shown.

Pathway analysis revealed that nicotinate and nicotinamide metabolism are strongly regulated upon Chlamydia infection (Figure 5—figure supplement 1B). Moreover, phenylalanine, tyrosine, and tryptophan biosynthesis were among the significantly altered pathways with strongest impact upon infection, but also after IFN-γ treatment of infected and c-Myc overexpressing infected cells (Figure 5—figure supplement 1B-D). Other modulated metabolic pathways included amino acid pathways that have been shown before to be regulated upon Chlamydia infection cells (Mehlitz et al., 2017; Rajeeve et al., 2020). In addition, irrespective of IFN-γ treatment, arginine was one of the most depleted amino acids in infected cells (Figure 6—figure supplement 1D).

α-Ketoglutarate and nucleosides rescue Chlamydia from IFN-γ-induced persistence

We next focused our attention on those metabolites that were induced by infection but reduced following IFN-γ treatment and restored by c-Myc overexpression as candidates that could be causally involved in Chlamydia persistence. Chlamydia infection resulted in a significant increase in several TCA cycle (related) intermediates, including aconitate, citrate, α-ketoglutarate, and glutamate (Figure 6B; Figure 6—figure supplement 1A). Furthermore, the amino acids aspartate, serine, and glycine, which function as important precursors for TCA cycle anaplerosis and nucleotide biosynthesis (Figure 6—figure supplement 1C), were also significantly induced by Chlamydia infection, while glutamine showed a trend towards induction that failed to reach statistical significance. In contrast, levels of arginine were strongly reduced upon infection, while intracellular levels of the urea cycle metabolites ornithine and citrulline were significantly increased (Figure 6—figure supplement 1B, D).

Remarkably, treatment of infected cells with IFN-γ lowered the induction of glutamate as well as aspartate, serine, and glycine. Moreover, levels of most TCA cycle metabolites, in particular aconitate, citrate, α-ketoglutarate, succinate, fumarate, and malate, were also reduced upon IFN-γ treatment, suggesting that reprogramming of host cell metabolism is a major part of the IFN-γ response (Figure 6A and B). Interestingly, re-expression of c-Myc restored levels of the TCA cycle metabolites citrate, aconitate and α-ketoglutarate, as well as the amino acids glutamine, glutamate, and glycine in IFN-γ-treated infected cells (Figure 6A and B; Figure 6—figure supplement 1C), suggesting that these metabolites are required for Chlamydia development.

We also investigated intracellular levels of purine and pyrimidine nucleotides and nucleosides as well as intermediates of nucleotide metabolism, as Chlamydia is an auxotroph for nucleotides. Interestingly, IFN-γ treatment significantly lowered the amounts of ATP and CTP as well as AMP, UMP, and cytidine (Figure 6—figure supplement 1E, F; Figure 6C). Moreover, several other metabolites involved in nucleotide metabolism showed a trend towards reduced abundance in IFN-γ-treated infected cells (Figure 6—figure supplement 1E, F; Figure 6C). This reduction in essential precursors for chlamydial DNA replication may explain why Chlamydia enter persistence in the presence of IFN-γ. In addition, overexpression of c-Myc enhanced levels of nucleoside triphosphates and strongly increased intracellular levels of adenosine, uridine, and cytidine in IFN-γ-treated cells (Figure 6—figure supplement 1E; Figure 6C). Another possibility is that IFN-γ-induced reduction of ATP levels generally slowed down metabolic processes and induced chlamydial persistence.

Based on the observation that IFN-γ leads to a reduction in TCA cycle intermediates and nucleotides in host cells, we investigated whether chlamydial growth after IFN-γ-induced persistence could be overcome by the supplementation of specific metabolic precursors. We therefore treated WII-U2OS and HeLa 229 cells with IFN-γ, followed by Chlamydia infection and addition of the cell-permeable dimethyl ester of α-ketoglutarate (DMKG) or a mixture of nucleosides (A, C, G, U). In both cell lines, the growth of Chlamydia was rescued by the addition of either DMKG or nucleosides and both conditions produced infectious progeny (Figure 6D–F). Moreover, restoration of chlamydial development could also be achieved by the sole addition of pyrimidine nucleosides (U+C), and to a minor extend also by purine nucleosides (A+G) (Western blot in Figure 6F). In contrast, purines seem to restore inclusion formation more efficiently than pyrimidines (bar diagram in Figure 6F). Furthermore, addition of citrate also showed the tendency to rescue chlamydial growth (Figure 6G). Even in primary human Fimb cells could the addition of DMKG restore the development of Chlamydia (Figure 6H). Taken together, these results indicate that IFN-γ broadly alters the metabolism of host cells to limit the availability of metabolic precursors for pyrimidine and purine biosynthesis to promote chlamydial persistence.

The chlamydial Trp synthase pathway is not involved in c-Myc- and DMKG-mediated rescue of IFN-γ persistence

Since Ctr have an intact Trp synthase operon the effects of c-Myc on the rescue of IFN-γ-induced persistence could be indirect, for example, by the provision of precursors of the Trp synthase. We therefore generated a trpBA mutant in Ctr by Fluorescence-reported Allelic Exchange Mutagenesis (FRAEM) (Keb and Fields, 2020). This mutant lacked expression of TrpA or TrpB (Figure 7A) and was resistant to rescue from IFN-γ-induced persistence by generating Trp from indole (Figure 7B), in line with the phenotype of Trp synthase negative Ctr (Caldwell et al., 2003). However, expression of c-Myc restored growth of the trpBA mutant in the presence of IFN-γ (Figure 7C). In addition, the trpBA mutant also could be reactivated by the addition of exogenous DMKG to a similar extend as the wildtype strain (Figure 7D). These data show that the chlamydial Trp synthase is dispensable for the restoration of growth by c-Myc expression and supplementation of TCA metabolites in the presence of IFN-γ.

Figure 7. The chlamydial Trp synthase operon is not involved in the rescue from persistence by c-Myc expression and tricarboxylic acid (TCA) metabolite supply.

Figure 7.

(A) Western blot of wildtype Chlamydia trachomatis (Ctr) and TrpBA mutant to demonstrate the loss of TrpA and TrpB. (B) HeLa 229 cells were infected with Ctr or TrpBA mutant at multiplicity of infection (MOI) 1 for 48 hr and treated with 10 ng/mL IFN-γ and/or 50 µM indole. The cells were lysed, and the supernatant was used to infect freshly plated HeLa 229 cells to assess the infectivity of the progeny. The number of inclusions and the number of the cells were counted to plot the graph. One-way ANOVA was used for analysis. ** indicates p-value <0.01. (C) WII-U2OS cells were induced with 100 ng/mL anhydrotetracycline (AHT) for 2 hr. Cells were left untreated or were pre-treated for 2 hr with 10 ng/mL IFN-γ, infected with Ctr or TrpBA mutant at MOI 1 and lysed at 44 hpi for infecting freshly plated WII-U2OS cells to check infectious progeny. The number of inclusions and the number of the cells were counted to plot the graph. One-way ANOVA was used for analysis. * indicates a p-value <0.05, ** indicates p-value <0.01, *** indicates a p-value <0.001. (D) HeLa 229 cells were infected with Ctr or TrpBA mutant at MOI 1 for 48 hr and treated with 10 ng/mL IFN-γ and/or 4 mM α-ketoglutarate (DMKG). The cells were lysed, and the supernatant was used to infect freshly plated HeLa 229 cells to assess the infectivity of the progeny. Inclusions and cells were counted, and the results are shown as bar diagram. One-way ANOVA was used for analysis. * indicates p-value <0.05, **** indicates a p-value <0.0001.

Figure 7—source data 1. Complete and cutted membranes of all Western blots from Figure 7.

Discussion

Persistent and recurrent infections are an important cause of excessive inflammation and tissue damage in the fallopian tube resulting in infertility and ectopic pregnancy (Darville et al., 2003; Nagarajan et al., 2012). Chlamydial infection of the epithelial cells lining the genital tract leads to the secretion of cytokines, like IL-8 (Buchholz and Stephens, 2008) and GM-CSF (Lehr et al., 2018), which attract myeloid and lymphoid cells towards the site of infection. This local immune response leads to chronic inflammation and may promote the development of malignancy including ovarian cancer (Shan and Liu, 2009). In addition, IFN-γ secreted by infiltrating T cells and NK cells provokes persistence of Chlamydia in epithelial cells. The current model of the immune defence elicited by IFN-γ in human cells centred around the induction of IDO and the consecutive degradation of Trp (Beatty et al., 1994; Wyrick, 2010). Chlamydia is auxotroph for Trp and enters persistence if this amino acid is degraded in the infected cell.

Our detailed molecular analysis of the IFN-γ-induced metabolic alterations in the host cells challenges this model and shifts the focus to the key transcription factor and proto-oncogene c-Myc as a central regulator of Chlamydia persistence. We provide evidence that IFN-γ acts via the GSK3β-STAT1 axis to deplete c-Myc levels and demonstrate that constitutive expression of c-Myc is sufficient to rescue Chlamydia from persistence induced by IFN-γ (Figure 1; Figure 2; Figure 3). Interestingly, this effect was also evident in human fallopian tube organoids, a newly developed physiologically relevant model for Chlamydia infection.

The pathway governing persistence uncovered in our study was indeed dependent on the levels of Trp (Figure 4; Figure 4—figure supplement 1), since Chlamydia failed to grow in the absence of this amino acid even in the presence of continuous c-Myc expression (Figure 4—figure supplement 1H, I). Conversely, the depletion of c-Myc and Trp addition was not sufficient to achieve normal chlamydial growth (Figure 4C; Figure 4—figure supplement 1G). Nevertheless, our results clearly show that both Trp and c-Myc are required for efficient bacterial replication (Figure 4; Figure 4—figure supplement 1). Chlamydia utilizes Trp to synthesize proteins, like the outer membrane protein MOMP, a Trp-rich polypeptide. Our findings that Trp but also indole, which Ctr can use as a substrate for Trp synthesis (Byrne et al., 1986; Kari et al., 2011; Østergaard et al., 2016), affects the level of c-Myc was unexpected (Figure 4A and B). It was shown previously that glutamine deprivation lowers levels of adenosine nucleotides and suppresses c-Myc in cancer cells by a mechanism dependent on the c-Myc 3’UTR (Dejure et al., 2017). We show here that Trp induces the phosphorylation and inactivation of GSK3β and thereby prevents the degradation of c-Myc by the ubiquitin proteasome system (Figure 4; Figure 4—figure supplement 1). Phosphorylation-dependent inactivation of GSK3β also occurs during normal chlamydial infection and causes the accumulation of c-Myc protein, as GSK3β leads to a destabilization of c-Myc by phosphorylation on the threonine 58 and proteasomal degradation (AlZeer et al., 2017; Albert et al., 1994). This finding suggests that Trp contributes to the rescue of Ctr from persistence by activating the pGSK3ß/c-Myc axis. Interestingly, c-Myc transcriptionally activates expression of the tryptophan transporter LAT-1, thereby increasing the uptake of Trp as part of a positive feedback regulation. Moreover, Trp depletion induced by IFN-γ signalling via STAT1 leads to loss of c-Myc expression, indicating that this amino acid functions as a central regulator of host cell metabolism and determines the decision between chlamydial development vs. the induction of persistence.

Detailed analysis of supernatants and extracts of infected cells also pointed to a broader impact of IFN-γ treatment on host cell metabolism. While Trp levels were significantly increased in infected cells and strongly reduced by IFN-γ treatment, constitutive expression of c-Myc failed to restore Trp levels in IFN-γ-treated cells despite preventing Chlamydia persistence (Figure 5G and H). Our data suggest that the highly efficient IDO prevents the restoration of Trp levels in the presence of IFN-γ even under constitutive c-Myc expression. Increased Trp levels induced by c-Myc expression are compensated by the enhanced degradation of Trp to kynurenine induced by IFN-γ (Figure 5G and I). All genital Ctr isolates possess Trp synthase activity which in the presence of indole mediates IFN-γ resistance (Caldwell et al., 2003). However, c-Myc expression also rescued a trpBA mutant from IFN-γ persistence (Figure 7) excluding a role of the Trp synthase and endogenous Trp synthesis in this pathway. This already indicated that additional metabolic pathways regulated by c-Myc expression may be responsible for preventing persistence induced by IFN-γ. Unbiased metabolomics analysis of IFN-γ-treated, infected and c-Myc-expressing cells, and subsequent hierarchical clustering analyses revealed a grouping of all cells permissive for chlamydial replication (Figure 6A; infected, c-Myc infected, c-Myc IFN-γ infected), suggesting that this is the metabolic profile required for chlamydial replication.

Since c-Myc acts as a major metabolic regulator (Dejure and Eilers, 2017; Stine et al., 2015), we systematically investigated the c-Myc-dependent alterations in metabolite levels in response to bacterial infection and IFN-γ treatment. This analysis revealed that several intermediates of the TCA cycle, including citrate, aconitate, and α-ketoglutarate, as well as glutamate, were increased upon chlamydial infection, but significantly depleted upon IFN-γ treatment and restored when c-Myc was re-expressed (Figure 6). In addition, several nucleotides, in particular ATP and CTP, were among the top metabolites upregulated upon chlamydial infection (Figure 6—figure supplement 1E). Moreover, glutamate and alanine, which are both upregulated by infection, repressed in response to IFN-γ treatment and restored by c-Myc expression (Figure 6A and B), are central metabolites for Chlamydia, since they serve as precursors for cell wall biosynthesis (Otten et al., 2018). Interestingly, we could observe a strong increase in the levels of citrate in c-Myc overexpressing cells (Figure 6B). Citrate is required for the synthesis of fatty acids, which are scavenged by the bacteria from the host cell, as Chlamydia lack citrate synthase, aconitase, and isocitrate dehydrogenase and thus have only an incomplete TCA cycle (Yao et al., 2014; Yao et al., 2015). The finding of others that reduced uptake of glucose may play a role in IFN-γ-induced chlamydial persistence supports our model, since glycolysis fuels the TCA and nucleotide biosynthesis (Shima et al., 2018).

Chlamydia-infected cells showed a drastic reduction in the levels of arginine (Figure 6—figure supplement 1D). However, arginine levels were not restored upon c-Myc re-expression in IFN-γ-treated infected cells. It is possible that arginine is shuttled into the urea cycle, as we observed significantly higher levels of ornithine and citrulline (Figure 6—figure supplement 1D), which can be used for polyamine biosynthesis, that stabilize DNA and are essential for cell proliferation (van Dam et al., 2002). Further work is required to elucidate the exact role of arginine metabolism in chlamydial infection.

Here, we show a central role of c-Myc in the control of the host cell metabolism during IFN-γ-mediated innate immune defence against Ctr infection. The effect of IFN-γ-mediated c-Myc downregulation included substantial remodelling of host cell metabolism, including reduced abundance of TCA cycle intermediates, which are usually replenished via c-Myc-dependent glutaminolysis and anaplerosis. Thus, the enhanced production of amino acids, nucleotides and lipids, and, additionally, TCA cycle intermediates transferred from the host cell to the bacteria (Mehlitz et al., 2017; Rajeeve et al., 2020) may all be affected by IFN-γ treatment (Kress et al., 2015). The central role of host TCA cycle and nucleotide biosynthesis for chlamydial development is also supported by our finding that supplementing cell-permeable α-ketoglutarate or nucleosides can overcome the IFN-γ-induced persistent state of Chlamydia (Figure 6; Figure 7D). It can therefore be concluded that c-Myc is required for Ctr to induce metabolic reprogramming of the host cell to avoid nutrient shortage during replication and prevent the induction of persistence.

There is no doubt that Trp plays a central role in the control of chlamydial replication induced by IFN-γ (Byrne et al., 1986; Taylor and Feng, 1991). In the human host, depletion of Trp is the major effector mechanism of IFN-γ and the presence of a Trp synthase operon in the genital chlamydial isolates supports a central role of Trp in chlamydial persistence (Fehlner-Gardiner et al., 2002). However, our finding that both the substrate and the product of the Trp synthase, indole and Trp, control the levels of c-Myc suggests that Trp plays a role in signalling in chlamydial persistence beyond its sole function as an amino acid. IFN-γ depletes the essential amino acid Trp and causes a reduction in the levels of c-Myc, which affects the metabolic state of the host cell in a way that prevents chlamydial replication and induces persistence. It is very likely that similar mechanisms are also involved in IFN-γ-induced persistence of other intracellular bacteria (Ganesan and Roy, 2019). In addition, IFN-γ also restricts the infection of viruses (Karupiah et al., 1993; Weizman et al., 2017). Since c-Myc activation and metabolic reprogramming of cells is a prerequisite for the replication of several viruses (Thai et al., 2014; Thai et al., 2015), our findings may be generally relevant for the IFN-γ-dependent innate immune defence against infection.

Materials and methods

Cell lines and bacteria

Human Fimb cells (epithelial cells isolated from the fimbriae of patients undergoing hysterectomy), HeLa 229 cells (ATCC CCL-2.1) and HeLa 229 pInducer11 shc-Myc cells were cultured in RPMI1640+GlutaMAX medium (Gibco) supplemented with 10% (v/v) heat-inactivated FBS (Sigma-Aldrich). WII-U2OS cells (Lorenzin et al., 2016) were maintained in high-glucose DMEM (Sigma-Aldrich) with 10% (v/v) heat-inactivated FBS. All cell lines were grown in a humidified atmosphere containing 5% (v/v) CO2 at 37°C. In this study Chlamydia trachomatis serovar L2/434/Bu (ATCC VR-902B), and C. trachomatis serovar D/UW-3/Cx (ATCC VR-885) were used and cultured and purified as published previously (Paland et al., 2008). In brief, Chlamydia were propagated in HeLa 229 cells at a multiplicity of infection (MOI) of 1 for 48 hr. Cells were mechanically detached and lysed using glass beads (3 mm, Roth). Low centrifugation supernatant (10 min at 2000× g at 4°C) was transferred to high-speed centrifugation (30 min at 30,000× g at 4°C) to pellet the bacteria. The pellet was washed and resuspended in ×1 SPG buffer (7.5% sucrose, 0.052% KH2PO4, 0.122% Na2HPO4, 0.072% L-glutamate). Aliquots were made, stored at –80°C, and the bacteria were titrated for MOI of 1 for use in further experiments. Infected cells were incubated in a humidified atmosphere with 5% (v/v) CO2 at 35°C. The cell lines as well as the Chlamydia used in this study were tested to be free of Mycoplasma via PCR.

Generation of Ctr trpBA mutant

The C. trachomatis serovar L2/434/Bu trpBA mutants were generated by Fluorescence-reported Allelic Exchange Mutagenesis (FRAEM) as previously described (Keb and Fields, 2020; Mueller et al., 2016). Briefly, the up- and downstream fragments of trpA were amplified with primers trpA_us_fwd/trpA_us_rev (trpA up fwd: GCAGGTACCGGTCGACGAGAGCGGTTGAGTGCTATTTC; trpA up rev: AGTAGGAATGGTCGAAAATTCCTCTGTTTCTGCGGATG) and trpA_ds_fwd/trpA_ds_rev (trpA down fwd: TACGAAGTTATGACCTTTATGAATATGAATATGAAGCCCA; trpA down rev: CGGGGTCTGACGCCCGCTCTTGTTGGTTTCGGCAT) from Ctr genomic DNA. The upstream fragment was cloned into the unique SalI site of the suicide vector pSUmC-4.0, whereas the downstream fragment was cloned into the unique Sbfl restriction site of pSUmC-4.0. Thus, trpA up- and downstream fragments flanked the aadA and gfp genes in pSUmC-4.0 encoding for spectinomycin resistance and green fluorescent protein, respectively. The resulting vector was then transformed into Ctr using CaCl2. McCoy cells were infected and transformants were selected by treatment with spectinomycin (Keb and Fields, 2020). Additionally, AHT selection was required for the expression of the plasmid replication factor pgp6. Bacteria were passaged every 48 hr onto fresh McCoy cells until GFP- and mCherry-positive clones appeared. These transformants also expressed mCherry encoded by the pSUmC-4.0 backbone. GFP- and mCherry-positive clones were selected and cultured in the absence of AHT. This resulted in plasmid loss and allowed selection for GFP-positive and mCherry-negative trpA mutants, where trpA was deleted through allelic exchange by the aadA-gfp cassette. The trpA mutant was FACS sorted for GFP. Deletion of trpA was verified by Western blot. Mutation of trpA also resulted in loss of trpB.

Infectivity assay

For primary infection, control or IFN-γ-treated cells were infected with C. trachomatis at MOI 1 for 30–48 hr. The cells were lysed with glass beads and freshly plated cells were infected with different dilutions (referred to as secondary infection). Lysates of the secondary infection were taken to determine the infectivity via Western blotting against chlamydial HSP60.

Induction and chemicals

To induce c-Myc overexpression in WII-U2OS cells or c-Myc knockdown in HeLa 229 pInducer11 shc-Myc cells, medium was changed to 10% (v/v) heat-inactivated FBS DMEM or RPMI accordingly and 100 ng/mL AHT (Acros) was added. After 2 hr of induction, cells were infected with C. trachomatis and incubated for further 24–36 hr. Likewise, IFN-γ (Gibco, Merck Millipore), interferon-alpha (Merck Millipore), Trp (Sigma-Aldrich), Indole (Sigma-Aldrich), citrate (Roth), and IDO inhibitor Epacadostat (Biozol) were added to cells as needed 2 hr before infection.

Induction of persistence

Cells and organoids were pre-treated with IFN-γ (Recombinant Human IFN-γ PHC4031 Gibco, IF002 Merck Millipore) for 2 hr at least prior infection (Nelson et al., 2005). Throughout the experiments, according amounts of IFN-γ were left in the medium. HeLa 229 cells were pre-treated for 2 hr with 1 unit of penicillin (Penicillin G sodium salt 13752-5G-F Sigma-Aldrich) before infection and left in the medium during the whole infection period.

Western blot and antibodies

For Western blot analysis, cells were directly lysed with ×2 Laemmli buffer (10% 1.5 M Tris-HCl pH 6.8, 4% SDS, 30% glycerol, and 1.5% β-mercaptoethanol) on ice. Protein samples were separated with a 10% SDS-PAGE (Peqlab) and transferred onto a PVDF membrane (Sigma-Aldrich) via a semi-dry blotter (Peqlab) (2 hr at 1 mA/cm2). The membrane was blocked in 5% (w/v) non-fat dried milk powder in ×1 Tris-buffered saline with 0.5% Tween20 (Sigma-Aldrich) for 1 hr and then incubated in the appropriate primary antibody overnight at 4°C. Antibodies against c-Myc, c-Myc phospho-T58, and c-Myc phospho-S62 were purchased from Abcam. Phospho-Akt (Ser473), Akt (pan), phospho-Erk, Erk, phospho-GSK-3β (Ser9), GSK-3β (3D10), phospho-Stat1 (Ser727), phospho-Stat1 (Tyr701), and Stat1 antibodies were obtained from Cell Signaling. β-Actin antibody was purchased from Sigma-Aldrich. Chlamydial HSP60 antibody was obtained from Santa Cruz. An IDO antibody was kindly provided by Ida Rosenkrands and OmpA was self-made. Proteins were detected with corresponding horseradish peroxidase-conjugated secondary antibody (Santa Cruz), using homemade ECL solutions and Intas Chemiluminescence Imager.

Immunofluorescence analysis

The cells were seeded on cover slips and infected with C. trachomatis serovar L2 at MOI 1 for indicated time points. Before fixation with 4% PFA/Sucrose (Roth), the cells were washed with DPBS (Gibco). Fixed cells were permeabilized with 0.2% Triton X-100 (Sigma-Aldrich) in ×1 DPBS for 30 min, blocked with 2% FBS in ×1 DPBS for 45 min and incubated with primary antibodies for 1 hr at room temperature. Primary antibodies, chlamydial HSP60 (Santa Cruz, 1:500) and Phalloidin (Thermo Fisher Scientific), were diluted in 2% FBS in ×1 DPBS. Samples were washed and incubated with fluorescence dye conjugated secondary antibodies (Dianova) for 1 hr in the dark at room temperature. Cover slips were mounted onto microscopy slides using mowiol, slides were air-dried for at least 24 hr and examined using a LEICA DM2500 fluorescence microscope. The images were analysed with LAS AF program (Leica) and ImageJ software.

Metabolic profiling

For this study, 106 WII-U2OS cells per well (six-well culture plate, Costar) were seeded in triplicates, either uninfected or infected with C. trachomatis serovar L2 for 30 hr. c-Myc overexpression was induced by AHT and cells were treated with IFN-γ as described above. After the respective time, medium was collected, snap-frozen in liquid nitrogen, and the cells were washed with ice-cold 154 mM ammonium acetate (Sigma) and snap-frozen in liquid nitrogen. The cells were harvested after adding 480 µL cold MeOH/H2O (80/20, v/v) (Merck) to each sample containing Lamivudine (Sigma) standard (10 µM). The cell suspension was collected by centrifugation and transferred to an activated (by elution of 1 mL CH3CN [Merck]) and equilibrated (by elution of 1 mL MeOH/H2O [80/20, v/v]) C18-E SPE-column (Phenomenex). The eluate was collected and evaporated in SpeedVac and was dissolved in 50 μL CH3CN/5 mM NH4OAc (25/75). Each sample was diluted 1:1 (cells) or 1:5 (medium) in CH3CN. Five µL of sample was applied to HILIC column (Acclaim Mixed-Mode HILIC- 1, 3 µm, 2.1 * 150 mm). Metabolites were separated at 30°C by LC using a DIONEX Ultimate 3000 UPLC system (Solvent A: 5 mM NH4OAc in CH3CN/H2O (5/95), Solvent B: 5 mM NH4OAc in CH3CN/H2O (95/5); Gradient: linear from 100% B to 50% B in 6 min, followed by 15 min const. 40% B, then returning to 100% B within 1 min) at a flow rate of 350 µL/min. After chromatographic separation, masses (m/z) were acquired using a Q-Exactive instrument (Thermo Fisher Scientific) in positive and negative ionization mode in the scan range between 69 and 1000 m/z with a resolution of 70,000. AGC target was set to 3×106 and maximum injection time was set to 200 ms. Sheath, auxiliary, and sweep gas were set to 30, 10, and 3, respectively, and spray voltage was fixed to 3.6 kV. S-lens RF level was set to 55.0, the capillary and the Aux gas heater were heated to 320°C and 120°C, respectively. Peak determination and semi-quantitation were performed using TraceFinder software. Obtained signal intensities were normalized to the internal standard (lamivudine) and a cell number, which was determined by crystal violet staining. In brief, for the crystal violet staining cells were fixed with 4% PFA/Sucrose (Roth), stained with 0.1% crystal violet (Merck) dissolved in 20% ethanol (Roth), washed with water, dried overnight, and the absorbance was measured at 550 nm. The pellet of the cell samples was dried, resuspended in 0.2 M sodium hydroxide (Roth), cooked for 20 min at 95°C, and absorbance was measured at 550 nm. Statistical analysis was performed using GraphPad Prism or MetaboAnalyst 4.0. Significantly changed metabolite levels were determined by ANOVA with subsequent FDR correction, where a p value of 0.05 was considered statistically significant (*) and Tukey HSD was applied as post hoc test. Hierarchical clustering, PCA, and pathway analyses were done and resulting plots were generated by MetaboAnalyst 4.0 (Chong et al., 2019).

Generation and culture of human fallopian tube organoids

Generation of human organoids was adapted from Kessler et al., 2019. Fallopian tube tissue was obtained from patients undergoing hysterectomy. The tissue was processed within 2 hr after the surgery. Briefly, tissue samples were washed with DPBS (Gibco), placed into a sterile Petri dish (Corning), cut into small pieces, and pressed against the dish with a glass slide (VWR). The cells were washed with DPBS, incubated with 1 mg/mL collagenase type I (Sigma) for one hour at 37°C to dissociate epithelial cell, centrifuged at 1000× g for 10 min. The supernatant was removed, the pellet was resuspended in Matrigel (Corning) and plated in 50 µL drops in a 24-well plate. After 20 min of incubation at 37°C, organoid growth medium (Advanced DMEM [Thermo Fisher Scientific], 25% conditioned Wnt3A medium, 25% conditioned RSPO1 medium, 10% conditioned Noggin medium, 2% B27 [Thermo Fisher Scientific], 1% N2 [Thermo Fisher Scientific], 1 mM nicotinamide [Sigma], 50 ng/mL human EGF [Thermo Fisher Scientific], 100 ng/mL human FGF [Thermo Fisher Scientific], 0.5 mM TGF-β R Kinase Inhibitor IV [Tocris], 10 mM ROCK inhibitor [Abmole Bioscience]) was added to the wells.

Organoids were splitted every 1–2 weeks, at a ratio of 1:2. The Matrigel drop was resuspended in cold Advanced DMEM medium, mechanically fragmented with a 26 G needle, and centrifuged at 1000× g at 4°C for 5 min. The pellet was resuspended in the respective amount of fresh Matrigel and seeded in 50 µL drops in cell culture well plates added and further processed as explained above.

Infectivity assay in organoids

For infection with Ctr mature organoids were released from Matrigel drops by resuspending them in ice-cold DPBS (Gibco), pooled, mechanically fragmented with a needle, and distributed in equal amounts in Eppendorf tubes. The IFN-γ-treated or untreated organoids were infected with Ctr L2 (5×105 IFU). Afterwards Matrigel was added to the pellets and organoids were seeded in a cell culture plate. Six days post infection the organoids were fixed with 4% PFA and used for immunostaining. In addition, infected organoids were lysed with glass beads and different dilutions were used to infect freshly plated HeLa 229 cells to analyse the infectivity of the progeny.

Acknowledgements

We thank Dr Jörg Wischhusen for providing the human Fimb cells, Dr Francesca Dejure for the WII-U2OS cells, and Dr Ken Fields for pSUmC-4.0 and pSUmC-CRE-bla plasmids. We thank Dr Adriana Moldovan and Marcel Rühling for technical assistance. We thank Dr Andreas Demuth for critically reading the manuscript. This work was supported by the Deutsche Forschungsgemeinschaft (DFG) priority program GRK2157 '3D Tissue Models for Studying Microbial Infections by Human Pathogens' and the European Research Council (grant no. ERC-2018-ADG/NCI-CAD) to TR.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Thomas Rudel, Email: thomas.rudel@uni-wuerzburg.de.

Sophie Helaine, Harvard Medical School, United States.

Dominique Soldati-Favre, University of Geneva, Switzerland.

Funding Information

This paper was supported by the following grants:

  • European Research Council ERC-2018-ADG/NCI-CAD to Thomas Rudel.

  • Deutsche Forschungsgemeinschaft RTG 2157/2 to Thomas Rudel.

Additional information

Competing interests

No competing interests declared.

No competing interests declared.

Author contributions

Conceptualization, Formal analysis, Investigation, Writing – original draft.

Formal analysis, Methodology, Writing – review and editing.

Investigation.

Investigation.

Formal analysis, Investigation, Writing – review and editing.

Investigation.

Formal analysis.

Formal analysis, Writing – review and editing.

Supervision.

Conceptualization, Supervision, Investigation, Writing – original draft.

Conceptualization, Formal analysis, Supervision, Funding acquisition, Writing – original draft, Project administration, Writing – review and editing.

Additional files

Transparent reporting form
Source data 1. Inclusion Forming Units (IFU).
elife-76721-data1.xlsx (50.3KB, xlsx)
Source data 2. Metabolic profiling.
elife-76721-data2.xlsx (259.4KB, xlsx)

Data availability

Metabolomics data set has been uploaded with the manuscript.

References

  1. Abdelrahman YM, Belland RJ. The chlamydial developmental cycle. FEMS Microbiology Reviews. 2005;29:949–959. doi: 10.1016/j.femsre.2005.03.002. [DOI] [PubMed] [Google Scholar]
  2. Aiyar A, Quayle AJ, Buckner LR, Sherchand SP, Chang TL, Zea AH, Martin DH, Belland RJ. Influence of the tryptophan-indole-ifnγ axis on human genital Chlamydia trachomatis infection: role of vaginal co-infections. Frontiers in Cellular and Infection Microbiology. 2014;4:72. doi: 10.3389/fcimb.2014.00072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Albert T, Urlbauer B, Kohlhuber F, Hammersen B, Eick D. Ongoing mutations in the N-terminal domain of c-myc affect transactivation in Burkitt's lymphoma cell lines. Oncogene. 1994;9:759–763. [PubMed] [Google Scholar]
  4. Allan I, Pearce JH. Amino acid requirements of strains of Chlamydia trachomatis and C. psittaci growing in McCoy cells: relationship with clinical syndrome and host origin. Journal of General Microbiology. 1983a;129:2001–2007. doi: 10.1099/00221287-129-7-2001. [DOI] [PubMed] [Google Scholar]
  5. Allan I, Pearce JH. Differential amino acid utilization by Chlamydia psittaci (strain guinea pig inclusion conjunctivitis) and its regulatory effect on chlamydial growth. Journal of General Microbiology. 1983b;129:1991–2000. doi: 10.1099/00221287-129-7-1991. [DOI] [PubMed] [Google Scholar]
  6. AlZeer MA, Xavier A, Abu Lubad M, Sigulla J, Kessler M, Hurwitz R, Meyer TF. Chlamydia trachomatis prevents apoptosis via activation of PDPK1-MYC and enhanced mitochondrial binding of hexokinase II. EBioMedicine. 2017;23:100–110. doi: 10.1016/j.ebiom.2017.08.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Asao H, Fu XY. Interferon-Gamma has dual potentials in inhibiting or promoting cell proliferation. The Journal of Biological Chemistry. 2000;275:867–874. doi: 10.1074/jbc.275.2.867. [DOI] [PubMed] [Google Scholar]
  8. Battey J, Moulding C, Taub R, Murphy W, Stewart T, Potter H, Lenoir G, Leder P. The human c-myc oncogene: structural consequences of translocation into the IgH locus in Burkitt lymphoma. Cell. 1983;34:779–787. doi: 10.1016/0092-8674(83)90534-2. [DOI] [PubMed] [Google Scholar]
  9. Beatty WL, Belanger TA, Desai AA, Morrison RP, Byrne GI. Tryptophan depletion as a mechanism of gamma interferon-mediated chlamydial persistence. Infection and Immunity. 1994;62:3705–3711. doi: 10.1128/iai.62.9.3705-3711.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bhutia YD, Babu E, Ganapathy V. Interferon-γ induces a tryptophan-selective amino acid transporter in human colonic epithelial cells and mouse dendritic cells. Biochimica et Biophysica Acta. 2015;1848:453–462. doi: 10.1016/j.bbamem.2014.10.021. [DOI] [PubMed] [Google Scholar]
  11. Buchholz KR, Stephens RS. The cytosolic pattern recognition receptor NOD1 induces inflammatory interleukin-8 during Chlamydia trachomatis infection. Infection and Immunity. 2008;76:3150–3155. doi: 10.1128/IAI.00104-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Byrne GI, Lehmann LK, Landry GJ. Induction of tryptophan catabolism is the mechanism for gamma-interferon-mediated inhibition of intracellular Chlamydia psittaci replication in T24 cells. Infection and Immunity. 1986;53:347–351. doi: 10.1128/iai.53.2.347-351.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Caldwell HD, Wood H, Crane D, Bailey R, Jones RB, Mabey D, Maclean I, Mohammed Z, Peeling R, Roshick C, Schachter J, Solomon AW, Stamm WE, Suchland RJ, Taylor L, West SK, Quinn TC, Belland RJ, McClarty G. Polymorphisms in Chlamydia trachomatis tryptophan synthase genes differentiate between genital and ocular isolates. The Journal of Clinical Investigation. 2003;111:1757–1769. doi: 10.1172/JCI17993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Capmany A, Gambarte Tudela J, Alonso Bivou M, Damiani MT. Akt/AS160 signaling pathway inhibition impairs infection by decreasing rab14-controlled sphingolipids delivery to chlamydial inclusions. Frontiers in Microbiology. 2019;10:666. doi: 10.3389/fmicb.2019.00666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Chong J, Wishart DS, Xia J. Using metaboanalyst 4.0 for comprehensive and integrative metabolomics data analysis. Current Protocols in Bioinformatics. 2019;68:e86. doi: 10.1002/cpbi.86. [DOI] [PubMed] [Google Scholar]
  16. Coffin JM, Varmus HE, Bishop JM, Essex M, Hardy WD, Martin GS, Rosenberg NE, Scolnick EM, Weinberg RA, Vogt PK. Proposal for naming host cell-derived inserts in retrovirus genomes. Journal of Virology. 1981;40:953–957. doi: 10.1128/JVI.40.3.953-957.1981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Cunningham JT, Moreno MV, Lodi A, Ronen SM, Ruggero D. Protein and nucleotide biosynthesis are coupled by a single rate-limiting enzyme, PRPS2, to drive cancer. Cell. 2014;157:1088–1103. doi: 10.1016/j.cell.2014.03.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Dang CV. C-Myc target genes involved in cell growth, apoptosis, and metabolism. Molecular and Cellular Biology. 1999;19:1–11. doi: 10.1128/MCB.19.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Darville T, O’Neill JM, Andrews CW, Nagarajan UM, Stahl L, Ojcius DM. Toll-Like receptor-2, but not Toll-like receptor-4, is essential for development of oviduct pathology in chlamydial genital tract infection. Journal of Immunology. 2003;171:6187–6197. doi: 10.4049/jimmunol.171.11.6187. [DOI] [PubMed] [Google Scholar]
  20. Dejure FR, Eilers M. MYC and tumor metabolism: chicken and egg. The EMBO Journal. 2017;36:3409–3420. doi: 10.15252/embj.201796438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Dejure FR, Royla N, Herold S, Kalb J, Walz S, Ade CP, Mastrobuoni G, Vanselow JT, Schlosser A, Wolf E, Kempa S, Eilers M. The MYC mRNA 3'-UTR couples RNA polymerase II function to glutamine and ribonucleotide levels. The EMBO Journal. 2017;36:1854–1868. doi: 10.15252/embj.201796662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Dong Y, Tu R, Liu H, Qing G. Regulation of cancer cell metabolism: oncogenic Myc in the driver ’ S seat. Signal Transduction and Targeted Therapy. 2020;5:124. doi: 10.1038/s41392-020-00235-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Duesberg PH, Vogt PK. Avian acute leukemia viruses MC29 and MH2 share specific RNA sequences: evidence for a second class of transforming genes. PNAS. 1979;76:1633–1637. doi: 10.1073/pnas.76.4.1633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Evans DR, Guy HI. Mammalian pyrimidine biosynthesis: fresh insights into an ancient pathway. The Journal of Biological Chemistry. 2004;279:33035–33038. doi: 10.1074/jbc.R400007200. [DOI] [PubMed] [Google Scholar]
  25. Fehlner-Gardiner C, Roshick C, Carlson JH, Hughes S, Belland RJ, Caldwell HD, McClarty G. Molecular basis defining human Chlamydia trachomatis tissue tropism. A possible role for tryptophan synthase. The Journal of Biological Chemistry. 2002;277:26893–26903. doi: 10.1074/jbc.M203937200. [DOI] [PubMed] [Google Scholar]
  26. Fenwick A. The global burden of neglected tropical diseases. Public Health. 2012;126:233–236. doi: 10.1016/j.puhe.2011.11.015. [DOI] [PubMed] [Google Scholar]
  27. Gagnaire A, Nadel B, Raoult D, Neefjes J, Gorvel JP. Collateral damage: insights into bacterial mechanisms that predispose host cells to cancer. Nature Reviews. Microbiology. 2017;15:109–128. doi: 10.1038/nrmicro.2016.171. [DOI] [PubMed] [Google Scholar]
  28. Galvin SR, Cohen MS. The role of sexually transmitted diseases in HIV transmission. Nature Reviews. Microbiology. 2004;2:33–42. doi: 10.1038/nrmicro794. [DOI] [PubMed] [Google Scholar]
  29. Ganesan S, Roy CR. Host cell depletion of tryptophan by IFNγ-induced indoleamine 2,3-dioxygenase 1 (IDO1) inhibits lysosomal replication of Coxiella burnetii. PLOS Pathogens. 2019;15:e1007955. doi: 10.1371/journal.ppat.1007955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Gaylord WH. Intracellular forms of meningopneumonitis virus. The Journal of Experimental Medicine. 1954;100:575–580. doi: 10.1084/jem.100.6.575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Gordan JD, Thompson CB, Simon MC. HIF and c-myc: sibling rivals for control of cancer cell metabolism and proliferation. Cancer Cell. 2007;12:108–113. doi: 10.1016/j.ccr.2007.07.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Hackstadt T, Fischer ER, Scidmore MA, Rockey DD, Heinzen RA. Origins and functions of the chlamydial inclusion. Trends in Microbiology. 1997;5:288–293. doi: 10.1016/S0966-842X(97)01061-5. [DOI] [PubMed] [Google Scholar]
  33. Hare MJ, Taylor-robinson D, Cooper P. Evidence for an association between Chlamydia trachomatis and cervical intraepithelial neoplasia. BJOG: An International Journal of Obstetrics and Gynaecology. 1982;89:489–492. doi: 10.1111/j.1471-0528.1982.tb03643.x. [DOI] [PubMed] [Google Scholar]
  34. Ho JL, He S, Hu A, Geng J, Basile FG, Almeida MG, Saito AY, Laurence J, Johnson WD. Neutrophils from human immunodeficiency virus (HIV) -seronegative donors induce HIV replication from HIV-infected patients’ mononuclear cells and cell lines: an in vitro model of HIV transmission facilitated by Chlamydia trachomatis. The Journal of Experimental Medicine. 1995;181:1493–1505. doi: 10.1084/jem.181.4.1493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Hu X, Ivashkiv LB. Cross-regulation of signaling pathways by interferon-gamma: implications for immune responses and autoimmune diseases. Immunity. 2009;31:539–550. doi: 10.1016/j.immuni.2009.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Hybiske K, Stephens RS. Mechanisms of host cell exit by the intracellular bacterium Chlamydia. PNAS. 2007;104:11430–11435. doi: 10.1073/pnas.0703218104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kari L, Goheen MM, Randall LB, Taylor LD, Carlson JH, Whitmire WM, Virok D, Rajaram K, Endresz V, McClarty G, Nelson DE, Caldwell HD. Generation of targeted Chlamydia trachomatis null mutants. PNAS. 2011;108:7189–7193. doi: 10.1073/pnas.1102229108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Karupiah G, Xie QW, Buller RM, Nathan C, Duarte C, MacMicking JD. Inhibition of viral replication by interferon-gamma-induced nitric oxide synthase. Science. 1993;261:1445–1448. doi: 10.1126/science.7690156. [DOI] [PubMed] [Google Scholar]
  39. Keb G, Fields KA. Markerless gene deletion by floxed cassette allelic exchange mutagenesis in Chlamydia trachomatis. Journal of Visualized Experiments. 2020;30:60848. doi: 10.3791/60848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Kessler M, Hoffmann K, Fritsche K, Brinkmann V, Mollenkopf HJ, Thieck O, Teixeira da Costa AR, Braicu EI, Sehouli J, Mangler M, Berger H, Meyer TF. Chronic Chlamydia infection in human organoids increases stemness and promotes age-dependent CpG methylation. Nature Communications. 2019;10:1194. doi: 10.1038/s41467-019-09144-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Khan S, Abdelrahim M, Samudio I, Safe S. Estrogen receptor/sp1 complexes are required for induction of CAD gene expression by 17beta-estradiol in breast cancer cells. Endocrinology. 2003;144:2325–2335. doi: 10.1210/en.2002-0149. [DOI] [PubMed] [Google Scholar]
  42. Koskela P, Anttila T, Bjørge T, Brunsvig A, Dillner J, Hakama M, Hakulinen T, Jellum E, Lehtinen M, Lenner P, Luostarinen T, Pukkala E, Saikku P, Thoresen S, Youngman L, Paavonen J. Chlamydia trachomatis infection as a risk factor for invasive cervical cancer. International Journal of Cancer. 2000;85:35–39. doi: 10.1002/(sici)1097-0215(20000101)85:1&#x0003c;35::aid-ijc6&#x0003e;3.0.co;2-a. [DOI] [PubMed] [Google Scholar]
  43. Krause CD, He W, Kotenko S, Pestka S. Modulation of the activation of STAT1 by the interferon-gamma receptor complex. Cell Research. 2006;16:113–123. doi: 10.1038/sj.cr.7310015. [DOI] [PubMed] [Google Scholar]
  44. Kress TR, Sabò A, Amati B. MYC: connecting selective transcriptional control to global RNA production. Nature Reviews. Cancer. 2015;15:593–607. doi: 10.1038/nrc3984. [DOI] [PubMed] [Google Scholar]
  45. Lehr S, Vier J, Häcker G, Kirschnek S. Activation of neutrophils by Chlamydia trachomatis-infected epithelial cells is modulated by the chlamydial plasmid. Microbes and Infection. 2018;20:284–292. doi: 10.1016/j.micinf.2018.02.007. [DOI] [PubMed] [Google Scholar]
  46. Liu YC, Li F, Handler J, Huang CRL, Xiang Y, Neretti N, Sedivy JM, Zeller KI, Dang CV. Global regulation of nucleotide biosynthetic genes by c-myc. PLOS ONE. 2008;3:e2722. doi: 10.1371/journal.pone.0002722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Lorenzin F, Benary U, Baluapuri A, Walz S, Jung LA, von Eyss B, Kisker C, Wolf J, Eilers M, Wolf E. Different promoter affinities account for specificity in MYC-dependent gene regulation. eLife. 2016;5:e15161. doi: 10.7554/eLife.15161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. MacMicking JD. Interferon-Inducible effector mechanisms in cell-autonomous immunity. Nature Reviews. Immunology. 2012;12:367–382. doi: 10.1038/nri3210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Makinoshima H, Takita M, Matsumoto S, Yagishita A, Owada S, Esumi H, Tsuchihara K. Epidermal growth factor receptor (EGFR) signaling regulates global metabolic pathways in EGFR-mutated lung adenocarcinoma. The Journal of Biological Chemistry. 2014;289:20813–20823. doi: 10.1074/jbc.M114.575464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Malik A, Jain S, Rizvi M, Shukla I, Hakim S. Chlamydia trachomatis infection in women with secondary infertility. Fertility and Sterility. 2009;91:91–95. doi: 10.1016/j.fertnstert.2007.05.070. [DOI] [PubMed] [Google Scholar]
  51. Mannava S, Grachtchouk V, Wheeler LJ, Im M, Zhuang D, Slavina EG, Mathews CK, Shewach DS, Nikiforov MA. Direct role of nucleotide metabolism in c-MYC-dependent proliferation of melanoma cells. Cell Cycle. 2008;7:2392–2400. doi: 10.4161/cc.6390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. McClarty G, Tipples G. In situ studies on incorporation of nucleic acid precursors into Chlamydia trachomatis DNA. Journal of Bacteriology. 1991;173:4922–4931. doi: 10.1128/jb.173.16.4922-4931.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Mehlitz A, Eylert E, Huber C, Lindner B, Vollmuth N, Karunakaran K, Goebel W, Eisenreich W, Rudel T. Metabolic adaptation of Chlamydia trachomatis to mammalian host cells. Molecular Microbiology. 2017;103:1004–1019. doi: 10.1111/mmi.13603. [DOI] [PubMed] [Google Scholar]
  54. Mueller KE, Wolf K, Fields KA. Gene deletion by fluorescence-reported allelic exchange mutagenesis in Chlamydia trachomatis. MBio. 2016;7:e01817-15. doi: 10.1128/mBio.01817-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Nagarajan UM, Sikes JD, Yeruva L, Prantner D. Significant role of IL-1 signaling, but limited role of inflammasome activation, in oviduct pathology during Chlamydia muridarum genital infection. Journal of Immunology. 2012;188:2866–2875. doi: 10.4049/jimmunol.1103461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Nelson DE, Virok DP, Wood H, Roshick C, Johnson RM, Whitmire WM, Crane DD, Steele-Mortimer O, Kari L, McClarty G, Caldwell HD. Chlamydial IFN-gamma immune evasion is linked to host infection tropism. PNAS. 2005;102:10658–10663. doi: 10.1073/pnas.0504198102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Newman L, Rowley J, Vander Hoorn S, Wijesooriya NS, Unemo M, Low N, Stevens G, Gottlieb S, Kiarie J, Temmerman M. Global estimates of the prevalence and incidence of four curable sexually transmitted infections in 2012 based on systematic review and global reporting. PLOS ONE. 2015;10:e0143304. doi: 10.1371/journal.pone.0143304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Nguyen H, Ramana CV, Bayes J, Stark GR. Roles of phosphatidylinositol 3-kinase in interferon-gamma-dependent phosphorylation of STAT1 on serine 727 and activation of gene expression. The Journal of Biological Chemistry. 2001;276:33361–33368. doi: 10.1074/jbc.M105070200. [DOI] [PubMed] [Google Scholar]
  59. Østergaard O, Follmann F, Olsen AW, Heegaard NH, Andersen P, Rosenkrands I. Quantitative protein profiling of Chlamydia trachomatis growth forms reveals defense strategies against tryptophan starvation. Molecular & Cellular Proteomics. 2016;15:3540–3550. doi: 10.1074/mcp.M116.061986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Otten C, Brilli M, Vollmer W, Viollier PH, Salje J. Peptidoglycan in obligate intracellular bacteria. Molecular Microbiology. 2018;107:142–163. doi: 10.1111/mmi.13880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Paland N, Böhme L, Gurumurthy RK, Mäurer A, Szczepek AJ, Rudel T. Reduced display of tumor necrosis factor receptor I at the host cell surface supports infection with Chlamydia trachomatis. The Journal of Biological Chemistry. 2008;283:6438–6448. doi: 10.1074/jbc.M708422200. [DOI] [PubMed] [Google Scholar]
  62. Panzetta ME, Valdivia RH, Saka HA. Chlamydia persistence: a survival strategy to evade antimicrobial effects in-vitro and in-vivo. Frontiers in Microbiology. 2018;9:3101. doi: 10.3389/fmicb.2018.03101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Patel AL, Chen X, Wood ST, Stuart ES, Arcaro KF, Molina DP, Petrovic S, Furdui CM, Tsang AW. Activation of epidermal growth factor receptor is required for Chlamydia trachomatis development. BMC Microbiology. 2014;14:277. doi: 10.1186/s12866-014-0277-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Rajeeve K, Vollmuth N, Janaki-Raman S, Wulff TF, Baluapuri A, Dejure FR, Huber C, Fink J, Schmalhofer M, Schmitz W, Sivadasan R, Eilers M, Wolf E, Eisenreich W, Schulze A, Seibel J, Rudel T. Reprogramming of host glutamine metabolism during Chlamydia trachomatis infection and its key role in peptidoglycan synthesis. Nature Microbiology. 2020;5:1390–1402. doi: 10.1038/s41564-020-0762-5. [DOI] [PubMed] [Google Scholar]
  65. Ramana CV, Grammatikakis N, Chernov M, Nguyen H, Goh KC, Williams BR, Stark GR. Regulation of c-myc expression by IFN-gamma through STAT1-dependent and -independent pathways. The EMBO Journal. 2000;19:263–272. doi: 10.1093/emboj/19.2.263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Raulston JE. Response of Chlamydia trachomatis serovar E to iron restriction in vitro and evidence for iron-regulated chlamydial proteins. Infection and Immunity. 1997;65:4539–4547. doi: 10.1128/iai.65.11.4539-4547.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Schlee M, Hölzel M, Bernard S, Mailhammer R, Schuhmacher M, Reschke J, Eick D, Marinkovic D, Wirth T, Rosenwald A, Staudt LM, Eilers M, Baran-Marszak F, Fagard R, Feuillard J, Laux G, Bornkamm GW. C-MYC activation impairs the NF-kappaB and the interferon response: implications for the pathogenesis of Burkitt’s lymphoma. International Journal of Cancer. 2007;120:1387–1395. doi: 10.1002/ijc.22372. [DOI] [PubMed] [Google Scholar]
  68. Shan W, Liu J. Inflammation: a hidden path to breaking the spell of ovarian cancer. Cell Cycle. 2009;8:3107–3111. doi: 10.4161/cc.8.19.9590. [DOI] [PubMed] [Google Scholar]
  69. Shima K, Kaeding N, Ogunsulire IM, Kaufhold I, Klinger M, Rupp J. Interferon-gamma interferes with host cell metabolism during intracellular Chlamydia trachomatis infection. Cytokine. 2018;112:95–101. doi: 10.1016/j.cyto.2018.05.039. [DOI] [PubMed] [Google Scholar]
  70. Siegl C, Prusty BK, Karunakaran K, Wischhusen J, Rudel T. Tumor suppressor p53 alters host cell metabolism to limit Chlamydia trachomatis infection. Cell Reports. 2014;9:918–929. doi: 10.1016/j.celrep.2014.10.004. [DOI] [PubMed] [Google Scholar]
  71. Smith JS, Bosetti C, Muñoz N, Herrero R, Bosch FX, Eluf-Neto J, Meijer C, Van Den Brule AJC, Franceschi S, Peeling RW, IARC multicentric case-control study Chlamydia trachomatis and invasive cervical cancer: a pooled analysis of the IARC multicentric case-control study. International Journal of Cancer. 2004;111:431–439. doi: 10.1002/ijc.20257. [DOI] [PubMed] [Google Scholar]
  72. Stine ZE, Walton ZE, Altman BJ, Hsieh AL, Dang CV. MYC, metabolism, and cancer. Cancer Discovery. 2015;5:1024–1039. doi: 10.1158/2159-8290.CD-15-0507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Subbarayal P, Karunakaran K, Winkler AC, Rother M, Gonzalez E, Meyer TF, Rudel T. EphrinA2 receptor (EphA2) is an invasion and intracellular signaling receptor for Chlamydia trachomatis. PLOS Pathogens. 2015;11:e1004846. doi: 10.1371/journal.ppat.1004846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Suchland RJ, Dimond ZE, Putman TE, Rockey DD. Demonstration of persistent infections and genome stability by whole-genome sequencing of repeat-positive, same-serovar Chlamydia trachomatis collected from the female genital tract. The Journal of Infectious Diseases. 2017;215:1657–1665. doi: 10.1093/infdis/jix155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Svenstrup HF, Fedder J, Kristoffersen SE, Trolle B, Birkelund S, Christiansen G. Mycoplasma genitalium, Chlamydia trachomatis, and tubal factor infertility -- a prospective study. Fertility and Sterility. 2008;90:513–520. doi: 10.1016/j.fertnstert.2006.12.056. [DOI] [PubMed] [Google Scholar]
  76. Tamura A, Manire GP. Effect of penicillin on the multiplication of meningopneumonitis organisms (Chlamydia psittaci) Journal of Bacteriology. 1968;96:875–880. doi: 10.1128/jb.96.4.875-880.1968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Taylor MW, Feng GS. Relationship between interferon-gamma, indoleamine 2,3-dioxygenase, and tryptophan catabolism. FASEB Journal. 1991;5:2516–2522. [PubMed] [Google Scholar]
  78. Thai M, Graham NA, Braas D, Nehil M, Komisopoulou E, Kurdistani SK, McCormick F, Graeber TG, Christofk HR. Adenovirus E4ORF1-induced MYC activation promotes host cell anabolic glucose metabolism and virus replication. Cell Metabolism. 2014;19:694–701. doi: 10.1016/j.cmet.2014.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Thai M, Thaker SK, Feng J, Du Y, Hu H, Ting Wu T, Graeber TG, Braas D, Christofk HR. MYC-Induced reprogramming of glutamine catabolism supports optimal virus replication. Nature Communications. 2015;6:8873. doi: 10.1038/ncomms9873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Tipples G, McClarty G. The obligate intracellular bacterium Chlamydia trachomatis is auxotrophic for three of the four ribonucleoside triphosphates. Molecular Microbiology. 1993;8:1105–1114. doi: 10.1111/j.1365-2958.1993.tb01655.x. [DOI] [PubMed] [Google Scholar]
  81. van Dam L, Korolev N, Nordenskiöld L. Polyamine-nucleic acid interactions and the effects on structure in oriented DNA fibers. Nucleic Acids Research. 2002;30:419–428. doi: 10.1093/nar/30.2.419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Vervoorts J, Lüscher-Firzlaff J, Lüscher B. The ins and outs of MYC regulation by posttranslational mechanisms. The Journal of Biological Chemistry. 2006;281:34725–34729. doi: 10.1074/jbc.R600017200. [DOI] [PubMed] [Google Scholar]
  83. Wang Y, Kahane S, Cutcliffe LT, Skilton RJ, Lambden PR, Clarke IN. Development of a transformation system for Chlamydia trachomatis: restoration of glycogen biosynthesis by acquisition of a plasmid shuttle vector. PLOS Pathogens. 2011;7:e1002258. doi: 10.1371/journal.ppat.1002258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Weizman O-E, Adams NM, Schuster IS, Krishna C, Pritykin Y, Lau C, Degli-Esposti MA, Leslie CS, Sun JC, O’Sullivan TE. ILC1 confer early host protection at initial sites of viral infection. Cell. 2017;171:795–808. doi: 10.1016/j.cell.2017.09.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Welcker M, Orian A, Jin J, Grim JE, Grim JA, Harper JW, Eisenman RN, Clurman BE. The Fbw7 tumor suppressor regulates glycogen synthase kinase 3 phosphorylation-dependent c-MYC protein degradation. PNAS. 2004;101:9085–9090. doi: 10.1073/pnas.0402770101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Wyrick PB. Chlamydia trachomatis persistence in vitro: an overview. The Journal of Infectious Diseases. 2010;201 Suppl 2:S88–S95. doi: 10.1086/652394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Yao J, Abdelrahman YM, Robertson RM, Cox JV, Belland RJ, White SW, Rock CO. Type II fatty acid synthesis is essential for the replication of Chlamydia trachomatis. The Journal of Biological Chemistry. 2014;289:22365–22376. doi: 10.1074/jbc.M114.584185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  88. Yao J, Dodson VJ, Frank MW, Rock CO. Chlamydia trachomatis scavenges host fatty acids for phospholipid synthesis via an acyl-acyl carrier protein synthetase. The Journal of Biological Chemistry. 2015;290:22163–22173. doi: 10.1074/jbc.M115.671008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. Ziklo N, Huston WM, Taing K, Katouli M, Timms P. In vitro rescue of genital strains of Chlamydia trachomatis from interferon-γ and tryptophan depletion with indole-positive, but not indole-negative Prevotella spp. BMC Microbiology. 2016;16:286. doi: 10.1186/s12866-016-0903-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

Editor's evaluation

Sophie Helaine 1

This paper will be of interest to scientists working to understand Chlamydia trachomatis persistence, and host pathogen interaction in general. The authors report the surprising observation that the mechanism of restriction of bacterial growth is through the inhibition of c-Myc signaling by IFNγ as opposed to IDO-dependent depletion of tryptophan levels, as had been previously suggested.

Decision letter

Editor: Sophie Helaine1

Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "Myc plays a key role in IFN-γ-induced persistence of Chlamydia trachomatis" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Dominique Soldati-Favre as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

Data need strengthening in terms of (a) quantification, (b) statistical analyses, (c) controls and (d) consistency of models used.

(a) Quantification:

Strengthen all instances of quantification based on western blots: a single Western blot is not acceptable evidence. Report the level of variance for technical replicates, or variability among independent biological replicates. (See for example Figure 4B, E; S4C, H; Figure S1C.)

In Figure 1B, there is a significant increase in c-Myc protein in condition 2 compared to condition 1 (~300%). However, in Figure S1C, the increase from t0 to 30 hpi, appears to be very mild (~50%) in c-Myc protein levels compared with at 0 hpi (in the non-IFNγ-treated samples). In light of these variations, please report on the reproducibility of Ctr-mediated c-Myc induction.

Figures 4A-C, S4A-B, S4D. The Western blots showing cHSP60/OmpA levels are not alone sufficiently convincing to support that tryptophan or indole supplementation rescues chlamydial growth after IFNγ treatment. Please provide another method to support these statements (e.g. microscopy).

(b) Statistical analyses:

Provide a systematic description of the statistical tests used throughout.

More specifically, do results of Figure 2D hold when an unpaired t-test rather than a paired t-test is used for the analysis? Lines 152-156. Statistical analyses should be carried out between untreated and IFNγ/AHT-treated samples in Figures S1I and S1J respectively to support the statements described here. Provide error bars, number of repeats and statistical analysis for figure S3B. Figures 6B-C, S6C-F, clarify the choice of statistical tests. Should multiple testing correction be applied considering the nature of these experiments/analyses?

(c) Controls:

Figure 1A-C, please report if, at 24 hpi for conditions 3 and 4, Ctr inclusion formation and c-Myc levels were, as expected, the same. In addition, provide a control wherein cells expressing a control shRNA that AHT expression does not impact Ctr inclusion formation in the absence of c-Myc suppression.

Figure S4F-G. Include a control in which cHSP60 is expected/can be detected.

The addition of DMKG can rescue Ctr from IFN-γ-induced persistence. Please test the addition of aconitate and citrate, both metabolites that should be required for C. trachomatis development too.

Type I IFNS do not induce persistence and only weakly limit Chlamydia replication, yet they also signal through STAT1. Test the model for STAT1-dependent regulation of c-myc. If IFNa/b decreases c-myc levels yet causes no persistence, reconsider the model linking IFNγ-induced tryptophan limitation to destabilisation of c-Myc.

(d) Consistency:

There are differences in response to IFN γ between cell lines that are not addressed fully.

Figure S3 shows c-Myc overexpression in HeLa cells but not in organoids, provide this result.

Similarly, the degree to which DMKG and nucleosides affect persistence appears less consistent (in contrast to L-tryptophane) and possibly confounded by different cell lines. In Figure 6, the addition of DMKG to IFN-treated cells during infection rescues inclusion number to levels of the untreated control but significantly less in Figure 7D. The addition of nucleosides in the cells used in Figure 6 rescues persistence significantly less (as assessed by inclusion number) than DMKG, but there is no data presented from the cells used in Figure 7. The organoid infection experiments seemed to be underpowered and quantification of infectivity is a little suspect (Figure S2H- inclusions were titers an uneven number of cells). U2OS and HeLa cells are transformed and their metabolism is likely to be very distinct. Thus, show if DMKG or nucleosides rescue persistence in primary Fimb cells.

In addition, the reduction of LAT1 levels is quite striking in HeLa cells (Figure 5C) but very minor in U2OS cells. U2OS cells might survive better c-Myc overexpression that can be pro-apoptotic. Please acknowledge.

(e) In addition, the model linking IFNγ-induced tryptophan limitation to destabilisation of c-Myc via PI3K-GSK3b is not fully supported by the current evidence. Either provide direct evidence of either increased phosphorylation of threonine 58 on c-Myc or increased proteasomal degradation of c-Myc as a result of decreased levels of tryptophan upon IFNγ treatment (at the moment, it seems that phosphorylation of threonine 58 is unchanged upon IFNγ treatment (see Lines 157-162 and Figure 1E)); or remove the model and rework the text accordingly. Of note, bacterial replication also induces AKT and GSK3b.

(f) Line 541-544/Figure S6E: Considering that the most pronounced effect appears to be on adenosine (Figure 6C) and ATP (Figure S6E), please consider and discuss that the effect could be mediated by reduced ATP levels generally slowing down metabolic processes rather than DNA replication in particular.

(g) Line 553-555/Figure 6F. The authors suggest that "restoration of chlamydial development could also be achieved by the sole addition of pyrimidine (U+C), and to a minor extend [sic] also purine nucleosides (A+G)". However, Figure 6F appear to suggest that purines (A+G) have a more significant contribution to Chlamydia trachomatis development than pyrimidines (C+U), which appear to have a statistically insignificant effect. Please clarify.

eLife. 2022 Sep 26;11:e76721. doi: 10.7554/eLife.76721.sa2

Author response


Essential revisions:

Data need strengthening in terms of (a) quantification, (b) statistical analyses, (c) controls and (d) consistency of models used.

(a) Quantification:

Strengthen all instances of quantification based on western blots: a single Western blot is not acceptable evidence. Report the level of variance for technical replicates, or variability among independent biological replicates. (See for example Figure 4B, E; S4C, H; Figure S1C.)

We fully agree that a single western blot is not sufficient to draw any conclusions. We generally repeat western blots three times from three biological replicates. We now explicitly mention this in the figure legend of figures showing western blots. Generally, the tendency of the results shown in the manuscript was always the same, individual levels of protein bands varied in individual blots probably due to blotting efficiency.

In Figure 1B, there is a significant increase in c-Myc protein in condition 2 compared to condition 1 (~300%). However, in Figure S1C, the increase from t0 to 30 hpi, appears to be very mild (~50%) in c-Myc protein levels compared with at 0 hpi (in the non-IFNγ-treated samples). In light of these variations, please report on the reproducibility of Ctr-mediated c-Myc induction.

Variation of c-Myc induction dependent on the infection conditions and the cell line or cell type used is indeed what we see. In the case mentioned here, the cell lines are different. In Figure 1B, HeLa229-shc-Myc, in the experiment shown in Figure S1C (new Figure 1 —figure supplement 1E), the cell was HeLa229 which responds differently to Chlamydia infection.

Figures 4A-C, S4A-B, S4D. The Western blots showing cHSP60/OmpA levels are not alone sufficiently convincing to support that tryptophan or indole supplementation rescues chlamydial growth after IFNγ treatment. Please provide another method to support these statements (e.g. microscopy).

We included light microscopy pictures to demonstrate the clear difference in inclusion formation dependent on tryptophan (Figure 4 —figure supplement 1C) and indole (Figure 4 —figure supplement 1F) supplementation after IFN-γ treatment. Unfortunately, the quality of the images is low in the pdf due to the size restrictions of the journal for the upload of manuscripts. We are happy to provide high resolution images if requested by the reviewers.

(b) Statistical analyses:

Provide a systematic description of the statistical tests used throughout.

More specifically, do results of Figure 2D hold when an unpaired t-test rather than a paired t-test is used for the analysis?

We provided a detailed description of the statistical test in the manuscript in each figure legend. If we use an unpaired t-test for the data shown in Figure 2D, the differences are not significant (0.1268; 0.6641). However, we used the paired t test since the organoids are all derived from the same biopsy. For this experimental setting, the paired t-test should be appropriate.

Lines 152-156. Statistical analyses should be carried out between untreated and IFNγ/AHT-treated samples in Figures S1I and S1J respectively to support the statements described here.

We performed several statistical analyses (unpaired t-test, paired t-test and one-way ANOVA) and none of them revealed significant induction of trpB. (Figure S1I and S1J new Figure 1 —figure supplement 1K and L)

Provide error bars, number of repeats and statistical analysis for figure S3B.

We replaced Figure 3 —figure supplement 1B and included error bars and the number of individual repeats.

Figures 6B-C, S6C-F, clarify the choice of statistical tests. Should multiple testing correction be applied considering the nature of these experiments/analyses?

We are grateful to the reviewers for this comment and fully agree that multiple testing correction should be applied for these data. We repeated the analysis and included FDR correction. Figure 6B-C and Figure 6 —figure supplement 1C-F have been exchanged.

In the methods part we included analysis as follows: “Statistical analysis was performed using Prism GraphPad or MetaboAnalyst 4.0. Significantly changed metabolite levels were determined by ANOVA with subsequent FDR correction, where a p value of 0.05 was considered statistically significant and Tukey HSD was applied as post-hoc test.”

(c) Controls:

Figure 1A-C, please report if, at 24 hpi for conditions 3 and 4, Ctr inclusion formation and c-Myc levels were, as expected, the same. In addition, provide a control wherein cells expressing a control shRNA that AHT expression does not impact Ctr inclusion formation in the absence of c-Myc suppression.

At 24 hpi, AHT was remove and the cells were washed with cell culture medium. At this time point, the inclusions and c-Myc levels were the same. This is expected since the samples were treated identical to this point. We have added this statement to the text on page 6.

For the control shRNA experiment we included HeLa229 NTC SCC5 cells which express a control shRNA (pInducer11 non-targeting shRNA). Treatment of this cell line under the same conditions as the knockdown cell line revealed no difference. IF images and IFU counts of these experiments were added in Figure S1A and S1B, respectively.

Figure S4F-G. Include a control in which cHSP60 is expected/can be detected.

We included a control in which chlamydial replication is possible (addition of tryptophan) and cHsp60 expression can be detected. These blots are now included in the new Figure 4 —figure supplement 1H and I.

The addition of DMKG can rescue Ctr from IFN-γ-induced persistence. Please test the addition of aconitate and citrate, both metabolites that should be required for C. trachomatis development too.

We performed the experiment with citrate as suggested and detected the trend to rescue as predicted by the reviewer. The results have been included as a new Figure 6G showing IFU data and a western blot. We unfortunately could not perform the aconitate experiment since the order was postponed by the company. The expected delivery is now in August 2022. Since the delivery in August is not guaranteed and we were already delayed with the revision of the manuscript, we decided to submit the revision without the aconitate data.

Type I IFNS do not induce persistence and only weakly limit Chlamydia replication, yet they also signal through STAT1. Test the model for STAT1-dependent regulation of c-myc. If IFNa/b decreases c-myc levels yet causes no persistence, reconsider the model linking IFNγ-induced tryptophan limitation to destabilisation of c-Myc.

We performed the experiment with IFN-α as suggested by the reviewers and tested the effects on c-Myc and Ctr. C-Myc level were slightly reduced compared to infection in the absence of IFN-α but not as strongly as after IFN-α treatment. The inhibitory effect of IFN-α on Ctr was also mild. We included the results of this experiment as a new Figure 1J and added the following statement:

Line 189: Since IFN-α also signals through STAT1, we tested whether IFN-α also downregulates c-Myc and chlamydial growth. Although c-Myc levels and the bacterial load were slightly reduced upon IFN-a treatment, it failed to induce strong c-Myc depletion and chlamydial persistence suggesting that Type I and -II IFNs have different effects on c-Myc levels and chlamydial replication (Figure 1J).

(d) Consistency:

There are differences in response to IFN γ between cell lines that are not addressed fully.

Figure S3 shows c-Myc overexpression in HeLa cells but not in organoids, provide this result.

If we understand correctly, this comment addresses two issues: c-Myc response to IFN-γ in cell lines and the overexpression of c-Myc by lentiviral transduction. Indeed, c-Myc downregulation by IFN-γ treatment is differently affected in different cell lines. However, since c-Myc expression is weak in human organoids in the absence of infection, the downregulation is only visible in infected organoids. This is shown in Figure 2E. Regarding the lentivirus-induced overexpression, this is also weaker in organoids as compared to HeLa cells as shown in Figure 3 —figure supplement 1C and D. We have now indicated this fact in the manuscript:

Line 326:

“IFN-γ-induced c-Myc downregulation varies in different cell lines and in organoids downregulation is only visible in infected organoids due to weak c-Myc expression in uninfected human organoids (Figure 2E). Therefore, lentivirus-induced overexpression is also weaker in human organoids as compared to HeLa 229 cells as shown in Figure 3 —figure supplement 1C and D.”

Similarly, the degree to which DMKG and nucleosides affect persistence appears less consistent (in contrast to L-tryptophane) and possibly confounded by different cell lines. In Figure 6, the addition of DMKG to IFN-treated cells during infection rescues inclusion number to levels of the untreated control but significantly less in Figure 7D. The addition of nucleosides in the cells used in Figure 6 rescues persistence significantly less (as assessed by inclusion number) than DMKG, but there is no data presented from the cells used in Figure 7.

We are aware of the differences in the rescue effect of DMKG and nucleosides shown in these two figures. In Figure 7, we investigated the effect of the chlamydial trpBA mutant. This experiment was done by the student who generated the trpBA mutant with a different batch of cells and Chlamydia than the experiment performed by another person in Figure 6. We simply wanted to demonstrate in this experiment that mutant Chlamydia behave as wildtype and can be rescued with metabolites. Since the data are consistent in this set of experiment and confirm the previous observation of a rescue with metabolites, we decided to show it as a figure although the rescue did not reach the same efficiency as in Figure 6.

The organoid infection experiments seemed to be underpowered and quantification of infectivity is a little suspect (Figure S2H- inclusions were titers an uneven number of cells). U2OS and HeLa cells are transformed and their metabolism is likely to be very distinct. Thus, show if DMKG or nucleosides rescue persistence in primary Fimb cells.

We agree that quantification of infection effects is challenging in the organoid model. We therefore repeated the experiment in Fimb cells as suggested and show now a clear rescue by supplementing with DMKG. These data have been included as Figure 6H.

In addition, the reduction of LAT1 levels is quite striking in HeLa cells (Figure 5C) but very minor in U2OS cells. U2OS cells might survive better c-Myc overexpression that can be pro-apoptotic. Please acknowledge.

We discuss this possible connection in the revised version of the manuscript.

Line 468:

“Differences in reduction of LAT1 levels between HeLa 229 and U2OS cells might be due to a better survival of c-Myc overexpression that can be pro-apoptotic in U2OS cells.”

(e) In addition, the model linking IFNγ-induced tryptophan limitation to destabilisation of c-Myc via PI3K-GSK3b is not fully supported by the current evidence. Either provide direct evidence of either increased phosphorylation of threonine 58 on c-Myc or increased proteasomal degradation of c-Myc as a result of decreased levels of tryptophan upon IFNγ treatment (at the moment, it seems that phosphorylation of threonine 58 is unchanged upon IFNγ treatment (see Lines 157-162 and Figure 1E)); or remove the model and rework the text accordingly. Of note, bacterial replication also induces AKT and GSK3b.

It indeed appears that phosphorylation of threonine 58 is not affected by IFN-γ treatment, however, this strongly depends on the way we normalize the western blots. We in general normalize to actin (as loading control) to have similar normalization conditions in all figures. In case of such a strong variation of c-Myc levels like after IFN-g treatment, the normalization to loading controls gives a wrong picture. If we normalize pThr58 to c-Myc levels, we get a 4- and 7-fold increase after IFN-γ and IFN-γ/infection, respectively. These data are therefore in line with a role of pThr58 in the downregulation of c-Myc and the model we propose for GSK3b and AKT. The model we included in the manuscript shows more or less the textbook knowledge of IFN-g signalling, which we included for the better understanding of the readers. We are happy to remove these models if the reviewer prefer their deletion.

We have included the following statement in Line 168:

“while phosphorylation at threonine 58 was unchanged (Figure 1E). These results were obtained, if protein bands of the western blot were normalized to actin as loading control. However, since c-Myc levels varied significantly upon IFN-γ exposure, normalization to c-Myc protein levels revealed strongly increased phosphorylation at Thr58 (4- and 7-fold, IFN- γ and IFN- γ/infected, respectively) and a mild increase at Ser62 (1.3- and 2-fold, IFN- γ and IFN- γ/infected, respectively). These data are consistent with a role for Thr58 phosphorylation in IFN-γ-mediated downregulation of c-Myc.”

(f) Line 541-544/Figure S6E: Considering that the most pronounced effect appears to be on adenosine (Figure 6C) and ATP (Figure S6E), please consider and discuss that the effect could be mediated by reduced ATP levels generally slowing down metabolic processes rather than DNA replication in particular.

We added the following sentence in Line 626:

“Another possibility is that IFN-γ-induced reduction of ATP levels generally slowed down metabolic processes and induced chlamydial persistence.”

(g) Line 553-555/Figure 6F. The authors suggest that "restoration of chlamydial development could also be achieved by the sole addition of pyrimidine (U+C), and to a minor extend [sic] also purine nucleosides (A+G)". However, Figure 6F appear to suggest that purines (A+G) have a more significant contribution to Chlamydia trachomatis development than pyrimidines (C+U), which appear to have a statistically insignificant effect. Please clarify.

We thank the reviewers for this comment since this conclusion has to be explained better. If we talk about development, we usually test this in a secondary infection assay. This assay tells us how many of the bacteria developed to EB under certain conditions and can therefore produce progeny. This is the immunoblot in Figure 6F. In this assay of chlamydial development pyrimidines appear to rescue better. The other assay is quantification of inclusions in primary infection where the purines have a significant effect. Since inclusion formation and infectivity are different readouts, we clarified this now in the revised version of the manuscript.

Line 635: Moreover, restoration of chlamydial development could also be achieved by the sole addition of pyrimidine nucleosides (U+C), and to a minor extend also by purine nucleosides (A+G) (Western blot in Figure 6F). In contrast, purines seem to restore inclusion formation more efficiently than pyrimidines (bar diagram in Figure 6F).

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—source data 1. Complete and cutted membranes of all Western blots from Figure 1.
    Figure 1—figure supplement 1—source data 1. Complete and cutted membranes of all Western blots from Figure 1—figure supplement 1.
    Figure 2—source data 1. Complete and cutted membranes of all Western blots from Figure 2.
    Figure 3—source data 1. Complete and cutted membranes of all Western blots from Figure 3.
    Figure 3—figure supplement 1—source data 1. Complete and cutted membranes of all Western blots from Figure 3—figure supplement 1.
    Figure 4—source data 1. Complete and cutted membranes of all Western blots from Figure 4.
    Figure 4—figure supplement 1—source data 1. Complete and cutted membranes of all Western blots from Figure 4—figure supplement 1.
    Figure 5—source data 1. Complete and cutted membranes of all Western blots from Figure 5.
    Figure 6—source data 1. Complete and cutted membranes of all Western blots from Figure 6.
    Figure 7—source data 1. Complete and cutted membranes of all Western blots from Figure 7.
    Transparent reporting form
    Source data 1. Inclusion Forming Units (IFU).
    elife-76721-data1.xlsx (50.3KB, xlsx)
    Source data 2. Metabolic profiling.
    elife-76721-data2.xlsx (259.4KB, xlsx)

    Data Availability Statement

    Metabolomics data set has been uploaded with the manuscript.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES